ID: 932706227

View in Genome Browser
Species Human (GRCh38)
Location 2:74026953-74026975
Sequence GTCCCCTGCAGTGACGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 400
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 374}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932706217_932706227 23 Left 932706217 2:74026907-74026929 CCCAGCTTGCTTTTCTCCCCACT 0: 1
1: 0
2: 2
3: 42
4: 362
Right 932706227 2:74026953-74026975 GTCCCCTGCAGTGACGTGGGAGG 0: 1
1: 0
2: 0
3: 25
4: 374
932706218_932706227 22 Left 932706218 2:74026908-74026930 CCAGCTTGCTTTTCTCCCCACTC 0: 1
1: 0
2: 4
3: 44
4: 542
Right 932706227 2:74026953-74026975 GTCCCCTGCAGTGACGTGGGAGG 0: 1
1: 0
2: 0
3: 25
4: 374
932706222_932706227 -9 Left 932706222 2:74026939-74026961 CCACCACTCCTACTGTCCCCTGC 0: 1
1: 0
2: 1
3: 49
4: 498
Right 932706227 2:74026953-74026975 GTCCCCTGCAGTGACGTGGGAGG 0: 1
1: 0
2: 0
3: 25
4: 374
932706220_932706227 6 Left 932706220 2:74026924-74026946 CCCACTCAAGAGTTGCCACCACT 0: 1
1: 0
2: 0
3: 8
4: 102
Right 932706227 2:74026953-74026975 GTCCCCTGCAGTGACGTGGGAGG 0: 1
1: 0
2: 0
3: 25
4: 374
932706219_932706227 7 Left 932706219 2:74026923-74026945 CCCCACTCAAGAGTTGCCACCAC 0: 1
1: 0
2: 2
3: 10
4: 127
Right 932706227 2:74026953-74026975 GTCCCCTGCAGTGACGTGGGAGG 0: 1
1: 0
2: 0
3: 25
4: 374
932706221_932706227 5 Left 932706221 2:74026925-74026947 CCACTCAAGAGTTGCCACCACTC 0: 1
1: 0
2: 0
3: 6
4: 119
Right 932706227 2:74026953-74026975 GTCCCCTGCAGTGACGTGGGAGG 0: 1
1: 0
2: 0
3: 25
4: 374

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932706227 Original CRISPR GTCCCCTGCAGTGACGTGGG AGG Intronic
900103055 1:970999-971021 GTCCCCGGCACTGACCTGTGGGG - Exonic
900339703 1:2182234-2182256 GGGCCCTGCAGTGGAGTGGGGGG + Intronic
900831858 1:4971195-4971217 GTCCCCTGAGGTGACGTGCAGGG - Intergenic
901005779 1:6170930-6170952 GTCTCCTGCGGTGGCGGGGGAGG - Intronic
901016565 1:6235389-6235411 AGGCCCCGCAGTGACGTGGGTGG - Intronic
901607563 1:10471395-10471417 TTCCCCTTCAGTGCCGTGGCTGG - Intronic
902890245 1:19438080-19438102 GTCCCCTCCCCTGACGTAGGAGG - Intronic
904584926 1:31575289-31575311 GCTCCCTGCAGGGACCTGGGAGG - Intergenic
904596089 1:31646447-31646469 GTCCTTTGCAGGGACGTGGATGG - Intergenic
906176464 1:43778117-43778139 GTCCTCTGCAGGGACATGGTTGG + Intronic
906316050 1:44786960-44786982 CTCCCCTGCAGTGCCCAGGGTGG + Intronic
909140841 1:71863288-71863310 GTCCTCTGCAGGGACATGGATGG + Intronic
909252704 1:73379350-73379372 ATCCTTTGCAGGGACGTGGGTGG - Intergenic
909438947 1:75676392-75676414 GTCCTTTGCAGTGACATGGATGG + Intergenic
910542737 1:88379282-88379304 GTCCCTAGCAGTGACATAGGTGG - Intergenic
910810258 1:91228406-91228428 GTCCCTTGCAGGGACATGGATGG - Intergenic
912633945 1:111273408-111273430 GTCCTTTGCAGGGACGTGGATGG + Intergenic
913048718 1:115096274-115096296 GTCCCTTGCAGGGACATGGATGG - Intergenic
916145755 1:161737781-161737803 CTCCCCTGCAGTGAGGTGCTTGG - Intergenic
916916743 1:169415444-169415466 ATCCCTTTCAGTGACTTGGGAGG - Intronic
919930322 1:202217099-202217121 TTCCCCTGCAGTGCTGAGGGTGG + Intronic
920063107 1:203241888-203241910 GTCCTTTGCAGAGACGTGGGTGG - Intronic
921654998 1:217723943-217723965 GTCCTCTGAAGGGACATGGGCGG + Intronic
923074281 1:230595672-230595694 GTCCCCTGCAGTGGCATACGAGG + Intergenic
923427396 1:233884962-233884984 GTCCTTTTCAGTGACGTGGATGG + Intergenic
924558813 1:245140783-245140805 GTCCTTTGCAGTGACATGGATGG - Intergenic
1062964222 10:1594943-1594965 GTCCCCAGCAGAGATGGGGGAGG - Intronic
1063169226 10:3491667-3491689 GTCCTTTGCAGTGACGTGTGTGG + Intergenic
1063307332 10:4916931-4916953 GTCCACTGCAGGGACATGGATGG + Intergenic
1064172221 10:13043656-13043678 GTCCTTTGCAGCAACGTGGGTGG - Intronic
1064241656 10:13635196-13635218 GTCCTCTGCAGGGACATGGATGG - Intronic
1064722107 10:18239443-18239465 GTCTCTTGCAGTGACATGGATGG - Intronic
1065250375 10:23805365-23805387 GTCCTCTGCAGGGACATGGATGG + Intronic
1065256596 10:23875789-23875811 GTCCTCTGCAGGGACATGGATGG + Intronic
1067732894 10:48825261-48825283 GTCCTTTGCAGTGACATGGATGG - Intronic
1068073117 10:52220719-52220741 GTCCTCTGCAGGAACATGGGTGG - Intronic
1068380720 10:56250625-56250647 GTCCTTTGCAGGGACATGGGTGG - Intergenic
1069194887 10:65538997-65539019 GTCCTTTGCAGGGACATGGGTGG + Intergenic
1070249336 10:74760305-74760327 GTCCTTTGCAGGGACGTGGATGG + Intergenic
1070584715 10:77755045-77755067 GTCCTCTGCAGGGACATGGATGG - Intergenic
1070825366 10:79387561-79387583 GTCCCCTGCATGGACATGGGGGG + Intronic
1071192222 10:83114601-83114623 GTCCTCTGCAGGAACGTGGACGG + Intergenic
1071467323 10:85953212-85953234 GTCCTTTGCAGGGACATGGGTGG + Intronic
1073962318 10:108946685-108946707 GTCCTCTGCAGGGACGTGGACGG + Intergenic
1073992141 10:109273935-109273957 GTCCTTTGCAGCAACGTGGGTGG - Intergenic
1074524098 10:114249640-114249662 GTCCTTTGCAGGGACATGGGTGG - Intronic
1074872074 10:117585007-117585029 GTCCTTTGCAGAGACGTGGATGG - Intergenic
1075529000 10:123211128-123211150 GTCCTTTGCAGGGACGTGGATGG - Intergenic
1076518927 10:131067720-131067742 TTCTCCAGCAGTGAGGTGGGAGG + Intergenic
1076610117 10:131720277-131720299 GTCCTTTGCAGGGACGTGGATGG - Intergenic
1077381255 11:2239643-2239665 GTCCTCTGCAGAGATGTGGATGG + Intergenic
1079174131 11:18122488-18122510 GTCCTTTGCAGGGACGTGGATGG - Intronic
1079291525 11:19192324-19192346 TTCCACTGCAGTGAGTTGGGTGG - Exonic
1079737967 11:24021345-24021367 GTCCTTTGCAGTGACATGGGGGG - Intergenic
1080055209 11:27899880-27899902 GTCCTTTGCAGGGACGTGGATGG + Intergenic
1081604764 11:44520362-44520384 ATCCCCCGCAGGGCCGTGGGAGG - Intergenic
1083015784 11:59452427-59452449 GTCCTTTGCAGAGACATGGGTGG - Intergenic
1084204246 11:67582691-67582713 GTCCTTTGCAGGGACATGGGTGG + Intergenic
1085284539 11:75351415-75351437 CTCCCCGGCAGGGCCGTGGGCGG - Intronic
1085452520 11:76643589-76643611 GTCCTTTGCAGGGACATGGGTGG - Intergenic
1085644076 11:78211254-78211276 GTCCTCTGCAGGGACATGGACGG - Intronic
1086372226 11:86166512-86166534 GTCCTTTGCAGTGACATGGATGG + Intergenic
1086607927 11:88719364-88719386 GTCCTTTGCAGGGACATGGGTGG - Intronic
1087159148 11:94932294-94932316 GTCCTTTGCAGGGACATGGGTGG + Intergenic
1087723157 11:101689586-101689608 GTCTTCTGCAGTGACATGGATGG + Intronic
1088075658 11:105845439-105845461 GACCCCTGCAGTTCAGTGGGAGG + Intronic
1088742770 11:112780487-112780509 GTCAGCTGCAGGGAGGTGGGGGG + Intergenic
1090115871 11:123972558-123972580 GTCCTTTGCAGCAACGTGGGTGG - Intergenic
1090741498 11:129665682-129665704 GTCCTTTGCAGGGACGTGGATGG - Intergenic
1091219224 11:133920462-133920484 GGCACCTGCAGGGAGGTGGGGGG + Exonic
1091769009 12:3139408-3139430 GTCCCCTGCCGTGCAGTGGAGGG + Intronic
1093189078 12:16054659-16054681 GTCCTTTGCAGAGACGTGGATGG + Intergenic
1093210798 12:16306068-16306090 GTCCTTTGCAGGGACATGGGTGG - Intergenic
1093512641 12:19947289-19947311 GTCCTTTGCAGGGACATGGGTGG - Intergenic
1094055359 12:26263832-26263854 GTCCTTTGCAGGGACATGGGTGG + Intronic
1094454274 12:30614717-30614739 GTCCTTTGCAGGGACGTGGATGG - Intergenic
1095853564 12:46836397-46836419 GTCCTTTGCAGTGACATGGATGG - Intergenic
1096051163 12:48609252-48609274 GTCCTTTGCAGGGACGTGGATGG - Intergenic
1096887605 12:54733075-54733097 GTCCTTTGCAGGGACATGGGTGG - Intergenic
1096929540 12:55191315-55191337 GTCCTTTGCAGTGACATGGATGG - Intergenic
1097565834 12:61267027-61267049 GTCCTTTGCAGGGACGTGGATGG + Intergenic
1097598014 12:61658277-61658299 GTCCTTTGCAGGGACATGGGTGG - Intergenic
1097932474 12:65204481-65204503 GTCCTTTGCAGGGACGTGGATGG - Intronic
1098338736 12:69430024-69430046 GTCCCATGTAGTGAGGTGGGAGG + Intergenic
1098979300 12:76937722-76937744 GTCCTTTGCAGGGACATGGGTGG - Intergenic
1099471130 12:83049464-83049486 GTCCTCTGCAGTAACCTGGGTGG - Intronic
1099579004 12:84417769-84417791 GTCCTTTGCAGGGACGTGGATGG - Intergenic
1100735130 12:97520292-97520314 GTCTCCTGCAGAGGCATGGGAGG - Intergenic
1102928963 12:116848147-116848169 GTCCTTTGCAGGGACATGGGTGG - Intronic
1103052216 12:117790085-117790107 GTCCCATGCAGTGGAGTGGAAGG - Intronic
1104600737 12:130151738-130151760 GTCCTTTGCAGGGACATGGGTGG + Intergenic
1104693695 12:130847321-130847343 GTCCTTTGCAGCAACGTGGGTGG - Intergenic
1104974456 12:132546227-132546249 CTCCCCTGCTGTGATATGGGCGG - Intronic
1105825365 13:24117727-24117749 GGCCACTGCAGTGTCCTGGGAGG - Intronic
1106081479 13:26504041-26504063 CTCTGCTGCAGTGAGGTGGGAGG + Intergenic
1106175449 13:27326941-27326963 GTCCTCTGCAGGGACATGGATGG + Intergenic
1106343694 13:28855575-28855597 GTCCTTTGCAGGGACATGGGTGG - Intronic
1106372472 13:29148833-29148855 GTCCTTTGCAGGGACATGGGTGG - Intronic
1107208054 13:37819510-37819532 GTCCCTTGCAGGGACATGGATGG + Intronic
1108069244 13:46610846-46610868 ATGCCCTGCAGTGTAGTGGGTGG - Intronic
1109463541 13:62695703-62695725 GTCCTTTGCAGTGACATGGATGG - Intergenic
1109626932 13:64986500-64986522 GTCCTTTGCAGTGACATGGATGG - Intergenic
1111537178 13:89617481-89617503 GTCCTCTGCAGGGACATGGATGG - Intergenic
1111709957 13:91798492-91798514 GTCCTCTGCAGGGACATGGATGG - Intronic
1111856359 13:93642295-93642317 GTCCTCTGCAGCAACGTGGCTGG - Intronic
1113888061 13:113671352-113671374 GTCCTCTGCAGGGACGTAGGGGG + Intronic
1113949089 13:114061199-114061221 GTCCCCGGCCGTGGCGGGGGTGG - Intronic
1114885827 14:26849796-26849818 GTCCTTTGCAGGGACATGGGTGG - Intergenic
1115019125 14:28653633-28653655 GTCACCTGTATTGATGTGGGAGG + Intergenic
1115353706 14:32424804-32424826 GTCCTTTGCAGGGACGTGGATGG - Intronic
1115870943 14:37802083-37802105 GTCCTTTGCAGGGACGTGGATGG + Intronic
1116294877 14:43094424-43094446 ATCCTTTGCAGGGACGTGGGTGG + Intergenic
1116809966 14:49529991-49530013 GTCCCCTTCAGTGACATGGATGG + Intergenic
1118053979 14:62058910-62058932 GTCCTTTGCTGGGACGTGGGTGG + Intronic
1118346606 14:64945748-64945770 GACCCTGGCAGTGATGTGGGAGG - Intronic
1118988918 14:70780504-70780526 GTGTCCTGCAGACACGTGGGAGG - Intronic
1119707306 14:76791097-76791119 TTCACCTGCAGTAACATGGGTGG + Intronic
1119987027 14:79149696-79149718 GTCCTTTGCAGGGACGTGGAAGG + Intronic
1120131356 14:80811089-80811111 GTCCTTTGTAGGGACGTGGGTGG - Intronic
1120536324 14:85700630-85700652 GTCCTTTGCAGGGACATGGGTGG + Intergenic
1122209534 14:100165902-100165924 GCCCCCTGAAGTGGGGTGGGGGG + Intergenic
1123054362 14:105562117-105562139 GTCCCCTGCTGGGCGGTGGGCGG + Intergenic
1123074582 14:105661598-105661620 GGACCCTGCTGTGCCGTGGGAGG - Intergenic
1123078946 14:105682536-105682558 GTCCCCTGCTGGGCGGTGGGCGG + Intergenic
1125271644 15:37945177-37945199 GTCCTTTGCAGGGACATGGGTGG - Intronic
1126164965 15:45647287-45647309 ATCCCATGGAGTGAGGTGGGAGG - Intronic
1126386701 15:48100702-48100724 CTCCCCAGCAGTGCCCTGGGAGG - Intergenic
1126673638 15:51138197-51138219 GTCCCCTGCAGAATCTTGGGTGG + Intergenic
1126949883 15:53869215-53869237 GTGACCTGCAGTTACGTGGATGG + Intergenic
1129322517 15:74782745-74782767 GTCCCCTGGAGGGAAGAGGGTGG + Intronic
1129377853 15:75145410-75145432 GTCCACAGCTGTGACTTGGGTGG + Intergenic
1130129099 15:81122017-81122039 GTCCTCTGCAGGGACATGGGTGG - Intronic
1130353169 15:83108552-83108574 GATCCCTGCAGTGGAGTGGGAGG - Intronic
1130697410 15:86144502-86144524 GTCCTTTGCAGGGACATGGGTGG + Intronic
1130784249 15:87078238-87078260 GTCCTTTGCAGGGACGTGGATGG - Intergenic
1131661905 15:94526214-94526236 GTCCCCTGTAGTGGTTTGGGAGG + Intergenic
1132986666 16:2770927-2770949 TTCCCCAGCAGAGCCGTGGGAGG + Exonic
1136053918 16:27673701-27673723 GTCCCCTGGAGTTGGGTGGGGGG + Intronic
1137512513 16:49114113-49114135 GTCCCGTGCAGAGACGTGCTTGG - Intergenic
1138882204 16:61030456-61030478 GTCCTTTGCAGGGACATGGGTGG - Intergenic
1139966624 16:70749297-70749319 GTGCTCTGCAGTGGGGTGGGAGG - Intronic
1140785272 16:78335428-78335450 GTCCTCTGCAGGGACATGGATGG - Intronic
1141358361 16:83370773-83370795 GTCCTTTGCAGTGACATGGATGG - Intronic
1142193251 16:88727520-88727542 GTCCTCTGCAGAGGCGGGGGTGG + Intronic
1142488163 17:260130-260152 GTCCCCTGCTGTGACTCGTGGGG - Intronic
1143092232 17:4455682-4455704 GTAGTCTGCAGTGTCGTGGGAGG - Intronic
1143977901 17:10843974-10843996 TTCCCCTGCCTTGGCGTGGGCGG - Intergenic
1144616115 17:16775014-16775036 GTCCTTTGCAGGGACATGGGTGG - Intronic
1144877131 17:18404326-18404348 GTCCTCTGCAGGGACATGGATGG + Intergenic
1144896590 17:18540648-18540670 GTCCTTTGCAGGGACATGGGTGG + Intergenic
1145135627 17:20403574-20403596 GTCCTTTGCAGGGACATGGGTGG - Intergenic
1145155099 17:20540082-20540104 GTCCTCTGCAGGGACATGGATGG - Intergenic
1145879003 17:28340468-28340490 GTGCCCTGCAGGTACATGGGTGG + Exonic
1150855568 17:68749114-68749136 GTCCTTTGCAGGGACGTGGATGG - Intergenic
1151722504 17:75865473-75865495 GTCCCCTGCAGCGCCCTGGCTGG + Intergenic
1152308921 17:79537506-79537528 GTCCCCTGCAATGCCAAGGGGGG + Intergenic
1152567011 17:81104924-81104946 GACCCCTGCAGGGAGGTGGTTGG - Intronic
1203169395 17_GL000205v2_random:134389-134411 GTCCCTTGCAGGGACATGGTTGG + Intergenic
1153272898 18:3340943-3340965 GTCCTTTGCAGGGAAGTGGGTGG + Intergenic
1153349816 18:4067015-4067037 GTCCTTTGCAGGGACGTGGACGG + Intronic
1153513253 18:5878492-5878514 GCCACCTGGAGTGAGGTGGGGGG - Intergenic
1155676247 18:28432380-28432402 GTCCTTTGCAGGGACGTGGATGG - Intergenic
1157242341 18:46022955-46022977 GTCCTTTGCAGGGACATGGGTGG + Intronic
1157847334 18:51016206-51016228 GTCCTTTGCAGGGACGTGGATGG - Intronic
1158569825 18:58588736-58588758 GTCCTCTGCAGGGACATGGATGG - Intronic
1159505395 18:69328901-69328923 GTCCCTTGCAGGAACGTGGATGG + Intergenic
1159854056 18:73563171-73563193 GTCCTTTGCAGGGACGTGGATGG - Intergenic
1160280884 18:77489617-77489639 GTCCTTTGCAGCGACATGGGTGG + Intergenic
1160329935 18:77982116-77982138 GTCCTCTTCAGTAACATGGGAGG + Intergenic
1160591793 18:79949086-79949108 GTCCCCTGCAACGACCTCGGAGG - Intronic
1161166391 19:2790115-2790137 GTACCCTGCAGTGACCAGGACGG - Intronic
1165248722 19:34513374-34513396 GTAACCTGCAGTGTGGTGGGTGG - Intergenic
1165256274 19:34578747-34578769 GTAACCTGCAGTGTGGTGGGTGG - Intergenic
1165258991 19:34597224-34597246 GTAACCTGCAGTGTGGTGGGTGG - Intronic
1165266290 19:34665581-34665603 GTAACCTGCAGTGTGGTGGGTGG + Intronic
1165273932 19:34732672-34732694 GTAACCTGCAGTGTGGTGGGTGG + Intergenic
1165715705 19:38044482-38044504 GACCCCTGCAGTGAGGCAGGAGG + Intronic
1165983297 19:39745121-39745143 GTCCTTTGCAGTGACATGGTTGG + Intergenic
1167078256 19:47262135-47262157 GAGCCCTGCAGGGAGGTGGGTGG + Intronic
1167202285 19:48074285-48074307 GTCCTCTGCAGGGATATGGGTGG - Intronic
1168218502 19:54943720-54943742 TTCCCCAGCTGTGACGTGTGGGG + Intronic
925336404 2:3102138-3102160 GTCCCCTCCAGTGGTCTGGGCGG - Intergenic
925350137 2:3195272-3195294 CTCCCCAGCACTGCCGTGGGCGG + Intronic
925388329 2:3478997-3479019 GGCCCCTGCTGAGACGTGTGTGG - Intronic
926498598 2:13622630-13622652 GTCCCTTGCAGCAACGTGGATGG + Intergenic
930671515 2:54156564-54156586 GTCCTTTGCAGGGACGTGGATGG - Intronic
932296562 2:70628550-70628572 GTCCTTTGCAGGGACGTGGATGG - Intronic
932706227 2:74026953-74026975 GTCCCCTGCAGTGACGTGGGAGG + Intronic
932908353 2:75779053-75779075 GTCCTTTGCAGGGACATGGGTGG + Intergenic
933587832 2:84199303-84199325 GTCCTTTGCAGCAACGTGGGTGG - Intergenic
934773354 2:96921802-96921824 GGCCCCTGCAGGGTCCTGGGTGG + Intronic
937058455 2:118961040-118961062 GTCCTTTGCAGTGACATGGATGG - Intronic
937163963 2:119794716-119794738 GTCACCTGCAGCAACGTGGTGGG + Intronic
937718827 2:125066533-125066555 GTCCTTTGCAGGGACGTGGATGG - Intergenic
938785423 2:134624303-134624325 GTCCTTTGCAGGGACGTGGATGG + Intronic
940189133 2:151020164-151020186 GTCCTTTGCAGGGACGTGGATGG - Intronic
940459697 2:153948694-153948716 GTCCTTTGCAGGGACGTGGATGG + Intronic
941240868 2:163036020-163036042 GTCCTTTGCAGGGACATGGGTGG - Intergenic
941418969 2:165258773-165258795 GTCCTCTGCAGGGACATGGATGG + Intronic
941980888 2:171455308-171455330 GTCCTTTGCAGGGACGTGGATGG - Intronic
945023817 2:205600805-205600827 GTCCTTTGCAGGGACGTGGATGG - Intronic
945212715 2:207400347-207400369 GTCCTCTGCAGGGACATGGTTGG + Intergenic
945770892 2:214040594-214040616 GTCCTCTGCAGGGACATGGATGG - Intronic
946834540 2:223759920-223759942 GTCCTTTGCAGGGACGTGGATGG - Intronic
947533312 2:230926192-230926214 TTCCCCTGCAGTGACTTGCAAGG - Intronic
948722496 2:239910405-239910427 GTCCTTTGCAGGGACATGGGTGG + Intronic
948757805 2:240169349-240169371 GGCCCCTGAAGTGCCGTGGGAGG + Intergenic
948972729 2:241441737-241441759 GTGACCGGCAGTGTCGTGGGGGG + Intronic
1169754919 20:9033504-9033526 GTCCTTTGCAGGGACGTGGATGG - Intergenic
1169807489 20:9574465-9574487 ATCGCCTGCAGTGATGTGGAGGG + Intronic
1169891558 20:10458663-10458685 GTCCTTTGCAGGGACGTGGATGG - Intronic
1173149776 20:40557067-40557089 GTCCTCTGCAGGGACATGGATGG + Intergenic
1173549655 20:43923789-43923811 GTTCTCTGCGGTGAGGTGGGCGG + Intronic
1173567181 20:44049793-44049815 GTCCTCTGCAGGGACATGGATGG - Intronic
1174328535 20:49799043-49799065 GTCACTTGCAGTGATGTGTGTGG + Intergenic
1174560405 20:51427011-51427033 AGCCCCTGCAGTGACTTGTGAGG - Intronic
1176402363 21:6324760-6324782 GTCCCTTGCAGGGACATGGTTGG - Intergenic
1176434794 21:6664344-6664366 GTCCCTTGCAGGGACATGGTTGG + Intergenic
1176459056 21:6991414-6991436 GTCCCTTGCAGGGACATGGTTGG + Intergenic
1177118410 21:17112614-17112636 GTCCTTTGCAGGGACATGGGTGG + Intergenic
1178408869 21:32347668-32347690 GACCCCTGCACTAAAGTGGGTGG + Exonic
1179079238 21:38154887-38154909 GTCCCTTGCAGGGACATGGATGG - Intronic
1179253281 21:39692268-39692290 GTCCTTTGCAGTGACGTGGATGG - Intergenic
1179278860 21:39916786-39916808 GTCCTTTGCAGGGACGTGGATGG + Intronic
1180219808 21:46351357-46351379 CACCCCAGCAGTGACGTGTGCGG - Intronic
1184796941 22:46738215-46738237 GGCCCCTGCAGTGGCCCGGGCGG + Exonic
1184816268 22:46873757-46873779 GTCCTTTGCAGTGACATGGATGG - Intronic
950549889 3:13659882-13659904 GTCCCTTCCTGTGACATGGGAGG + Intergenic
951366124 3:21785085-21785107 GTTCCCTGCACTGACCGGGGAGG + Intronic
952188344 3:30995133-30995155 GTCCTTTGCAGCAACGTGGGTGG + Intergenic
952533518 3:34286996-34287018 GTCCTTTGCAGGGACATGGGTGG + Intergenic
952785636 3:37152154-37152176 GTCTCTTGCAGTGACTTGGATGG + Intronic
954515239 3:51169426-51169448 GTCCTTTGCAGGAACGTGGGTGG + Intronic
955053321 3:55433338-55433360 GTCCTTTGCAGGGACGTGGATGG + Intergenic
956309898 3:67867227-67867249 GTCCTCTGCAGGAACGTGGATGG - Intergenic
958761017 3:98308501-98308523 GTCCTTTGCAGTGACATGGATGG - Intergenic
958875838 3:99616072-99616094 GTCCTTTGCAGGGACATGGGTGG - Intergenic
959264308 3:104118360-104118382 GTCCCTTGCAAGGACATGGGTGG + Intergenic
962696433 3:137952035-137952057 GTCCTTTGCAGGGACATGGGTGG - Intergenic
963333133 3:143938784-143938806 GTCCTTTGCAGGGACATGGGTGG + Intergenic
963755114 3:149226802-149226824 GTCCTCTGCAGGGACATGGATGG - Intergenic
964710819 3:159669596-159669618 GTGACCTGGAGTGAGGTGGGAGG - Intronic
965343550 3:167519474-167519496 GTCCTCTGCAGGGACATGGATGG + Intronic
966566719 3:181390802-181390824 GTCCCTTGCAGGGACATGGATGG - Intergenic
968556377 4:1248291-1248313 GCCCCCGGCGGTGACGCGGGAGG - Intronic
969834583 4:9830203-9830225 GTCCTTTGCAGTGACATGGATGG + Intronic
970124180 4:12790837-12790859 GTCCTTTGCAGGGACATGGGTGG - Intergenic
973093157 4:46163814-46163836 GTCCTTTGCAGGGACATGGGTGG + Intergenic
974288601 4:59902147-59902169 GTCCTTTGCAGGGACATGGGTGG + Intergenic
974339586 4:60598200-60598222 GTCCCTTGCAGGGACGTGGATGG - Intergenic
974874627 4:67687783-67687805 GTCCTTTGCAGGGACGTGGTTGG - Intronic
975107207 4:70581007-70581029 GTCCTCTGCAGGGACATGGATGG + Intergenic
976004305 4:80410343-80410365 TTTCCCTGCACTGAGGTGGGAGG - Intronic
976894230 4:90088921-90088943 GTCCTTTGCAGGGACGTGGATGG - Intergenic
981655457 4:147107718-147107740 GTCCTTTGCAGGGACGTGGATGG + Intergenic
982437899 4:155399161-155399183 GTGCCCTGCAGTGTCTTTGGAGG + Intergenic
982778951 4:159470197-159470219 GTCCTTTGCAGGGACATGGGTGG - Intergenic
983529463 4:168794345-168794367 CTCACCTTCAGTGAAGTGGGAGG - Intronic
985180274 4:187253175-187253197 GTCCTCTACAGGGACCTGGGTGG + Intergenic
985695590 5:1338365-1338387 GTCACCTGCAGCCACCTGGGAGG + Intronic
986362889 5:6998795-6998817 GTCCCCTACTATGCCGTGGGAGG + Intergenic
987327333 5:16824301-16824323 GTCCCCAGCAGTGGCGGGGGCGG - Intronic
987753538 5:22070817-22070839 GTCCTTTGCAGGGACGTGGAAGG + Intronic
987894987 5:23933145-23933167 GTCCTTTGCAGAGACCTGGGTGG + Intergenic
989548658 5:42705706-42705728 GTCCTCTGCAGTCACATGGATGG - Intronic
991183211 5:63778347-63778369 GTCCCTTGCAGAGACATGGGTGG - Intergenic
992265653 5:75015979-75016001 GTCCTTTGCAGGGACATGGGTGG + Intergenic
993335979 5:86659362-86659384 GTCCTTTGCAGGGACATGGGTGG - Intergenic
993901246 5:93585208-93585230 GTCCCCCGCCGTGCCGGGGGTGG - Exonic
996778002 5:127153682-127153704 GTCCCTTGCAGGGACATGGATGG - Intergenic
998128676 5:139640287-139640309 GTCCCCTCCAGGAAGGTGGGAGG + Intergenic
998365579 5:141628635-141628657 GTCACCTGTAGGGAAGTGGGTGG + Exonic
999410742 5:151347602-151347624 GTGCCCTCCAGGGAGGTGGGCGG - Intergenic
1000414845 5:160973655-160973677 GTCCTTTGCAGGGACGTGGATGG + Intergenic
1002506529 5:179682991-179683013 GTCCCTTGCAGTCAGGTGGGTGG - Intronic
1002643523 5:180641619-180641641 GGCCTCTGCAGGGACCTGGGGGG + Intronic
1002701402 5:181127696-181127718 GACCCCTGGAGTGATGTGGAGGG + Intergenic
1003881065 6:10480112-10480134 GTCCTCTGCAGGGACATGGATGG - Intergenic
1004344267 6:14833743-14833765 CTGCCCTGCAGTGACGTCAGTGG + Intergenic
1004614308 6:17275543-17275565 GTCCTTTGCAGCGACATGGGTGG + Intergenic
1006265280 6:32916414-32916436 GTCCTCTGCAGGGACATGGATGG - Intergenic
1006430907 6:33995162-33995184 GTCCCCTGATATGATGTGGGAGG + Intergenic
1009893343 6:69715921-69715943 GTCCCTTGCAGGGACATGGAGGG - Intronic
1009939577 6:70274513-70274535 GTCCTTTGCAGGGACGTGGATGG - Intronic
1010318268 6:74475608-74475630 GTCCTCTGCAGGGACATGGATGG + Intergenic
1010338096 6:74712919-74712941 GTCCTTTGCAGGGACATGGGTGG + Intergenic
1012360812 6:98377126-98377148 GTCCTTTGCAGTAACATGGGTGG - Intergenic
1012537830 6:100320549-100320571 GTCCTTTGCAGTGACATGGATGG - Intergenic
1014029156 6:116681279-116681301 GTCCCCAGCGGCGACGTGTGTGG - Exonic
1014066353 6:117131217-117131239 GTCCTTTGCAGTGACTTGGATGG + Intergenic
1014142837 6:117964125-117964147 GTCCTTTGCAGGGACGTGGATGG - Intronic
1014332884 6:120093105-120093127 GTCCTTTGCAGTGACATGGATGG + Intergenic
1014706631 6:124755550-124755572 GTCCTCTGCAGGGACATGGATGG + Intronic
1015491240 6:133828458-133828480 GTCCTCTGCAGCAACGTGGATGG + Intergenic
1016090326 6:139970158-139970180 GTCCTTTGCAGTGACATGGATGG + Intergenic
1016423240 6:143907082-143907104 GTCCTTTGCAGGGACGTGGATGG - Intronic
1017188249 6:151624286-151624308 GTCCTTTGCAGGGATGTGGGTGG + Intergenic
1017516240 6:155158284-155158306 GTCTCCTGTAGTAAAGTGGGAGG - Intronic
1017876384 6:158528558-158528580 GTCCTTTGCAGGGACATGGGTGG + Intergenic
1018248022 6:161840756-161840778 TTCCCTTGCAGGGACATGGGTGG - Intronic
1019295498 7:271988-272010 GTCCCCTGCAGGGAGGAGTGGGG + Intergenic
1019618472 7:1977935-1977957 GTCCCCAGGAGCCACGTGGGAGG - Intronic
1019963500 7:4480769-4480791 GTCCTTTGCAGGGACATGGGTGG - Intergenic
1020382428 7:7561797-7561819 GTCCCCTGCAGGAACATGGATGG + Intergenic
1021002493 7:15349895-15349917 GTCCCCTCCTATGACATGGGGGG + Intronic
1022317642 7:29260495-29260517 GTCCATTGCAGTGAGGAGGGGGG + Intronic
1023213579 7:37834362-37834384 GTTACCTGCAGTTACTTGGGAGG - Intronic
1025212126 7:57025808-57025830 GCTCCCTGCAGGGAGGTGGGTGG + Intergenic
1025659828 7:63551020-63551042 GCTCCCTGCAGGGAGGTGGGTGG - Intergenic
1026329519 7:69339559-69339581 GTCCTTTGCAGGGACGTGGATGG + Intergenic
1027754121 7:82188857-82188879 GTCCTTTGCAGTGACTTGGATGG + Intronic
1027788846 7:82614141-82614163 GTCCTTTGCAGGGACGTGGATGG - Intergenic
1028040356 7:86044681-86044703 GTCCCTTGCAGGGACATGGATGG - Intergenic
1029250127 7:99230246-99230268 GTCCTTTGCAGTAACATGGGTGG - Intergenic
1030847856 7:114443724-114443746 GTCCTCTGCAGCAACATGGGTGG - Intronic
1031167560 7:118247691-118247713 GTCCTTTGCAGTGACATGGATGG - Intergenic
1031169075 7:118269174-118269196 GTCCTTTGCAGGGACATGGGTGG - Intergenic
1031733804 7:125331064-125331086 GTCCCTTGCAGTGACATGAGTGG - Intergenic
1031831522 7:126632722-126632744 GTCCCTTGCAGGGACATGGATGG + Intronic
1032900491 7:136301642-136301664 GTCCTCTGCAGGGACATGGATGG + Intergenic
1034680641 7:152925333-152925355 CTCCCCTACAGTGAGGTGGGTGG + Intergenic
1035965828 8:4190788-4190810 GTCCTCTGCAGGGACATGGATGG + Intronic
1036012060 8:4737175-4737197 GTCCTCTGCAGGGACATGGATGG + Intronic
1036032080 8:4985051-4985073 GTCCTTTGCAGGGACGTGGGTGG + Intronic
1036646273 8:10612782-10612804 GTCCGCTGCAGTGGCCTGTGGGG - Exonic
1037766514 8:21775606-21775628 GTCCTCCTCAGTGACCTGGGCGG - Intronic
1038657745 8:29469560-29469582 GTCCTCAGCAGTTACGGGGGTGG - Intergenic
1038770405 8:30473784-30473806 GTCCTTTGCAGGGACATGGGTGG + Intronic
1039620021 8:38988318-38988340 GTCCTCTGCAGGGACATGGATGG + Exonic
1040003548 8:42599427-42599449 GTCCCCTTCAGTGGTGTGGAAGG - Intergenic
1040306021 8:46212249-46212271 GTCCCCAGGACTGACGCGGGTGG + Intergenic
1040735606 8:50504146-50504168 GTCCACTGCAGGGACATGGATGG - Intronic
1040774715 8:51027868-51027890 GTCCCTTGCAGGGACATGGATGG - Intergenic
1041116487 8:54542788-54542810 GTCCTTTGCAGGGACATGGGTGG - Intergenic
1042748683 8:72134604-72134626 GTCAGCTGCATTGAGGTGGGGGG + Intergenic
1042932040 8:74023263-74023285 GTGCCCTGCAGTATCTTGGGTGG + Intronic
1045198655 8:99956270-99956292 GTCCCCTTCAATGCCGTGGACGG - Intergenic
1045394052 8:101742974-101742996 GTCCTTTGCAGGGACGTGGATGG - Intronic
1045960240 8:107958848-107958870 GTCCCCTGCAGGGACATGGATGG - Intronic
1046027978 8:108747864-108747886 GTCCTTTGCAGGGACGTGGATGG - Intronic
1047018309 8:120747200-120747222 GTCCCTTGCAGGGACATGGATGG + Intronic
1048817387 8:138346507-138346529 GTCCTTTGCAGGGACGTGGATGG + Intronic
1049410507 8:142471872-142471894 GCCCCCTGCACGGACGTGGAAGG - Intronic
1049556694 8:143286051-143286073 GTTCCATGCTGTGACCTGGGGGG - Intergenic
1049617241 8:143581018-143581040 GTCCCCTGCAGTGTCAGGCGTGG + Intronic
1050167121 9:2776949-2776971 GTCCTTTGCAGAGACGTGGATGG + Intronic
1050883075 9:10728220-10728242 GTCCTCTGCAGGGACATGGATGG - Intergenic
1051765621 9:20520037-20520059 GTCCTTTGCAGGGACATGGGTGG + Intronic
1051981477 9:23024592-23024614 GTCCGTTGCAGTGACATGGATGG - Intergenic
1052535994 9:29748254-29748276 GTCCTTTGCAGGGACATGGGTGG + Intergenic
1053059449 9:35019100-35019122 GTCCTTTGCAGGGACATGGGTGG - Intergenic
1054775782 9:69122263-69122285 GTGCCTTGGAGTGACGCGGGCGG + Intronic
1054974435 9:71125498-71125520 GTCCTTTGCAGTGACATGGATGG - Intronic
1055682825 9:78735633-78735655 GTCCTCTGCAGGGACGTGGATGG - Intergenic
1056538181 9:87549241-87549263 GTCCTCTGCAGGGACATGGATGG - Intronic
1056891395 9:90496917-90496939 GTCCTTTGCAGGGACGTAGGTGG + Intergenic
1058352572 9:104043257-104043279 GTCTTCTGCAGGGATGTGGGTGG + Intergenic
1058789407 9:108427104-108427126 GTCCTTTGCAGGGACATGGGTGG + Intergenic
1059868951 9:118549444-118549466 GTCCTTTGCAGTAACATGGGTGG + Intergenic
1060310589 9:122457061-122457083 GTCCTTTGCAGGGACATGGGTGG + Intergenic
1060402035 9:123354891-123354913 GTCCCCTGCAGTGCAGGGGAGGG - Intergenic
1062110661 9:134780442-134780464 GGCCCCTGCAGGCACGTGGGGGG - Intronic
1203436742 Un_GL000195v1:144302-144324 GTCCCTTGCAGGGACATGGTTGG - Intergenic
1186343096 X:8663896-8663918 GTCCTTTGCAGGGACGTGGGTGG + Intronic
1186696422 X:12037883-12037905 GTCCTTTGCAGGGACGTGGATGG - Intergenic
1188099715 X:26069453-26069475 GTCCTTTGCAGAGACATGGGTGG - Intergenic
1188246045 X:27836980-27837002 GTCCTTTGCAGGGACATGGGTGG + Intergenic
1188879380 X:35472876-35472898 GTCCTTTGCAGTAACGTGGATGG - Intergenic
1189320464 X:40084117-40084139 GTCGCCTACTGTAACGTGGGAGG + Intronic
1189872830 X:45402421-45402443 GTCCTTTGCAGTGACATGGGTGG - Intergenic
1190538544 X:51454313-51454335 GTCCCTTGCAGGGACATGGATGG + Intergenic
1190821217 X:53974748-53974770 GTCCACTGCAGGGACATGGATGG + Intronic
1191078315 X:56481193-56481215 GTCCTTTGCAGGGACGTGGATGG - Intergenic
1191942551 X:66497122-66497144 GTCCTTTGCAGTGACATGGATGG + Intergenic
1192293343 X:69821076-69821098 GTCCTTTGCAGTGACATGGATGG + Intronic
1192867211 X:75147509-75147531 GTCCTTTGCAGTGACATGGCTGG + Intronic
1192961263 X:76133609-76133631 GTCCTTTGCAGTGACATGGATGG + Intergenic
1193235200 X:79098201-79098223 GTCCTTTGCAGTGACCTGGATGG + Intergenic
1194273929 X:91856752-91856774 GTCCTTTGCAGTAACATGGGTGG - Intronic
1194902456 X:99530046-99530068 GTCCCTTGCAGAGACATGGATGG + Intergenic
1194998535 X:100618727-100618749 GTCCTCTGCAGGGACATGGATGG + Intergenic
1195415487 X:104615529-104615551 GTCCTCTGCAGGGACATGGATGG - Intronic
1196579590 X:117363126-117363148 GTCCTCTGCAAGGACGTGGATGG + Intergenic
1196777391 X:119352002-119352024 GTCCTCTGCAGGGACATGGATGG + Intergenic
1196978140 X:121182528-121182550 GTCCTCTGCAGGGACATGGATGG - Intergenic
1196994537 X:121367251-121367273 GTCCATTGCAGGGACATGGGTGG + Intergenic
1197094739 X:122580097-122580119 GTCTTCTGCAGGGACGTGGATGG + Intergenic
1197907192 X:131438133-131438155 GTCCTTTGCAGGGACGTGGATGG + Intergenic
1197955367 X:131940841-131940863 GTCCTTTGCAGTGACATGGATGG + Intergenic
1197962758 X:132023684-132023706 CTCCCAAGCAGTCACGTGGGCGG - Intergenic
1198259552 X:134953610-134953632 GTCCTTTGCAGGGACGTGGATGG + Intergenic
1198556782 X:137802486-137802508 GTCCTTTGCAGTGACATGGATGG - Intergenic
1198609440 X:138381648-138381670 GTCCTTTGCAGGGACATGGGTGG - Intergenic
1199719154 X:150529756-150529778 GTCCTCTGCAGGGACATGGATGG - Intergenic
1199754715 X:150853399-150853421 GTGCCCAGCAGTGAAGTGGGTGG - Intronic
1200074223 X:153543364-153543386 GGCCCCTCCAGTGCCGTGGACGG + Intronic
1200485334 Y:3762334-3762356 GTCCTTTGCAGGGACGTGGATGG - Intergenic
1200591166 Y:5078169-5078191 GTCCTTTGCAGTAACATGGGTGG - Intronic
1200597018 Y:5155622-5155644 GTCCTTTGCAGGGACGTGGATGG - Intronic
1200946426 Y:8844954-8844976 GTCCTCTGCAGGGACATGGATGG + Intergenic