ID: 932703266

View in Genome Browser
Species Human (GRCh38)
Location 2:74004815-74004837
Sequence CTCCCCTCGCCTCCCGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 407
Summary {0: 1, 1: 2, 2: 6, 3: 32, 4: 366}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932703259_932703266 0 Left 932703259 2:74004792-74004814 CCCCCAGGTTCCACCTCTGCTTC 0: 1
1: 0
2: 3
3: 49
4: 425
Right 932703266 2:74004815-74004837 CTCCCCTCGCCTCCCGCTGCTGG 0: 1
1: 2
2: 6
3: 32
4: 366
932703257_932703266 17 Left 932703257 2:74004775-74004797 CCTTCTCTGGAGCAGAACCCCCA 0: 1
1: 0
2: 3
3: 30
4: 206
Right 932703266 2:74004815-74004837 CTCCCCTCGCCTCCCGCTGCTGG 0: 1
1: 2
2: 6
3: 32
4: 366
932703260_932703266 -1 Left 932703260 2:74004793-74004815 CCCCAGGTTCCACCTCTGCTTCC 0: 1
1: 1
2: 5
3: 41
4: 528
Right 932703266 2:74004815-74004837 CTCCCCTCGCCTCCCGCTGCTGG 0: 1
1: 2
2: 6
3: 32
4: 366
932703262_932703266 -3 Left 932703262 2:74004795-74004817 CCAGGTTCCACCTCTGCTTCCTC 0: 1
1: 0
2: 4
3: 64
4: 617
Right 932703266 2:74004815-74004837 CTCCCCTCGCCTCCCGCTGCTGG 0: 1
1: 2
2: 6
3: 32
4: 366
932703261_932703266 -2 Left 932703261 2:74004794-74004816 CCCAGGTTCCACCTCTGCTTCCT 0: 1
1: 0
2: 6
3: 45
4: 471
Right 932703266 2:74004815-74004837 CTCCCCTCGCCTCCCGCTGCTGG 0: 1
1: 2
2: 6
3: 32
4: 366
932703263_932703266 -10 Left 932703263 2:74004802-74004824 CCACCTCTGCTTCCTCCCCTCGC 0: 1
1: 0
2: 13
3: 151
4: 1470
Right 932703266 2:74004815-74004837 CTCCCCTCGCCTCCCGCTGCTGG 0: 1
1: 2
2: 6
3: 32
4: 366

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932703266 Original CRISPR CTCCCCTCGCCTCCCGCTGC TGG Intronic
900109602 1:999978-1000000 CGCCCCGCGCCTCCCCGTGCCGG + Exonic
900270043 1:1782347-1782369 CTCCCCACGCATCCTGCTGAGGG + Intergenic
900479815 1:2892652-2892674 GTCCCCTCCCCACCCGCTCCTGG - Intergenic
900678380 1:3902337-3902359 CTCCCCTCTCCGCCCGCAGGTGG + Intergenic
901443465 1:9293118-9293140 CCCCCCGCGCCTCCCCCTCCCGG - Intronic
902072079 1:13749133-13749155 CGCCCCTCGCCCCACGCCGCGGG + Intronic
902409563 1:16205173-16205195 CTCCCCACGGCTCCCCCAGCTGG - Exonic
902539333 1:17141759-17141781 CTCCCCTCTCCTCCAGCCCCAGG - Intergenic
902559895 1:17270857-17270879 CTCCCCTGGTCTGCCCCTGCAGG + Exonic
905878932 1:41451050-41451072 CTGGCCTCCCCTCCCTCTGCCGG + Intergenic
906120926 1:43389983-43390005 CGCCCCTCACCTCCGGCTCCGGG - Exonic
907384673 1:54118331-54118353 CTCCCTCCCCCTCCCCCTGCAGG + Intergenic
908979297 1:69934867-69934889 CTCTCCTCCCCTCCCTGTGCTGG + Intronic
911348134 1:96721672-96721694 TGCCGCTCGCCTCCCGCTGCCGG + Intronic
912401646 1:109398065-109398087 CTCGCGTCGCCTCCGGCTTCGGG + Intergenic
912716962 1:111989866-111989888 CTCCCTTCCCCCGCCGCTGCCGG + Intergenic
912993278 1:114510328-114510350 CTCCCCCAGCCTCTCGCAGCCGG + Intronic
913450125 1:118987553-118987575 CTCCGCCCGCCTCCCGCGGTCGG + Intronic
914432055 1:147627666-147627688 CTCCTCTCGCAGCCCCCTGCTGG + Intergenic
915724528 1:158008148-158008170 CTCCCCACCCCCCTCGCTGCCGG - Intronic
916056707 1:161073284-161073306 CTACACTCTCCTCCGGCTGCAGG + Exonic
918044828 1:180935491-180935513 CTCCTCTCGCTGCCCGGTGCCGG - Exonic
918487665 1:185045989-185046011 GTCCCCTCGCCTCCGGGGGCGGG + Intronic
919080269 1:192857791-192857813 CTCCCCTCACCTCCCGGACCGGG - Intergenic
920498415 1:206471272-206471294 CTCCCCTCCCCTCCCTCCTCAGG - Intronic
921002207 1:211055659-211055681 CTCCCCTCTCCTCAAGCTGAGGG - Intronic
921866651 1:220094092-220094114 CTCCCCGCCCCTTCCGCTCCCGG + Exonic
922765923 1:228156758-228156780 CTCCCCTGCCCACCCTCTGCTGG - Intronic
923181982 1:231528622-231528644 CTCCCCTCCCCTCCGGACGCAGG + Intergenic
1063230693 10:4063241-4063263 CCCCCCTTCCCTCCCTCTGCAGG + Intergenic
1063407658 10:5812914-5812936 CTCCCCTCCGCTTCCGCTGGGGG + Intronic
1064208480 10:13344981-13345003 AGCCCCTCCCCTCCCTCTGCGGG + Exonic
1065343031 10:24723820-24723842 CTCCCCTCGCCTCGCCGGGCCGG + Intergenic
1066126416 10:32346993-32347015 CCCCACTCGCCAACCGCTGCCGG + Exonic
1066569378 10:36754350-36754372 CTCCCCTCCCCTCCCCTTCCCGG - Intergenic
1068544105 10:58327169-58327191 CTTCCCTGGCCTCCCGGAGCGGG + Intergenic
1069607701 10:69750107-69750129 CTCCTCTCGTCTCCCTCTGTGGG + Intergenic
1069844897 10:71364134-71364156 CTACCCTCTCCACCTGCTGCTGG - Intergenic
1070961888 10:80505250-80505272 CTCCCCTCTCCTCCTGAGGCTGG - Intronic
1071383292 10:85093391-85093413 CTCCCCTCCCCACCAGTTGCTGG + Intergenic
1072673185 10:97446449-97446471 CTCTCCTCGCCCCGCCCTGCGGG + Intronic
1073073668 10:100810145-100810167 CTCCGCTTGCCTCGCTCTGCAGG - Intronic
1073136835 10:101224874-101224896 CCCCCCGCGGCTCCCGGTGCGGG - Intergenic
1075042364 10:119118476-119118498 TTCCCCTCGCCTCCTGCTCAGGG - Intronic
1075063713 10:119274660-119274682 CTCCCTTTGCCTCCAGCTGTGGG - Intronic
1075080705 10:119381751-119381773 CTCCCCTCCCCGCCAGGTGCAGG + Intronic
1075370179 10:121928505-121928527 CTCTCCACCCCTCCCGCCGCGGG - Intronic
1075545556 10:123351954-123351976 CTCCCGCTGCCTCCTGCTGCAGG + Intergenic
1075768873 10:124917014-124917036 CTCCCCCGGCCTCCGGCAGCCGG + Intergenic
1075865970 10:125719614-125719636 CCGGCCCCGCCTCCCGCTGCGGG - Exonic
1076663243 10:132069249-132069271 CTCCCCTGGCCTCCCACCCCTGG - Intergenic
1076769562 10:132655665-132655687 CCCCCCACCCCTCCCACTGCAGG - Intronic
1076870466 10:133190464-133190486 CTGCCGTCTCCTCCCCCTGCAGG - Intronic
1076994347 11:290861-290883 CTCCCCTGGCCTGCAGCTGCAGG - Exonic
1077122746 11:917799-917821 CTCCCCACCCCTCCCCCAGCTGG + Intergenic
1077214752 11:1390647-1390669 CGCCCCTCGGGCCCCGCTGCAGG + Intronic
1077311698 11:1891662-1891684 CTCCCCGAGCCTCTCTCTGCTGG - Intronic
1077467869 11:2742191-2742213 CCCCCCAAGCCACCCGCTGCAGG - Intronic
1077919291 11:6631015-6631037 CTCCCCTTGGCTACCGCTGTAGG - Intronic
1079258203 11:18851729-18851751 CACCCCTCCCCTCCCACTGTGGG + Intergenic
1081627978 11:44666732-44666754 CTCCCCACTCCACCAGCTGCAGG - Intergenic
1081975484 11:47231856-47231878 CTCCCCTCGCCCCCAGCCCCTGG - Intronic
1083292209 11:61696487-61696509 CTCCCCTCCCCTTCCCCTGTGGG + Intronic
1083388652 11:62332224-62332246 CTCCCCCCACCTCCCAGTGCTGG - Intergenic
1083428361 11:62601273-62601295 CTCTCCTCGTCTCCCGGTTCCGG + Intronic
1083822657 11:65181755-65181777 CTCCCCGCCCCTCCCTCCGCAGG - Exonic
1083970212 11:66070056-66070078 CTCCCCTCCCCGCCCACGGCCGG - Intergenic
1084641705 11:70430173-70430195 CTTCCCTCCTCTCCCTCTGCAGG - Intronic
1084794562 11:71496525-71496547 CTCCCCTCACCTCCTGCTCTGGG + Intronic
1088481046 11:110296657-110296679 GCCCCCCCGCCTCCCCCTGCCGG + Exonic
1088840631 11:113624683-113624705 CTCTCCTCGCCACCACCTGCAGG - Intergenic
1089622253 11:119728807-119728829 CTCCGCTCTCCTCCCGGCGCCGG + Exonic
1089789027 11:120929232-120929254 CTGCCCACGCCACCCGCCGCGGG - Intronic
1090627292 11:128618157-128618179 CTCTCCCCGCCTCCCCCAGCCGG - Intergenic
1090865669 11:130698485-130698507 CTCCTCAGGCCTCCCGCTGCTGG - Intronic
1091405076 12:203875-203897 CTGCCCTCCCCGCCCTCTGCCGG - Intronic
1091461023 12:643330-643352 CTCCCCTCCCCACCCGGCGCGGG - Intronic
1092193232 12:6534733-6534755 CTCCCCTCCCCTCCCCCACCAGG - Intronic
1092894488 12:12999823-12999845 CTCCTCTCACCACCGGCTGCAGG + Intronic
1093176445 12:15918288-15918310 GCCGCCTCGCCTCCCTCTGCAGG + Intronic
1094219296 12:27975293-27975315 CTCCCCTCCCCTCTCCCTCCAGG + Intergenic
1096699136 12:53370967-53370989 CTCCCCTCCCCCGCCGCTGTAGG - Intergenic
1099955702 12:89351423-89351445 ATCCACTCGCTTCCGGCTGCGGG - Intronic
1101628062 12:106465606-106465628 CTCCCCTAGCCTCCCACCCCAGG + Intronic
1102218745 12:111180104-111180126 CTCCCCCCACCTCACCCTGCTGG + Intronic
1102820974 12:115909074-115909096 CTCCCCTGCCCTCTCCCTGCGGG + Intergenic
1102884169 12:116508919-116508941 CCCCCCTCCCCACCCCCTGCAGG + Intergenic
1103443273 12:120978914-120978936 CTCCCCTCGACCGCCGCCGCAGG - Exonic
1103507859 12:121453696-121453718 TTCCCCGCGCCTCCAGCTCCTGG - Intronic
1105243669 13:18628867-18628889 CTCCCAGCGCCTCCCCCTGGCGG - Intergenic
1105356685 13:19665407-19665429 CTGCCCTCGCCTGTCACTGCAGG + Intronic
1105885487 13:24638033-24638055 CTCCTCTTTCCTCCCGCTGGGGG - Intergenic
1105968745 13:25407910-25407932 CTCCCCTTGCCTCCCGTAGGTGG - Intronic
1106483684 13:30155137-30155159 CTCACCCCGCCTCCCCCTGCAGG + Intergenic
1107508840 13:41061450-41061472 CTCCTCTCCCCTCCCCCTACAGG - Exonic
1107662338 13:42651533-42651555 CTCCCTTCCCCTCCTTCTGCAGG + Intergenic
1110400671 13:75087609-75087631 CTCCCCACTCCTCCCACTCCTGG - Intergenic
1111815753 13:93150358-93150380 CTCCCCACCCCTCCCTCTCCTGG - Intergenic
1112533895 13:100230981-100231003 TTCCCCTCGCCTCTCTCTTCAGG + Intronic
1112891036 13:104231813-104231835 CTCCCCTCCCCTCCCCCAACAGG + Intergenic
1113115445 13:106869956-106869978 CTCCCCTAACCTCTCCCTGCGGG - Intergenic
1114495125 14:23126916-23126938 CTCCCCTCTCCTCCAGCAGCTGG + Exonic
1119286296 14:73458011-73458033 CTCTCCTCACCGGCCGCTGCCGG + Intronic
1119573379 14:75695905-75695927 CTCCCCTCCCCTCCCTCCCCAGG + Intronic
1120143605 14:80955569-80955591 CTTCCCACCCCTCCCGCTCCCGG + Exonic
1120751808 14:88204585-88204607 CTCCCCCCTACCCCCGCTGCAGG + Intronic
1121330495 14:93046580-93046602 CCCCCCCCGCCCCCGGCTGCTGG - Intronic
1122016826 14:98803497-98803519 CTGCCCACCCCTCCTGCTGCAGG + Intergenic
1122113584 14:99517137-99517159 CTGCCCTCGCCCCCCTCTGCTGG - Exonic
1122487921 14:102094213-102094235 TTCCCCTCCCCTCCCACTGTTGG + Intronic
1122779692 14:104138487-104138509 CGCCCCTCGCCGCCCGCCCCGGG + Intergenic
1122939248 14:104973879-104973901 CTCCCCTCCCCTCCGGCTGCGGG - Intronic
1123060619 14:105592590-105592612 CGCCCCTGGCCTCCCATTGCCGG - Intergenic
1123487626 15:20755764-20755786 CTCCCAGCGCCTCCCCCTGGCGG + Intergenic
1123544118 15:21324822-21324844 CTCCCAGCGCCTCCCCCTGGCGG + Intergenic
1125181838 15:36887521-36887543 CTCCCCTCGCCCCCCGCCGCTGG - Intergenic
1125676605 15:41505457-41505479 CACCCCTCGCCTCATTCTGCTGG - Exonic
1125719854 15:41840136-41840158 CTCCCCTCTCCCACCTCTGCAGG + Exonic
1127154358 15:56110445-56110467 CTCCCCTCGCCTCCCGGATGGGG - Intronic
1128218232 15:65949211-65949233 CTCCCCCGGCCTCCCCCAGCTGG - Intronic
1129317341 15:74753056-74753078 CTCCCCTCCCCTCCCAGTGTAGG + Intronic
1131318702 15:91366053-91366075 CTCCTCTCCCCTCCCACTGTGGG - Intergenic
1132055151 15:98647083-98647105 CTCCTCTCTCCTGCCACTGCTGG + Intergenic
1132105424 15:99059365-99059387 CTCCCCGCGCCTGGGGCTGCAGG - Intergenic
1132141682 15:99402401-99402423 CTACTCTCTCCTCCCTCTGCAGG - Intergenic
1132156361 15:99498390-99498412 CTCTCTTGGCCTCCAGCTGCAGG + Intergenic
1132294903 15:100727666-100727688 CTCCCCGCTGCTCCCACTGCGGG + Intergenic
1202952460 15_KI270727v1_random:52095-52117 CTCCCAGCGCCTCCCCCTGGCGG + Intergenic
1132575420 16:661655-661677 CTCCACCCGCCTCCCGGAGCCGG + Exonic
1132661268 16:1062531-1062553 GTCCCCTCGGCTCCCACGGCCGG - Intergenic
1132788866 16:1673773-1673795 CTCCTATCGACTCCCGCTGCAGG - Intronic
1132806121 16:1775965-1775987 CTCCCCCCGCCTTCTGCAGCAGG + Exonic
1133002342 16:2857678-2857700 CTCCCCTGACCTCCTGCGGCAGG + Intronic
1133136662 16:3717200-3717222 CTCCCCTCGCCACCCGCCCATGG - Intronic
1133234522 16:4381735-4381757 CTTCCCCCGCCTGCGGCTGCTGG + Exonic
1133788436 16:8990679-8990701 CTCCCCTGGCCTCCCAATGCTGG - Intergenic
1135821561 16:25691127-25691149 CACCCCTCACCTCCCTCTCCTGG - Intergenic
1136477778 16:30524303-30524325 CTCCCAGGGCCTCCCGCTGCCGG + Exonic
1138105342 16:54284772-54284794 CGCCGCTCGCCTCCCGGCGCGGG - Exonic
1139718122 16:68830422-68830444 CTTCCCTTGCCTCCCACTGCTGG + Intronic
1139770924 16:69275622-69275644 CTGGCCTTGCCTCCCTCTGCAGG - Intronic
1140471394 16:75217297-75217319 CTCCCCACTCCCACCGCTGCTGG - Intergenic
1140533213 16:75684518-75684540 CTCCCCTCTCCTCTAACTGCTGG - Intronic
1141131181 16:81438064-81438086 CTCTCCTCCCTTCCCACTGCTGG + Intergenic
1142234008 16:88912931-88912953 ATTCCCTGGCCTCCTGCTGCAGG - Intronic
1142240280 16:88941628-88941650 CTCCCCGCGCCGCCCCCCGCAGG - Intronic
1142286482 16:89173489-89173511 CTCCCCCAGCCTCCAGCTGTCGG - Intronic
1142523308 17:519930-519952 CTCCTGTCTCCTCCCGCTGTAGG - Exonic
1142669740 17:1482672-1482694 CTCCCCTCCCCTCCCGCACTGGG + Intronic
1142906770 17:3048898-3048920 TTCCCTTCGCCGCCCGCAGCTGG - Intergenic
1143018789 17:3905508-3905530 CCTCCCCTGCCTCCCGCTGCTGG + Intronic
1144299061 17:13906132-13906154 TTCCCCTGGCCTCCTGCTGCTGG + Intergenic
1145224902 17:21119953-21119975 CCCCCCGTCCCTCCCGCTGCTGG - Intergenic
1146004398 17:29151738-29151760 TTCCCCAAGCCACCCGCTGCAGG + Intronic
1146403624 17:32519325-32519347 CTGCGCTCCGCTCCCGCTGCAGG - Intronic
1148146352 17:45367417-45367439 CTGAGCTCGCCTCACGCTGCTGG + Intergenic
1148388518 17:47253775-47253797 CTCCCCTCCCCTCCCGCTGCGGG + Intergenic
1148796847 17:50201195-50201217 CCACCCTCACCTCCCGCTCCCGG + Intronic
1150293931 17:63998135-63998157 CTCCCCTCCCCTCCCCTTGCTGG - Intergenic
1150790910 17:68199569-68199591 CCCCGCTCTCCTCCCGCGGCGGG - Intergenic
1151206642 17:72512953-72512975 CTCTCCTTGCCCCCCTCTGCTGG - Intergenic
1151761012 17:76103329-76103351 CTGCCCTCTCCCCCAGCTGCGGG + Intronic
1152386773 17:79979458-79979480 GTCCTCCCGCCTCCCGCTTCAGG - Intronic
1152635135 17:81427723-81427745 CTCCCCCCGCCCCCCGCGGCTGG + Intronic
1153070412 18:1098504-1098526 CTCCCCCCGCCCCCGGCTGTAGG + Intergenic
1153457217 18:5295266-5295288 CTCCCCCGCCCTCCCGCGGCCGG + Intronic
1154445273 18:14431018-14431040 CTCCCAGCGCCTCCCCCTGGCGG + Intergenic
1155218307 18:23662564-23662586 TTCCTCTCTCCTCCAGCTGCGGG - Intronic
1157107495 18:44788264-44788286 CTACCCCTGCCTCCTGCTGCTGG - Intronic
1157481843 18:48060223-48060245 CTCCCCTCTGCTTCCCCTGCTGG - Intronic
1157483339 18:48069907-48069929 CTTCCCTCTCCTCCCGCTCCAGG - Intronic
1159946733 18:74449544-74449566 CCCCCCTGGCTTCCTGCTGCGGG + Intronic
1160628277 18:80228275-80228297 CTCCCCTCACCTCCCCATGGCGG - Intronic
1160847626 19:1173490-1173512 CTCCCCGCCCCTCCCGCTCCTGG - Intronic
1160961967 19:1726047-1726069 GTACCCTCGCCCCCCGCCGCTGG - Intergenic
1161085581 19:2333429-2333451 CTCACCACGCCTCCCACCGCAGG - Intronic
1161210195 19:3061981-3062003 CCCCCCTCCCCTCCTGCCGCCGG - Intronic
1161242292 19:3229090-3229112 CTCCCCCCGCCCCCCGCTTCAGG + Intronic
1161811746 19:6475438-6475460 GGCCCCTCGCCTCCCGGGGCAGG + Intronic
1162021239 19:7869514-7869536 CTGCCGTGGCCTCCCGCTACCGG - Exonic
1162027789 19:7904180-7904202 CTCTCCGCCCCCCCCGCTGCGGG + Intronic
1162218021 19:9152392-9152414 CTCCGCTCACCTCCTGCGGCAGG - Intronic
1162790335 19:13059463-13059485 GTCCCCTGGCCTCACGCTGGGGG - Intronic
1162971517 19:14183745-14183767 CTCCCCTCTCCTCCTGCTGGTGG + Intronic
1163334396 19:16661370-16661392 CGGCCCGCGCCACCCGCTGCCGG - Intronic
1164742247 19:30584336-30584358 ATCCCTTATCCTCCCGCTGCTGG - Intronic
1165467852 19:35985751-35985773 CTCCCCTTGCCCCCCGCTGCTGG + Intergenic
1166361091 19:42253407-42253429 TTCCCCTCCCCTCCCCCAGCCGG + Intronic
1166605821 19:44141793-44141815 CTCCCCTCGTGTCCCGCGGCGGG + Intronic
1166605831 19:44141805-44141827 TGCCCCCCGCCTCCCGCCGCGGG - Intronic
1166917685 19:46206799-46206821 CTCCCCTCTCCTGAAGCTGCAGG - Intergenic
1166919977 19:46222611-46222633 CTCCCCTGTCCTGCAGCTGCAGG - Intergenic
1167703496 19:51065072-51065094 CTGCCCTCCCCTCCCGATCCCGG - Exonic
925302357 2:2826352-2826374 CTCCCCTCACCGGCCCCTGCAGG + Intergenic
926216450 2:10908539-10908561 CTCCCCTGGCTTCTGGCTGCAGG + Intergenic
926674977 2:15612049-15612071 CTCCCCTCTCCTCCCGGAGGGGG + Intronic
927255070 2:21034066-21034088 CTCCCCTCCCCACAAGCTGCTGG - Intronic
927474515 2:23402148-23402170 CTCCCATCCCCTCCTCCTGCCGG - Intronic
927531760 2:23811595-23811617 CTCCCCTGGCCTCCCACCCCCGG - Intronic
927972999 2:27317303-27317325 ATCCACTCCCCTCCCGCTGCTGG - Intronic
929234743 2:39593931-39593953 TTCCCCTTGCCTCCCTCTGGTGG - Intergenic
929441892 2:41971273-41971295 CTCCCCTCACCTTCCCCTGCCGG - Intergenic
929650724 2:43677786-43677808 CGCCCCTCACCTCCCGCACCGGG + Intronic
929822704 2:45286179-45286201 CTCCCCTCCCAGCCTGCTGCAGG - Intergenic
930124048 2:47782901-47782923 CTCCCCTTCCCTCACGCCGCGGG - Intronic
932496407 2:72147864-72147886 CTCCCCTCCCCCGCCGCGGCCGG - Exonic
932703266 2:74004815-74004837 CTCCCCTCGCCTCCCGCTGCTGG + Intronic
932770191 2:74496850-74496872 CTCCTCTCCCCTCACACTGCAGG + Intergenic
932780233 2:74554700-74554722 CCCGCCCCGCCTCCCGCCGCAGG + Exonic
933743369 2:85552402-85552424 CTCCCCTTGCCCACCTCTGCTGG + Exonic
934713676 2:96531117-96531139 CTCTCCTAGCCTGTCGCTGCAGG + Intergenic
935574208 2:104692110-104692132 CTCCTCTCCCCTCCAGCTCCTGG - Intergenic
935922160 2:108027875-108027897 TTCCCCCAGCCTCCTGCTGCTGG + Intergenic
936059014 2:109282506-109282528 CTCCCCTGTCCTCCCACCGCAGG - Intronic
937972139 2:127559107-127559129 CTCCCCGCTCCTCCTCCTGCTGG + Intronic
939004986 2:136776400-136776422 CTCCCATGGCCTCCCAATGCAGG + Intronic
939956010 2:148528180-148528202 GTCTCCTCGTCCCCCGCTGCTGG + Intergenic
939961393 2:148568988-148569010 CTCCCCTCCACTCCCTCTGGGGG - Intergenic
941490018 2:166132031-166132053 CTCCCCTCTCTTCCCACCGCAGG + Intergenic
942653976 2:178195244-178195266 CACCCCTGCCCACCCGCTGCTGG + Intronic
945305276 2:208254311-208254333 CTCCCCTCCCCTCCCCTCGCTGG + Exonic
945314731 2:208359818-208359840 CCACCCTCGCCTTCCCCTGCAGG - Intronic
946242842 2:218367506-218367528 CTCCCCTCACCTTCCGGTCCAGG - Exonic
948501464 2:238397794-238397816 CTCACCTCTGCTCCTGCTGCAGG - Intronic
948501478 2:238397838-238397860 CTCACCTCTGCTCCTGCTGCAGG - Intronic
948501520 2:238397970-238397992 CTCACCTCTGCTCCTGCTGCAGG - Intronic
948501534 2:238398014-238398036 CTCACCTCTGCTCCTGCTGCAGG - Intronic
948501548 2:238398058-238398080 CTCACCTCTGCTCCTGCTGCAGG - Intronic
948501562 2:238398102-238398124 CTCACCTCTGCTCCTGCTGCAGG - Intronic
1168800841 20:642458-642480 CCGCCCTCGCCTCCCGCAGGGGG - Intergenic
1168965125 20:1894336-1894358 CTCCCCTCGCCTCCGGACTCCGG - Exonic
1170747112 20:19109708-19109730 CTTCCCTGTCCTCCCGCAGCAGG + Intergenic
1171217353 20:23362099-23362121 GGCCCCTCCCCTCCCGCGGCCGG - Intergenic
1172211189 20:33199621-33199643 CTCCCCTAGCCTCCCGCGGTGGG - Intergenic
1172662062 20:36574489-36574511 TTCCCCTCCCCTCCCCCTCCGGG + Intronic
1173557284 20:43974821-43974843 GCCCCCTCCCCTGCCGCTGCAGG + Intronic
1174061297 20:47834823-47834845 CTCCCCTGGACTCCAGCTCCAGG + Intergenic
1174070230 20:47894500-47894522 CTCCCCTGGACTCCAGCTCCAGG - Intergenic
1174156164 20:48516726-48516748 CTCCCCTGGGCTCCAGCTCCAGG + Intergenic
1175498972 20:59435961-59435983 CTCCCCCCGCCCCCCACTGTGGG + Intergenic
1176244968 20:64093128-64093150 CTCCCCTCCCCTCCCTGTGGAGG - Intronic
1176450718 21:6858845-6858867 CTCCCAGCGCCTCCCCCTGGCGG - Intergenic
1176828887 21:13723863-13723885 CTCCCAGCGCCTCCCCCTGGCGG - Intergenic
1178414565 21:32393247-32393269 CACCCCCCGCCCCCGGCTGCAGG + Exonic
1179209705 21:39314177-39314199 CTCGCCGCGCCTCCCGCAGAGGG + Intronic
1179618148 21:42594990-42595012 ATCCCCTCGCCTCCTACTGAAGG + Intergenic
1179728843 21:43356061-43356083 CTCCCCTGGCCTCCCCTGGCTGG - Intergenic
1180701199 22:17782239-17782261 CTCCACTCCCTTCCCTCTGCTGG - Intergenic
1181468277 22:23122445-23122467 CTCCCCTGCCCTCCAGCTGTGGG - Intronic
1181508426 22:23377503-23377525 CTCTCCTCCCCTCCCTCTGAAGG - Intergenic
1182469951 22:30542382-30542404 CTCCCCTCGCCTCCGGACTCCGG - Intronic
1183149753 22:36028435-36028457 CCCCCCTCGCCTCCGGGAGCCGG + Intergenic
1184404002 22:44289707-44289729 CTCCCCTGGCCTGCCACGGCTGG + Intronic
1184465715 22:44668275-44668297 CTCCCCGCTCCGCCCGCGGCTGG + Intergenic
1184660297 22:45962553-45962575 CTCCCCTCTCCACTCCCTGCAGG + Intronic
1184776305 22:46625221-46625243 CTCCCCTCCCCTCACCATGCTGG + Intronic
1184854279 22:47137923-47137945 CTGCCTTCGCCTCCCTCTTCAGG + Intronic
1185018713 22:48360634-48360656 CTACCCTCGCCCCCAGCTGATGG - Intergenic
1185117025 22:48943854-48943876 CTCCCCTCACTTCCCTGTGCTGG - Intergenic
949105411 3:196865-196887 CGCCCGTCCCCTCCCGCCGCTGG - Exonic
949159193 3:859902-859924 CTCTCCTGGTCTCCAGCTGCAGG + Intergenic
949447087 3:4146389-4146411 CCCCCCTCGCCTCTCTCTACTGG - Intronic
950316405 3:12004969-12004991 CTCTCCTGGCCTGCGGCTGCCGG - Intronic
950729929 3:14948074-14948096 CTCCCCTCCCCGCCCGCGGCCGG + Intronic
952257020 3:31704423-31704445 CTACCCTCTCCTCCCCCAGCTGG - Intronic
952886005 3:38011265-38011287 CTGCCGCCTCCTCCCGCTGCTGG + Exonic
953236277 3:41110369-41110391 CTCCCCTAGCCTAGGGCTGCTGG + Intergenic
953246632 3:41199542-41199564 CTCCCCTCGCTCTCCGCTCCCGG - Exonic
954642383 3:52108853-52108875 CTTCCCTTCCCTCCCCCTGCAGG + Intronic
956144901 3:66182702-66182724 CCCCCCCCGCCGCCCACTGCAGG - Intronic
958004419 3:87793259-87793281 CTCTCCCCTCCTTCCGCTGCTGG - Intergenic
960691273 3:120349024-120349046 CTTCCCGCACCTCCAGCTGCTGG - Exonic
961355705 3:126338789-126338811 CTTCCCTGGCCTCCCTCAGCTGG + Intergenic
961505731 3:127369564-127369586 CTCCCACCACCTCCCTCTGCAGG + Intergenic
963022155 3:140882787-140882809 CTCCCCTAGCCCCCCACTCCTGG - Intergenic
964571394 3:158110510-158110532 CTCCCCTCGCCCCACGTTCCTGG + Intronic
964616588 3:158672783-158672805 CTCCCCACACCTCCACCTGCTGG - Intronic
966762307 3:183428763-183428785 CTCACCCAGCCTCCCGCTCCGGG - Intronic
966928413 3:184660232-184660254 CTCCGCTGCCCTCCTGCTGCAGG + Intronic
966970367 3:185040017-185040039 CTTCCCTCCCCTCCCTCTCCTGG - Intronic
967986175 3:195097048-195097070 CTCCCCTGGCGTCCCTCTGCTGG + Intronic
968105560 3:195999166-195999188 CTCCCCGGGTCTCCAGCTGCAGG + Intergenic
968303836 3:197636748-197636770 CTCCCCGGGTCTCCAGCTGCAGG + Intergenic
968467949 4:762375-762397 CTGCCCTGGCTTCCAGCTGCTGG - Intronic
968472456 4:788306-788328 CTCCCCTCCCCTAGGGCTGCAGG + Intronic
968695929 4:2026669-2026691 CCCCCCTCTCCTCCCCCAGCAGG + Intronic
968758295 4:2427943-2427965 CTCCCCTCTCCAGCCCCTGCTGG - Intronic
968947121 4:3670914-3670936 CTCCCCAAGCCTGCCGCTCCCGG - Intergenic
969370248 4:6727327-6727349 CTCCCCACGCCCCCGGCTCCCGG - Intergenic
969564530 4:7970300-7970322 CTCCCTTAGCCTCCCCCAGCAGG - Intronic
970815584 4:20152238-20152260 CTCCCTTAGGCTCCAGCTGCTGG + Intergenic
970824022 4:20252364-20252386 CTTTCCTGGCCTCCCGCTCCAGG - Intergenic
973996976 4:56467983-56468005 CTTCCCTCGCTTCCCGCGGAGGG - Intronic
974875704 4:67700909-67700931 CGCCCCTCGCCTCCCAGGGCCGG + Intronic
980739696 4:136933133-136933155 CTCCCCTCCCTTCCTGCTCCTGG - Intergenic
980944412 4:139304846-139304868 CTCCCATCCCCTCTCGCTGCAGG + Intronic
981722476 4:147815465-147815487 CTCCCCCCGCCCCCCGCCTCCGG - Intronic
981782782 4:148445229-148445251 CAGCCCTCGCCTCCCCCCGCAGG - Intergenic
984889052 4:184474931-184474953 CTCTCCTCCCCTACCGCCGCGGG - Intergenic
990538290 5:56746485-56746507 CTCCCCTCTCCTCACACTGATGG - Intergenic
992098123 5:73381372-73381394 CCCACCTCGCCTCCAGCCGCCGG + Intergenic
993161204 5:84293703-84293725 CTCCCCCAGCCTCCCACAGCTGG - Intronic
994179732 5:96751065-96751087 CTCCCCACTCTTCCCACTGCAGG + Intronic
995198555 5:109400475-109400497 CTTCCCCCCCCTCCCCCTGCTGG - Intronic
998282978 5:140830014-140830036 CTCTCCGCGCCACCGGCTGCTGG + Exonic
999758495 5:154682753-154682775 CTCCCGCCTCCTCCCGCGGCCGG - Intergenic
1001023990 5:168207632-168207654 CTCCCCCTCCCTCCCTCTGCTGG - Intronic
1001130784 5:169061817-169061839 ATCCCCTCCCCTCCAGCTGGAGG + Intronic
1001585985 5:172834256-172834278 CGCCACTCGCCTCCCGCTGCCGG - Exonic
1002105595 5:176878136-176878158 CGCCCCTCACCCCCCGCCGCTGG + Intronic
1002494389 5:179601999-179602021 CTCCCCTTGTCTGCCACTGCAGG + Intronic
1002764287 6:226105-226127 CTCCCCCCGCCTCCCTCACCAGG - Intergenic
1002786506 6:404339-404361 CCCCCCTGGCCTCCCGCTTGTGG - Intronic
1002888079 6:1312996-1313018 CTCCCCGCGCCGCCCGCGCCTGG - Exonic
1003146043 6:3511594-3511616 CTCCCCTTGGCTCCCTCTCCTGG + Intergenic
1003832935 6:10034730-10034752 ATCCACTCGCCTCCCTGTGCAGG - Intronic
1004321147 6:14632693-14632715 CTCCACAGGCCTCCAGCTGCTGG + Intergenic
1005669582 6:28091406-28091428 CTCCTCTCGCCTCCTGGCGCTGG + Intergenic
1005841700 6:29748265-29748287 CTCCCCTGGCCTCCCGCTGCCGG - Intergenic
1006071256 6:31499206-31499228 CTCCCCTCGCCTCCGGCTCCGGG + Intronic
1006294098 6:33162146-33162168 CTTCCCTAGCCTCCCTCTCCTGG - Intergenic
1006383718 6:33716800-33716822 CTCCTCTCTCCTCCCCCTGATGG - Intergenic
1006473084 6:34238796-34238818 CTCCCCCCACCTCTTGCTGCTGG - Intronic
1006634563 6:35452617-35452639 CCCCGCCCGCCTCCTGCTGCAGG + Exonic
1006814038 6:36839102-36839124 CTGCCGTCGCCACCCGCAGCTGG + Intronic
1006944683 6:37777575-37777597 CTCCCCGCTCCTCCAGCTTCAGG - Intergenic
1007307908 6:40921493-40921515 CTCCCCCTTCCTCCCTCTGCAGG - Intergenic
1007739141 6:44000513-44000535 CTCCCCTGGCCTGCCGCGGCGGG - Intergenic
1007808872 6:44472501-44472523 CTCCCCTCCCATCCTGCTTCAGG + Intergenic
1010032795 6:71288518-71288540 CTACCCTCGCCGCCCGGAGCCGG - Intergenic
1010277922 6:73990752-73990774 CTCCCCTCTCCTCCCGCGGTGGG - Intergenic
1013911273 6:115278774-115278796 CTCCCCTCCCCACAAGCTGCAGG - Intergenic
1016590122 6:145735213-145735235 CTCCTCCCGGCTCCCGCTTCAGG + Exonic
1017009769 6:150055367-150055389 CTCCCCAGGCCTCCAGCTCCAGG + Intergenic
1017943982 6:159078580-159078602 CTCCCCACGCCTCCCATTCCTGG - Intergenic
1018325898 6:162668546-162668568 CTCCCCTCTCCTTCAACTGCTGG - Intronic
1018471982 6:164105595-164105617 ATCCCCTCCCCTCCCGCTGCAGG - Intergenic
1018836450 6:167487825-167487847 CTCCCTTCTCCTCCCGCCGCAGG + Intergenic
1018876580 6:167827031-167827053 CGCCCCTCGCCACCCCCCGCCGG - Exonic
1019318801 7:405587-405609 CTCCCCTCACTTCCCTCAGCAGG - Intergenic
1019377306 7:699678-699700 CTCCCCACCCCTCCTGCAGCTGG - Intronic
1019422528 7:957713-957735 GGCCCCTCGCCAGCCGCTGCTGG - Intronic
1019473381 7:1232931-1232953 CCGCCCGCGCCTCCCGCCGCTGG + Exonic
1019563546 7:1669267-1669289 CTCCGCTCGCCGCCAGCAGCTGG - Intergenic
1019657107 7:2201768-2201790 CTTCTCTCGCCTCTCCCTGCGGG + Intronic
1019834679 7:3370955-3370977 CTCCCTCTGCCTCCTGCTGCGGG - Intronic
1019942754 7:4304179-4304201 CTCCCCCTGCCACCCTCTGCTGG + Intergenic
1020062211 7:5160953-5160975 CTCTCTTCCCCTCCCCCTGCTGG - Intergenic
1020103161 7:5406991-5407013 AACCCCTCACCTCCCGCTGTGGG + Intronic
1020423406 7:8035865-8035887 CTCCTCTCACCACCCGCTTCAGG + Intronic
1021959582 7:25858611-25858633 CTCTCCCCGCAGCCCGCTGCAGG + Intergenic
1022049093 7:26647746-26647768 CTCCCCTCACCTGCCTCTGCTGG + Intergenic
1022425341 7:30263459-30263481 CTCCCCTCCCCTACCACTCCTGG + Intergenic
1024186022 7:46948826-46948848 CTCACCCCTCCACCCGCTGCTGG + Intergenic
1025233126 7:57216245-57216267 CTCCCCTGGGCTCCAGCTCCAGG - Intergenic
1029145354 7:98441982-98442004 CTCCCCTCTCCTCCTCCTGGTGG - Intergenic
1029598733 7:101551294-101551316 CTCAAATCGCCTCCTGCTGCGGG + Intronic
1032119871 7:129148065-129148087 CTCTCCTCACCTCCCTCTGCAGG + Intronic
1032281730 7:130508653-130508675 CTCCCTTCTCCTCCAGTTGCAGG - Exonic
1032581964 7:133111936-133111958 CTCCCTCCACCTCCCACTGCTGG - Intergenic
1032703150 7:134399397-134399419 CTCCCCTCCCCTCCAGGTGATGG - Intergenic
1032744753 7:134774368-134774390 CTCCAATCGCCTCACCCTGCAGG - Intronic
1033276263 7:139973884-139973906 CTCCACTGGCCTCCCCCTGCTGG + Intronic
1034450407 7:151134294-151134316 CTTCCCTCTCCTCCCACAGCAGG + Intronic
1034620286 7:152451663-152451685 CCCCCCCCGCCCCCCGCCGCAGG + Intergenic
1034869959 7:154675205-154675227 CTCCCCTAGCCCCCCGCCCCCGG - Intronic
1035202707 7:157277376-157277398 CTCCTCTCCCCTCCCCTTGCCGG + Intergenic
1035840738 8:2809900-2809922 TTCCCCTCTCCACCAGCTGCCGG + Intergenic
1036162967 8:6406451-6406473 CTCGCCGCGCCTCTGGCTGCTGG - Intergenic
1036788660 8:11703852-11703874 CGCCCCTCGCCCGCCGCTGCGGG + Intronic
1037150385 8:15627870-15627892 CTCCACTCAGCTCCCGCTACCGG - Intronic
1037817722 8:22120682-22120704 CTCCCCTCCCCTCCCGGCCCTGG - Intronic
1038313394 8:26463083-26463105 CTCCCCTCCCCCCCAGCTTCTGG + Intronic
1038316803 8:26491284-26491306 CTCCCCTCACCTCTTGCTGTGGG + Intronic
1039588097 8:38723719-38723741 CTCCCCACGCCCCCAGGTGCTGG + Intergenic
1040409509 8:47139848-47139870 CTCCCCTCCCCACACCCTGCAGG + Intergenic
1041206297 8:55501459-55501481 CTCCCCTCACCTCCAGCCCCTGG + Intronic
1041715025 8:60924645-60924667 CTCCCCTCCCCTCCCCATCCTGG + Intergenic
1042591689 8:70403360-70403382 CTCCGCCCGCCTCGCGCTCCGGG + Intronic
1043479776 8:80641303-80641325 CTGCCCTGGCCTGCCACTGCAGG - Exonic
1043573507 8:81630964-81630986 CCCCCCTCGCCACCCTCTCCGGG - Intergenic
1047203112 8:122782517-122782539 CTCCCCTCGCTCCCCTCTCCCGG + Intronic
1047314829 8:123723170-123723192 CTCCCCCTGCCTCCCACTGATGG - Intronic
1047343948 8:124009422-124009444 CTCCCCTGGGCTCCAGCTCCAGG - Intronic
1048239843 8:132730508-132730530 CTCCCATCATCTCCCACTGCAGG - Intronic
1048833325 8:138496866-138496888 CTGCCCTCGCCCGCCGCCGCCGG + Intergenic
1049337130 8:142092488-142092510 CTCCCCTCCCCACCCCCAGCAGG + Intergenic
1049528000 8:143138776-143138798 CACCCCTGGCCTCCACCTGCTGG - Intergenic
1049555365 8:143278817-143278839 CTCCCGTCAGCTGCCGCTGCGGG - Intergenic
1049617246 8:143581022-143581044 CTCCCCACGCCTGACACTGCAGG - Intronic
1052968842 9:34363973-34363995 CTACCCTCTCCTCAAGCTGCTGG + Intergenic
1053392538 9:37746128-37746150 CTCACCTCACCGCCCTCTGCGGG + Exonic
1057202282 9:93147999-93148021 CACCCCTCACCTCCCACTGTGGG - Intergenic
1057386820 9:94612257-94612279 CTCTCCTCTCCTCCCACTGCAGG + Intronic
1059021269 9:110579386-110579408 ATCCCCGCGCCGCCCGCTCCTGG - Exonic
1059429547 9:114241542-114241564 CTCCCCTTCCTTCCCGCTTCCGG - Intronic
1059438266 9:114289150-114289172 CTCCCCACCCCTCCCCCTCCAGG + Intronic
1059470868 9:114504391-114504413 CTCCCCTGGCCCCGCGCTGTCGG + Exonic
1060658484 9:125388790-125388812 CTCCCCATGCCACCTGCTGCAGG - Intergenic
1060789756 9:126478250-126478272 CTACCCCCGCCTGCTGCTGCTGG - Intronic
1060849095 9:126860386-126860408 CTCTCCTCGGCGCCCCCTGCTGG - Intergenic
1061406118 9:130393905-130393927 CTCCCACTGCCTCCAGCTGCAGG - Intronic
1062413693 9:136437511-136437533 CTCCCGCTGCCTCCCGCTCCTGG - Intronic
1062576760 9:137212430-137212452 CTCCCCTCACCCCCTGCTGTGGG + Intronic
1203518464 Un_GL000213v1:25672-25694 CTCCCAGCGCCTCCCCCTGGCGG + Intergenic
1190054725 X:47174933-47174955 CTCCCCTCGGGTCCCGCCCCCGG + Intronic
1191640814 X:63428616-63428638 CTCCCCTCTCCTCTAACTGCTGG - Intergenic