ID: 932704829

View in Genome Browser
Species Human (GRCh38)
Location 2:74015393-74015415
Sequence TAATAGTGATTATACTGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 1, 2: 1, 3: 12, 4: 190}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932704829 Original CRISPR TAATAGTGATTATACTGGGA TGG (reversed) Intronic
903251339 1:22055258-22055280 TTATAGTTTTTATACTGAGATGG + Intronic
905276267 1:36820113-36820135 TAAGAGTGCTTTTTCTGGGATGG - Intronic
907697594 1:56748700-56748722 TCATAGTGCTTATATTGAGAAGG - Intronic
907934345 1:59028874-59028896 TAATAGTGGTTATATCTGGATGG - Intergenic
909077760 1:71072870-71072892 TAATCGTAATTCTTCTGGGAAGG + Intronic
911569460 1:99505432-99505454 AAATAGTGGTTATCCTTGGATGG - Intergenic
912305840 1:108565934-108565956 TAATAGTGATTATCCCTGGGTGG - Intronic
912530675 1:110318968-110318990 TAATAATAATAATAATGGGATGG + Intergenic
912596617 1:110885153-110885175 TAATAGTGTAGAGACTGGGAAGG - Intronic
916331055 1:163617569-163617591 TAATAGTGGTTTGACTTGGATGG + Intergenic
918541043 1:185633499-185633521 TATTATTGATTATTCTGGGGTGG + Intergenic
918734511 1:188042028-188042050 TATTAGAGTTTATACTGGAAAGG - Intergenic
918852939 1:189715909-189715931 AAATAATAATTTTACTGGGATGG + Intergenic
922448760 1:225719598-225719620 TAAGAGCTATTATAATGGGAAGG + Intergenic
922561690 1:226574501-226574523 TCACAGTGATTACACAGGGAAGG - Intronic
923624232 1:235601143-235601165 AAACAGTGATGATACAGGGAAGG + Intronic
923910770 1:238440921-238440943 TAAAAATGATTATATTGGGAAGG + Intergenic
924876640 1:248112000-248112022 TATTCGTGAGTATTCTGGGATGG + Intergenic
1063584724 10:7341774-7341796 TAATATTGATTAAACAAGGATGG + Intronic
1064558629 10:16573284-16573306 TAAAAATGAGTATACAGGGAGGG - Intergenic
1064792903 10:18979044-18979066 TATTATTGATTAGACTGAGATGG + Intergenic
1064858834 10:19802683-19802705 TAATAGTGGTTATTAAGGGATGG + Intergenic
1065644340 10:27818865-27818887 TGATAGTGATTTTTCTAGGAAGG - Intronic
1065644460 10:27819766-27819788 TGATAGTGATTTTTCTAGGAAGG + Intronic
1066988849 10:42493136-42493158 TAATTAGGATTATATTGGGATGG - Intergenic
1068176495 10:53466446-53466468 AAATAGTGATTTTGCTGGCAAGG + Intergenic
1068431052 10:56933033-56933055 TAAAAGTATTTATATTGGGAAGG - Intergenic
1069438988 10:68410844-68410866 TAATAGTGATTATTCTTTAATGG - Intergenic
1070571586 10:77643601-77643623 TAATAGTGGTTATTTTGGGGTGG - Intergenic
1070575764 10:77677413-77677435 TAAAAGTGATAACAGTGGGAGGG + Intergenic
1071139943 10:82497386-82497408 GAATGGTGATTATTCTGGGCTGG - Intronic
1071597327 10:86937810-86937832 TAATAATGCTAACACTGGGAAGG + Intronic
1071779040 10:88822453-88822475 TAAGAGTGATACAACTGGGAAGG + Exonic
1074265511 10:111898945-111898967 TAATAGTGATTACTTTGGGAGGG + Intergenic
1074357062 10:112795902-112795924 TAATGGTGTTTATACTCGGGTGG - Intronic
1076293164 10:129363189-129363211 TGAGAGTGAACATACTGGGAAGG + Intergenic
1076375004 10:129977689-129977711 TAATAGAGGTTCTGCTGGGAAGG + Intergenic
1081039160 11:38189406-38189428 TAAGAGAGATTATCCTGGGTGGG - Intergenic
1085923861 11:80991039-80991061 TAAAAGGGATTATTCTGGGTGGG + Intergenic
1086405930 11:86498993-86499015 TAATAATCATGATTCTGGGAGGG + Intronic
1090098300 11:123766626-123766648 TAAAAGTGTTTATAGTGTGAGGG + Intergenic
1093650811 12:21643639-21643661 TTATAAAGATTATCCTGGGATGG - Intronic
1095235783 12:39793889-39793911 TAAAAGTCATTAGAATGGGAGGG - Intronic
1095820482 12:46473046-46473068 CAATAGAGATTAAACTAGGAAGG - Intergenic
1096864478 12:54553980-54554002 TAATAATAAATATATTGGGAAGG + Intronic
1097956049 12:65486262-65486284 TAATAGTGTTTATTTTGTGAGGG - Intronic
1099616809 12:84946445-84946467 TTATAGTGATTTGTCTGGGATGG + Intergenic
1099698026 12:86045303-86045325 TAATACTATTTATATTGGGAAGG + Intronic
1100250551 12:92817975-92817997 TACTAGTGCTTATACAGGGCTGG - Intronic
1102488482 12:113274154-113274176 AAATAGTTGTTATACTGGGCTGG + Intronic
1104087099 12:125485421-125485443 TAATAGTGGTGATACTGTGTAGG - Intronic
1106201053 13:27537666-27537688 CAATAGTGATCATTCTAGGAAGG - Intergenic
1106236903 13:27870173-27870195 TAATAGCAATTATCCTTGGATGG - Intergenic
1106989819 13:35404998-35405020 TAAGAGAGATGATACTGGAAAGG + Intronic
1108450772 13:50560505-50560527 TACAAGTGTTTCTACTGGGATGG - Intronic
1108983021 13:56544181-56544203 GTATAGAGATTTTACTGGGATGG + Intergenic
1109815041 13:67570305-67570327 TAATGGTGATTTGGCTGGGATGG + Intergenic
1109879785 13:68456877-68456899 AAATAGTGGTTATATTGGGAAGG + Intergenic
1110478153 13:75942174-75942196 TAATTTTGATTATTCTGAGAAGG + Intergenic
1110917039 13:81033656-81033678 TAATTGTAATTATATTGGGCTGG - Intergenic
1111937826 13:94574773-94574795 AAATGGTGATTATACCGGAAAGG + Exonic
1111947090 13:94677417-94677439 TAGTGGTGATTATAATGAGAGGG + Intergenic
1112833935 13:103490646-103490668 TAATAGTGATTCGACAGTGATGG + Intergenic
1114005564 14:18309579-18309601 CCATATTGATTATAGTGGGAAGG - Intergenic
1114587506 14:23827598-23827620 TAGTAGGGATTCTAGTGGGAGGG - Intergenic
1115163985 14:30427592-30427614 TCATAGTGAGCATACTGAGATGG + Intergenic
1116285391 14:42964859-42964881 TAATAGCTATCATACTGAGATGG + Intergenic
1116587362 14:46724606-46724628 AAATAGTCATTATTCTGGTATGG + Intergenic
1116625623 14:47259207-47259229 TAAGAGTGATTATAATGGGTGGG + Intronic
1118678720 14:68216866-68216888 TAGTAGTGATTAGGCTGAGAGGG - Intronic
1119577360 14:75737821-75737843 TGATAGTGATTATACTGAGATGG + Intronic
1121659115 14:95621450-95621472 TGATTGTGATTAAACTGGTATGG - Intergenic
1126041962 15:44600176-44600198 TAACAGTGATTACATTTGGATGG - Intronic
1126325623 15:47473860-47473882 TATTAGTGACTATATTGTGATGG + Intronic
1128741407 15:70086320-70086342 TAATTCTGATAATACTGGCAGGG - Intronic
1130061253 15:80571749-80571771 TCATAGTTGTTATACTAGGATGG - Intronic
1132075599 15:98817337-98817359 TAATAGTAAGAATACTGGGGTGG + Intronic
1133687556 16:8180421-8180443 TAATAATGAATATATAGGGAAGG + Intergenic
1133687569 16:8180496-8180518 TAATAATGAATATACAGGGAAGG + Intergenic
1133687574 16:8180521-8180543 TAATAATGAATATATAGGGAAGG + Intergenic
1140052213 16:71491869-71491891 GAATAGTGATTATTTTGGGGAGG - Intronic
1140080846 16:71745662-71745684 TAATGGTGATTATTTTGGGTAGG - Intronic
1144108445 17:12008347-12008369 TAATAGTAGTAATAATGGGATGG - Intergenic
1149169931 17:53797093-53797115 AAATAGTGATTATGCTTGAAAGG + Intergenic
1149175994 17:53870732-53870754 TAATTGAGATTATATTGGGTTGG + Intergenic
1151722230 17:75863800-75863822 TAATAGTGATTCTACTGAGGGGG + Intergenic
1154531866 18:15354295-15354317 CCATATTGATTATAGTGGGAAGG + Intergenic
1155376909 18:25168819-25168841 TAAGTGTGAGTAAACTGGGAAGG + Intronic
1155715389 18:28936538-28936560 TAATAGTGATTATAAAGATAAGG + Intergenic
1159173844 18:64809425-64809447 TACTAGTGATAATACTGCAATGG + Intergenic
1159639529 18:70847526-70847548 TATTAGCGATTATCCTGGTAAGG - Intergenic
1159892059 18:73962241-73962263 AAAGAGAGATTATCCTGGGAGGG - Intergenic
1161450998 19:4345341-4345363 TAATAGTAATAATACAGGGCTGG - Intronic
926758427 2:16254305-16254327 TAATGGTGATTAGCCAGGGAGGG - Intergenic
926941151 2:18138419-18138441 TAAGAGTGATTAGACAGGAAGGG - Intronic
928342016 2:30452052-30452074 GAATAGTGATTACTCTGGGTTGG + Intronic
930634914 2:53793701-53793723 AAATAGTGATTATACTTGGGAGG - Intronic
931290863 2:60872056-60872078 TGATAGTGATTATATTAAGACGG - Intergenic
932546998 2:72722994-72723016 AAAATGTGACTATACTGGGAAGG - Intronic
932704829 2:74015393-74015415 TAATAGTGATTATACTGGGATGG - Intronic
933711429 2:85328583-85328605 TAATAGTGATTATCCCGGAAGGG - Intergenic
934068683 2:88363951-88363973 TAAAAGTGATTAAATTGGGCCGG + Intergenic
938530965 2:132185531-132185553 CCATATTGATTATAGTGGGAAGG + Intronic
939267700 2:139894915-139894937 TAATAGTTGTTATACTGTTAGGG - Intergenic
939562139 2:143744664-143744686 CAATAGTGATTATAAAGAGAGGG - Intronic
940897354 2:159093688-159093710 TGAGAGTGATTATAGTGAGATGG + Intronic
941897207 2:170641176-170641198 AAATGGTGAATAAACTGGGAGGG + Intronic
942879386 2:180840469-180840491 TTCTAGTGCTTATAATGGGAAGG + Intergenic
944384612 2:199150649-199150671 TAATCCTGATTATAATGAGAGGG + Intergenic
944425760 2:199581381-199581403 TAATTGTGGATAAACTGGGAAGG + Intergenic
948697800 2:239742093-239742115 TAGTACTGATCAAACTGGGATGG - Intergenic
1168928652 20:1603653-1603675 TAATAGTGATGACTCTTGGAGGG + Intronic
1169286279 20:4310018-4310040 TAATAGTGATGATGATGGTAAGG + Intergenic
1170337332 20:15284213-15284235 TCATAGCGATGATACAGGGAGGG - Intronic
1172708725 20:36903177-36903199 AACTAGTGATTTTACAGGGAGGG + Intronic
1173011634 20:39188501-39188523 TAAAAGTGGTTTTCCTGGGAGGG + Intergenic
1176520902 21:7823470-7823492 TAATAGTGAGTTCACTGAGAAGG + Intronic
1176765495 21:13013878-13013900 CCATATTGATTATAGTGGGAAGG - Intergenic
1178654922 21:34453482-34453504 TAATAGTGAGTTCACTGAGAAGG + Intergenic
1180430073 22:15240365-15240387 CCATATTGATTATAGTGGGAAGG - Intergenic
1181077931 22:20393868-20393890 TAATTGCGAGGATACTGGGAGGG - Intergenic
949367605 3:3300124-3300146 TAACATTGTTTATTCTGGGAGGG - Intergenic
949930406 3:9073923-9073945 TAACTGAGATTATACGGGGATGG + Intronic
949966544 3:9361647-9361669 TAATGGCGATTATAGAGGGAGGG - Intronic
953233289 3:41083706-41083728 AGATAGTGGTTATACTTGGAAGG - Intergenic
957197339 3:77086243-77086265 TAATAATGCTTATACTAGTAGGG + Intronic
957815168 3:85288881-85288903 TAATAGTGAATGTACTGTGTAGG - Intronic
962049238 3:131795445-131795467 TAATGGTGATTATCAAGGGAGGG - Intronic
963390866 3:144662649-144662671 TAATAGTGACAATACTGAGGAGG - Intergenic
964144723 3:153445418-153445440 GAATAGAGAGTATACTGTGATGG + Intergenic
964291889 3:155190380-155190402 TATTAGTGCTTATACAGGGAAGG - Intergenic
964807048 3:160621767-160621789 GAAGAGTGACTATACAGGGATGG - Intergenic
965386088 3:168048529-168048551 TAATAGGCATTATTCTGGGCTGG + Intronic
968328078 3:197838892-197838914 TAATAGTGAGTTCACTGGGCAGG - Intronic
972356707 4:38285994-38286016 TAATAGTGGTTATATCTGGAGGG - Intergenic
973202383 4:47519246-47519268 TAACAGTGATTCCACTAGGATGG - Intronic
975235637 4:71992085-71992107 TAATAGTGATTTTTCTCAGATGG + Intergenic
975710161 4:77153516-77153538 CAATAGTGAGTAGACGGGGAGGG + Intergenic
975819003 4:78250680-78250702 CAAGTGTGATTATACTGGGGAGG + Intronic
977191767 4:94009792-94009814 TTATGGTGATTACACTGGGCTGG + Intergenic
979236211 4:118403458-118403480 TAATAGTGTTTATCTTGGGATGG - Intergenic
979293459 4:119003651-119003673 ACATAGAGACTATACTGGGAGGG - Intronic
979838138 4:125400224-125400246 TAATAGATATTCTAATGGGATGG + Intronic
980298904 4:130962673-130962695 TAATAGTAATTTTACAGAGATGG + Intergenic
980666543 4:135945732-135945754 TAATATTGACTATACTGCAAAGG + Intergenic
983246050 4:165288385-165288407 TAATAGTGATTATCTTTAGAGGG - Intronic
984958616 4:185071745-185071767 CAGTAGTGATTATACTGACATGG + Intergenic
987209050 5:15659870-15659892 TAATAGTGCTTATATTGTGGAGG + Intronic
988543373 5:32133556-32133578 TAATAACGTTTATACTGTGATGG - Intronic
991707612 5:69373253-69373275 TTCTAGTGTTTATGCTGGGAAGG + Intronic
992425505 5:76652812-76652834 TAATACTGATTCTATTGTGAAGG + Exonic
993955782 5:94230843-94230865 TAACAGTGAAAATATTGGGAAGG - Intronic
995776844 5:115732616-115732638 TAATAATGATGATATTGGGGAGG + Intergenic
997177374 5:131793329-131793351 TAAAAGTGATTATTTTGGGCTGG - Intronic
997212248 5:132083887-132083909 GAATAGTGGCTATACTTGGAGGG - Intergenic
997876667 5:137555025-137555047 TGATAGTGATTATACTTTTAGGG - Intronic
998035759 5:138914510-138914532 TAATAGTTCATAAACTGGGATGG + Intronic
999549887 5:152675238-152675260 TCCTAATGCTTATACTGGGATGG + Intergenic
999875905 5:155805477-155805499 TAATAATAAATATTCTGGGATGG + Intergenic
1000491775 5:161922914-161922936 AAGTAGTGAGTATCCTGGGATGG + Intergenic
1001889262 5:175325498-175325520 TAACAGTGATTATCTTAGGATGG - Intergenic
1003408441 6:5841877-5841899 GAATAGTGAAAATAGTGGGAGGG + Intergenic
1004031922 6:11879045-11879067 AAATAATGTTTAGACTGGGAGGG - Intergenic
1004278400 6:14258259-14258281 TAAAAGAGAATAAACTGGGAGGG + Intergenic
1009606444 6:65874875-65874897 TAAAACTGATTATTCTAGGATGG - Intergenic
1011344268 6:86351912-86351934 TAATATTGATTAAAATTGGATGG + Intergenic
1012449878 6:99343853-99343875 TAAAAGTGGGGATACTGGGAAGG - Intronic
1012617014 6:101289799-101289821 TAAAAGGTATTATATTGGGAGGG + Intergenic
1014942582 6:127460527-127460549 TAATAGTGATTATTCACTGAGGG + Intronic
1016036753 6:139391136-139391158 TAATATGGATCATACTGGGCCGG + Intergenic
1020506268 7:8992616-8992638 TAATAGTCATTGTCATGGGAAGG + Intergenic
1020762261 7:12283208-12283230 AAAGAGTTACTATACTGGGAGGG - Intergenic
1021060060 7:16100159-16100181 TAATAATGATTATACTGGGATGG - Intronic
1022829388 7:34049958-34049980 CAGAAGTGATTATAATGGGATGG + Intronic
1028718846 7:94005436-94005458 TAAGAGTTATTAACCTGGGAAGG + Intergenic
1028914714 7:96245276-96245298 TAATGGTTATTTTACAGGGAGGG - Intronic
1032558668 7:132864897-132864919 AAATAGTGTTTATTCTGGGAAGG - Intronic
1033981895 7:147175536-147175558 TCATAGTGGTTTCACTGGGAGGG - Intronic
1034824394 7:154248425-154248447 GAACAGTGATTATTATGGGAGGG + Intronic
1036065553 8:5377820-5377842 TAATATTTATTATTCTGTGAGGG - Intergenic
1038096747 8:24321160-24321182 TAAAAATGAATATACTTGGAAGG - Intronic
1039507104 8:38060014-38060036 TGAAAGTGATCATACTGGGCAGG + Exonic
1042513889 8:69639807-69639829 TGATATTGATCATTCTGGGATGG - Intronic
1043179724 8:77072278-77072300 TAATAGTAATTATACTAGAGAGG - Intergenic
1043208403 8:77477168-77477190 GAATAATGATTACACTGGGTAGG + Intergenic
1045093722 8:98774607-98774629 TAATAGTAATTAAACTTGGCAGG - Intronic
1047760934 8:127953885-127953907 TAGTTGGGATTCTACTGGGAAGG - Intergenic
1049580917 8:143410443-143410465 TAATAGTGATGATAATGTGATGG + Intergenic
1052231547 9:26160417-26160439 AAAGAGTTATAATACTGGGAGGG + Intergenic
1052343613 9:27386311-27386333 TAATAATGATAATACTGAAATGG - Intronic
1053709572 9:40792056-40792078 CCATATTGATTATAGTGGGAAGG + Intergenic
1054419476 9:64912844-64912866 CCATATTGATTATAGTGGGAAGG + Intergenic
1054860646 9:69949363-69949385 TAATTGTGTTTATACAGGAAAGG + Intergenic
1058627335 9:106948571-106948593 GAATAGAGATTATTCTGGGTAGG - Intronic
1060189961 9:121586153-121586175 TAAAGCTGATTATTCTGGGAGGG + Intronic
1061278576 9:129583865-129583887 CTATAGTGATTAAACAGGGATGG + Intergenic
1187625473 X:21107893-21107915 TAATAGCAATTAAAGTGGGAAGG + Intergenic
1188527467 X:31101565-31101587 TAATGGGGGTTATGCTGGGATGG + Intronic
1188581956 X:31724791-31724813 TAATAGTACTTATGCTGGTAGGG - Intronic
1192110793 X:68361899-68361921 TAATAGTGATTATAACAGGTAGG + Intronic
1193133455 X:77943679-77943701 TAATAGTGATTACCCTTTGAGGG - Intronic
1194899562 X:99493081-99493103 TAATAGTGTTTATATTTGGGTGG + Intergenic
1195035370 X:100967141-100967163 TATTAGTAATGATTCTGGGATGG + Intergenic
1195946361 X:110217110-110217132 TAAAAAAGATTATACTAGGAAGG + Intronic
1198148195 X:133879970-133879992 TAAAACTGAATATAATGGGAAGG + Intronic