ID: 932705401

View in Genome Browser
Species Human (GRCh38)
Location 2:74020688-74020710
Sequence TCAAGCCCTTGAACAAGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 123}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932705401_932705411 25 Left 932705401 2:74020688-74020710 CCACCTCTTGTTCAAGGGCTTGA 0: 1
1: 0
2: 0
3: 8
4: 123
Right 932705411 2:74020736-74020758 ATCCCTGCTGTTGTTAAGCAGGG 0: 1
1: 0
2: 0
3: 5
4: 126
932705401_932705406 0 Left 932705401 2:74020688-74020710 CCACCTCTTGTTCAAGGGCTTGA 0: 1
1: 0
2: 0
3: 8
4: 123
Right 932705406 2:74020711-74020733 GGGCTATGCCCTTGGAGAGAAGG 0: 1
1: 0
2: 1
3: 22
4: 183
932705401_932705412 26 Left 932705401 2:74020688-74020710 CCACCTCTTGTTCAAGGGCTTGA 0: 1
1: 0
2: 0
3: 8
4: 123
Right 932705412 2:74020737-74020759 TCCCTGCTGTTGTTAAGCAGGGG 0: 1
1: 0
2: 0
3: 9
4: 161
932705401_932705410 24 Left 932705401 2:74020688-74020710 CCACCTCTTGTTCAAGGGCTTGA 0: 1
1: 0
2: 0
3: 8
4: 123
Right 932705410 2:74020735-74020757 AATCCCTGCTGTTGTTAAGCAGG 0: 1
1: 0
2: 0
3: 8
4: 117
932705401_932705407 1 Left 932705401 2:74020688-74020710 CCACCTCTTGTTCAAGGGCTTGA 0: 1
1: 0
2: 0
3: 8
4: 123
Right 932705407 2:74020712-74020734 GGCTATGCCCTTGGAGAGAAGGG 0: 1
1: 0
2: 3
3: 10
4: 184
932705401_932705405 -8 Left 932705401 2:74020688-74020710 CCACCTCTTGTTCAAGGGCTTGA 0: 1
1: 0
2: 0
3: 8
4: 123
Right 932705405 2:74020703-74020725 GGGCTTGAGGGCTATGCCCTTGG 0: 1
1: 0
2: 1
3: 11
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932705401 Original CRISPR TCAAGCCCTTGAACAAGAGG TGG (reversed) Intronic
906259578 1:44376713-44376735 TACAGCTCTTGACCAAGAGGAGG - Intergenic
907512090 1:54969363-54969385 TTAAGACCTAGAACAAAAGGTGG + Intergenic
907922029 1:58922716-58922738 TCAGGCCCTTTAAAATGAGGTGG + Intergenic
910447669 1:87315258-87315280 TCCAGTACTTGAAAAAGAGGAGG - Intergenic
911048519 1:93649419-93649441 TCAAGCTCTTGGGAAAGAGGTGG - Intronic
915040625 1:152965550-152965572 TCAGGCACTTGAAGAAGGGGAGG - Intergenic
915910296 1:159910682-159910704 TTGAGGCCTTGAACAAGAGTTGG - Intergenic
916511960 1:165480187-165480209 TCAAGCTCTTAAACAGGTGGGGG - Intergenic
917815971 1:178710721-178710743 TCAAGATCTAGGACAAGAGGTGG - Intergenic
919627534 1:199926269-199926291 GCAAGGCCTTCAACATGAGGGGG + Intergenic
1063704162 10:8414806-8414828 TCAAGCCCCTGAACCAGGGTTGG + Intergenic
1066614671 10:37282820-37282842 ACAAACCCTGGAAAAAGAGGTGG - Intronic
1073310189 10:102534808-102534830 TAAAGCCCTAGAGCAACAGGAGG + Intronic
1076133566 10:128029693-128029715 ACAAGCCTTTCAAGAAGAGGAGG + Intronic
1077059356 11:611009-611031 TCAAGCCCTTCTACCAGAAGAGG + Exonic
1077905641 11:6530732-6530754 TGAACCCCCTGTACAAGAGGAGG - Intronic
1078343165 11:10516423-10516445 TCTAGCCCCTGATCAAGAAGCGG + Intronic
1081629002 11:44674943-44674965 TCCAGCCCTTACTCAAGAGGAGG - Intergenic
1083442872 11:62688412-62688434 TCAAGACTTTGAAGAAGAGGAGG - Exonic
1087212879 11:95461362-95461384 ACTAGCCCTTGAAAAGGAGGTGG - Intergenic
1090290042 11:125535302-125535324 GAATGCCCTTGAGCAAGAGGAGG - Intergenic
1090771995 11:129928915-129928937 ACTAGCCCTTGAAAGAGAGGAGG - Intronic
1095202710 12:39403182-39403204 TCAAACCCTTGAACACCTGGGGG + Intronic
1103057155 12:117830676-117830698 TCAAGCCCTTGAGGCAGACGTGG + Intronic
1103522864 12:121548015-121548037 TCAAGTCCTTGAACATGGAGGGG + Intronic
1103728415 12:123010606-123010628 ACCGGCCCTTGAACAAGAGGTGG + Intronic
1103824153 12:123722808-123722830 TCAATTCCTTGCACAAGAAGAGG - Intronic
1104154232 12:126115989-126116011 TCAACTCCATGAAAAAGAGGAGG - Intergenic
1105422678 13:20266772-20266794 ACAAGCCCCTGAAGCAGAGGAGG - Intergenic
1107894324 13:44945460-44945482 ACAAACCCTTAAAAAAGAGGAGG + Intronic
1108782106 13:53848951-53848973 TCAAGCCCTGGGAGAATAGGAGG + Intergenic
1109849055 13:68036505-68036527 CCAGGCCCTTGAACATGAGCAGG - Intergenic
1113543778 13:111130893-111130915 TCAAGGCCTGGGGCAAGAGGAGG + Intronic
1115620209 14:35133746-35133768 TCATGGCCTTGAACAAGATCAGG + Intronic
1118264194 14:64278836-64278858 TAATGCCCTTGGCCAAGAGGAGG - Intronic
1122828745 14:104385091-104385113 TCAAGCCCAGGCACAGGAGGCGG + Intergenic
1129594306 15:76948531-76948553 TCAGGGCATTGCACAAGAGGAGG + Exonic
1133255434 16:4513379-4513401 TCAAGCCCATGACCAAGAGAGGG + Intronic
1133832716 16:9338977-9338999 TCAAGCCAATGAGGAAGAGGAGG - Intergenic
1134644392 16:15854850-15854872 TCAAACCTCTGAATAAGAGGGGG + Intronic
1135059692 16:19260647-19260669 GAATGCCCTTGACCAAGAGGAGG + Intronic
1135291984 16:21247720-21247742 TCAAGTCCTTGTAGGAGAGGAGG + Intronic
1137250926 16:46740383-46740405 TGAAGCCCTGGAAAAGGAGGTGG - Intronic
1137738757 16:50743948-50743970 TTAATCCCTTAAACAGGAGGAGG + Intronic
1138576406 16:57910092-57910114 GAAAGCCCTTGGCCAAGAGGAGG - Intronic
1140632433 16:76870253-76870275 TCAAGGCCTTTAACAAGAAGTGG - Intergenic
1152060539 17:78071069-78071091 TCATGCCCTTGAACAAAGTGTGG - Exonic
1161969046 19:7566027-7566049 TCAAGCTCTGGAACCAGAGAGGG - Intergenic
1162316168 19:9939396-9939418 ACAAGCTCTTGACCAAGAGTGGG + Intergenic
1164700594 19:30281413-30281435 TCAAGCCCTTAAGCAAGTGCAGG - Intronic
1168685322 19:58346129-58346151 TCAACCCCATCACCAAGAGGAGG - Intronic
925736560 2:6969002-6969024 TATAGCCCTGGACCAAGAGGCGG - Intronic
929506030 2:42528807-42528829 TCAACCCCCAGAACAAGAAGAGG + Intronic
930956420 2:57207977-57207999 TCAAGCTGTTGTAGAAGAGGTGG + Intergenic
932705401 2:74020688-74020710 TCAAGCCCTTGAACAAGAGGTGG - Intronic
932737490 2:74264469-74264491 ACGTGCCCTTGAACAGGAGGAGG - Intronic
936977555 2:118234762-118234784 TTAGACCCTTGAACAGGAGGAGG - Intergenic
941729067 2:168895832-168895854 TCAAGTCCTTGAACACTTGGAGG + Intronic
943954513 2:194171383-194171405 TCAAGGCCTTGAAAAACAAGGGG - Intergenic
944276017 2:197838790-197838812 TCAAGCCCATGAGCCAGAGCTGG + Intronic
946378558 2:219329177-219329199 TAAGGCCCTGAAACAAGAGGTGG - Exonic
1178047941 21:28716677-28716699 TTAAGACCTGGAACAAGATGAGG - Intergenic
1180985184 22:19899946-19899968 TTCAGTCTTTGAACAAGAGGAGG + Intronic
950256783 3:11512330-11512352 TGGAGCCCTTGACCCAGAGGTGG - Intronic
950770719 3:15308647-15308669 TCAATCCCATGAACAATGGGAGG + Intronic
951709984 3:25577361-25577383 GCAAGCCCTAGAAAAAGGGGTGG + Intronic
953539822 3:43807712-43807734 TCAACCCCTTTTACAAGAGCTGG + Intergenic
955859315 3:63310754-63310776 TCCAGCCCTAGAACAAGGTGTGG + Intronic
958077394 3:88699320-88699342 TAATGCCCTTTAAGAAGAGGAGG + Intergenic
961323094 3:126092003-126092025 TCAGGTCCTTGGCCAAGAGGAGG + Intronic
961470702 3:127109660-127109682 GCAAGCCCTCTACCAAGAGGCGG - Intergenic
964980448 3:162670825-162670847 TTCAGCCCCTGAACAAGAAGGGG + Intergenic
969073114 4:4555704-4555726 TCAAGCACATGAACCAGTGGTGG + Intergenic
972369015 4:38404205-38404227 TAAAGCCCCTGAACAATAGCCGG - Intergenic
974455110 4:62120336-62120358 ACAAGCCCTTTAAGCAGAGGTGG - Intergenic
974795465 4:66743220-66743242 TCAAGTCTCTGAACAAGAGGAGG - Intergenic
980263863 4:130490893-130490915 TCAGGACATTGAATAAGAGGAGG - Intergenic
981069064 4:140515892-140515914 ACATCCCCTTGACCAAGAGGAGG - Intergenic
981968628 4:150637446-150637468 TCAAGACCATGAACACTAGGAGG - Intronic
982001784 4:151027376-151027398 TCAATACCATGAACATGAGGTGG - Intergenic
982135234 4:152268891-152268913 TCAAGCCTTTTTACAAGAAGAGG - Intergenic
983064848 4:163196323-163196345 TAAAGCCCTAGAAATAGAGGAGG - Intergenic
984872166 4:184335468-184335490 TTTTTCCCTTGAACAAGAGGAGG + Intergenic
986270767 5:6228717-6228739 TCAAGCCCTTGCACTAGTGCTGG + Intergenic
990412149 5:55552108-55552130 TCAATCCCATGTACATGAGGTGG + Intergenic
991667591 5:69014613-69014635 TCAAGCCTTTGAAGAGGAGAAGG - Intergenic
997607548 5:135185948-135185970 TCAAGCCCTAGCTCAGGAGGAGG + Intronic
998385360 5:141754245-141754267 TCTCAACCTTGAACAAGAGGTGG - Intergenic
998414807 5:141938435-141938457 CCAAGCCCTTGAAGAAGTGCTGG + Intronic
998590314 5:143471305-143471327 TCAAGGCTCTGAATAAGAGGTGG + Intergenic
1003715341 6:8640039-8640061 TCAAGCCCCAGACCAAGGGGTGG - Intergenic
1007589544 6:43013174-43013196 CCAAGATCCTGAACAAGAGGAGG - Exonic
1009990138 6:70832705-70832727 GAGAGCACTTGAACAAGAGGGGG + Intronic
1012962005 6:105631805-105631827 TAAAGCCCTTGAACAAGGCTTGG + Intergenic
1013419236 6:109951106-109951128 GAATGCCCTTGACCAAGAGGAGG + Intergenic
1014298071 6:119644650-119644672 TCTAGGCCTTGAAAAAGAGCTGG - Intergenic
1018415802 6:163601168-163601190 AGAAGCCCATGAACATGAGGCGG - Intergenic
1023053619 7:36274154-36274176 TCATGCCCTTCAAAGAGAGGAGG - Intronic
1026471779 7:70700034-70700056 TCAGGCCCTAGAATAAGAGTTGG + Intronic
1029562165 7:101309734-101309756 TCAGGCCCTCCAACAAGAGGTGG + Intergenic
1029584278 7:101460336-101460358 GCCAGGCCTTGAACCAGAGGAGG - Intronic
1030232500 7:107223105-107223127 CCAGGCCCTTCAGCAAGAGGAGG - Intronic
1032275076 7:130447263-130447285 TAAAGCCCTTTAATAAGAGAAGG - Intergenic
1032731406 7:134646805-134646827 TCTAGCCCCTGAACCAGACGTGG - Intronic
1035000886 7:155611328-155611350 CCAAGCCCTGGCACGAGAGGAGG + Exonic
1037173016 8:15916205-15916227 TCAAGACCTGGACCCAGAGGTGG + Intergenic
1039051284 8:33496663-33496685 CAAAGCCCTGGAACAACAGGAGG + Exonic
1040419318 8:47224326-47224348 TCAAGCCCAAGTACTAGAGGTGG + Intergenic
1041091021 8:54300635-54300657 TCAGGCCCCTGAACTAGAGCCGG - Intergenic
1042054938 8:64754620-64754642 TCAAGCCCTTGAGCAAGGCTAGG + Intronic
1043641408 8:82455053-82455075 TAAAGCCCATGAGCAAGAGCTGG + Intergenic
1047796373 8:128260091-128260113 CTAAGCCCTTGAAAAAGGGGAGG + Intergenic
1047799761 8:128296581-128296603 TCAAGCCCTCTAAAAAGAGAAGG - Intergenic
1048377780 8:133837560-133837582 TCAAGATCTAGACCAAGAGGTGG + Intergenic
1048449490 8:134521064-134521086 TGAAGCATTTGAACAGGAGGAGG - Intronic
1048830320 8:138470240-138470262 ACAAGCCCAGGAACAAGAGCAGG + Intronic
1052472351 9:28916000-28916022 GAAAGCCCTTGGCCAAGAGGAGG - Intergenic
1053622610 9:39835270-39835292 TCTTTCTCTTGAACAAGAGGAGG - Intergenic
1053882252 9:42607820-42607842 TCTTTCTCTTGAACAAGAGGAGG + Intergenic
1053890416 9:42686473-42686495 TCTTTCTCTTGAACAAGAGGAGG - Intergenic
1054221277 9:62415289-62415311 TCTTTCTCTTGAACAAGAGGAGG + Intergenic
1054229437 9:62493884-62493906 TCTTTCTCTTGAACAAGAGGAGG - Intergenic
1055113822 9:72586315-72586337 TCAAGCCACTGAACAAGAGTGGG - Intronic
1058966289 9:110041999-110042021 TCAACCCCTTGGAGAAGAGATGG + Intronic
1185817370 X:3168815-3168837 GAAAGCCCTTGTCCAAGAGGAGG + Intergenic
1185833275 X:3321444-3321466 TCAAGCTCTTTAAGAAGGGGAGG + Exonic
1187091126 X:16098154-16098176 TCAAGCTCTGGACAAAGAGGGGG - Intergenic
1191681516 X:63845447-63845469 TTAGGCCCTGGAACAAGTGGTGG - Intergenic
1196141347 X:112266456-112266478 TCAAGACCTTGAACTAGGGGAGG + Intergenic
1197168221 X:123402719-123402741 TCAGGTCCTTGAAAAAGTGGCGG + Intronic
1198000883 X:132434144-132434166 CCAAGGCCATGAACAAGAAGGGG + Intronic
1201242402 Y:11971584-11971606 TCAAGCTCGTTAACAAGGGGAGG - Intergenic