ID: 932708875

View in Genome Browser
Species Human (GRCh38)
Location 2:74047670-74047692
Sequence GTTCCCACGGGACCTCCAGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 3, 3: 7, 4: 100}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932708875_932708880 -4 Left 932708875 2:74047670-74047692 CCAGCTGGAGGTCCCGTGGGAAC 0: 1
1: 0
2: 3
3: 7
4: 100
Right 932708880 2:74047689-74047711 GAACGGAGAAAGCTGCCCCTGGG 0: 1
1: 0
2: 0
3: 8
4: 108
932708875_932708879 -5 Left 932708875 2:74047670-74047692 CCAGCTGGAGGTCCCGTGGGAAC 0: 1
1: 0
2: 3
3: 7
4: 100
Right 932708879 2:74047688-74047710 GGAACGGAGAAAGCTGCCCCTGG 0: 1
1: 0
2: 0
3: 9
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932708875 Original CRISPR GTTCCCACGGGACCTCCAGC TGG (reversed) Exonic
900587219 1:3439024-3439046 GTTCCCCCAGCACCTCCAACAGG - Intergenic
900951804 1:5862246-5862268 CTTCCCACGGACTCTCCAGCTGG - Intergenic
901165823 1:7220925-7220947 GCTCCCTAGGGCCCTCCAGCTGG + Intronic
902843253 1:19088869-19088891 GTTCCCGCAGGGCTTCCAGCAGG + Exonic
913335093 1:117702651-117702673 GTTCCAGCCGGACCTCCAGTGGG + Intergenic
917448176 1:175124244-175124266 GTTGCCACGGGACCTAGAGATGG + Intronic
917649923 1:177066237-177066259 GTTCCCACTGGACCTCAGGCTGG + Intronic
923055593 1:230424535-230424557 AGGCCCAAGGGACCTCCAGCTGG - Intronic
1064007165 10:11707915-11707937 GGTCCCCCTGGCCCTCCAGCAGG - Intergenic
1064384681 10:14879250-14879272 GTGCCCCCCGGACCTCCAACCGG - Intronic
1064861668 10:19833348-19833370 GTGCCGACTGCACCTCCAGCAGG + Intronic
1065260466 10:23918536-23918558 ATTCCCACGGTAGCTCCAGTAGG + Intronic
1065852965 10:29805991-29806013 TATCCCAGGAGACCTCCAGCAGG + Intergenic
1074098704 10:110336095-110336117 GCTCTCACAGGACCCCCAGCAGG + Intergenic
1075742447 10:124704107-124704129 CCTCCCTCGGGACCTCCAGATGG + Intronic
1076346919 10:129785582-129785604 GTCCCCACGTGGCCTACAGCTGG - Intergenic
1076614415 10:131746555-131746577 CTTCCCACGGGGGCTGCAGCAGG + Intergenic
1077049144 11:558940-558962 GGTCACCTGGGACCTCCAGCAGG - Exonic
1080221970 11:29916600-29916622 GATCCCAAGGAAACTCCAGCAGG + Intergenic
1083233236 11:61336372-61336394 GTTCCCACCGGGCCACCAGGTGG + Intronic
1084719535 11:70895422-70895444 GCTTCCACAGGACCTGCAGCGGG - Intronic
1084946743 11:72642620-72642642 GTTCCCTCGGCCCTTCCAGCTGG + Intronic
1089646622 11:119884605-119884627 GACCCCTCAGGACCTCCAGCTGG + Intergenic
1091771914 12:3157670-3157692 TTTCCCTTGTGACCTCCAGCAGG - Intronic
1095963490 12:47850880-47850902 ATTCCCACGGTACCTCCAGCAGG + Intronic
1104870194 12:131989345-131989367 GTTCCCACTCGGCCTCCAACGGG - Intronic
1110104021 13:71647539-71647561 GTTCCCACGGGACATCTAAAAGG + Intronic
1110149763 13:72237249-72237271 GTTCACACGTGACCTCCATTTGG + Intergenic
1111733122 13:92101972-92101994 GTACCTATGGGACATCCAGCAGG + Intronic
1118652092 14:67907568-67907590 GTTCCAGCTGGACCCCCAGCAGG - Intronic
1119148056 14:72334131-72334153 GTTCCCACGGGGCCTCTTTCTGG - Intronic
1121038865 14:90728737-90728759 GTACCCCTGGGACCTCCAGGGGG + Intronic
1121436600 14:93924722-93924744 GTGCTCACGGGAGCTCCAGGAGG + Intronic
1122886898 14:104714217-104714239 CTGCCCACGGGATCTCCTGCAGG - Exonic
1122953899 14:105061105-105061127 GTTCCCACCGGGCCTCCTGCTGG - Intronic
1123714630 15:23017897-23017919 GTGACCAGGGGCCCTCCAGCAGG - Exonic
1123782710 15:23644008-23644030 GTGCCCACGGCCCCACCAGCAGG - Exonic
1124956201 15:34362236-34362258 GTTCCAACGCCACCTTCAGCCGG + Exonic
1127342527 15:58062944-58062966 ATTTCCACTGGACCTCTAGCAGG + Intronic
1129458171 15:75686782-75686804 GCAACCACGGGCCCTCCAGCAGG - Intronic
1129725615 15:77900100-77900122 GCAACCACGGGCCCTCCAGCAGG + Intergenic
1134090133 16:11387111-11387133 ATTCCCAGGGGCCCGCCAGCAGG + Exonic
1136750143 16:32628279-32628301 GCTTCCACAGGAGCTCCAGCAGG - Intergenic
1203052273 16_KI270728v1_random:887478-887500 GCTTCCACAGGAGCTCCAGCAGG - Intergenic
1142531725 17:583875-583897 GTTCCCAGAGAACCTCCATCAGG + Intronic
1142531746 17:583972-583994 GTTCCCAGGGAACCTCCCTCAGG + Intronic
1143121060 17:4607227-4607249 GTTCCCAAGGACCCACCAGCGGG - Intronic
1148157262 17:45431425-45431447 GTTCCAACGGGGGCCCCAGCAGG + Intronic
1148686393 17:49503440-49503462 GTTCCCTCGAGCCCTCCAGGTGG - Intronic
1151745643 17:76010300-76010322 GTTCTACCGGGACCCCCAGCTGG - Exonic
1152546720 17:81004043-81004065 GGTCCCACGGTCCCTCCCGCAGG - Intronic
1152760698 17:82105732-82105754 GTTCCCACGGTCCCTCCACAGGG + Intronic
1157286444 18:46380345-46380367 GTGCGCAGGGGACATCCAGCAGG + Intronic
1162387026 19:10365786-10365808 GTTCCTGCGGGACTTCCAGCCGG - Exonic
1162797478 19:13094383-13094405 GTGCCCACGGGAAGGCCAGCTGG + Intronic
1164515738 19:28933881-28933903 GATGCCAAGGGACCTCCATCTGG - Intergenic
1165748688 19:38246771-38246793 GTTCCTAAGGGACTTCCTGCTGG + Intronic
1167510880 19:49894855-49894877 GGTCCAACCAGACCTCCAGCTGG - Intronic
1167620266 19:50556491-50556513 GTTCCCACGACACCTCCAGGAGG + Intronic
1168238195 19:55076400-55076422 GCTCCCAGGGCACCTCCAGGTGG + Exonic
932708875 2:74047670-74047692 GTTCCCACGGGACCTCCAGCTGG - Exonic
933006187 2:76998376-76998398 CTTCCCAGGGCACCTACAGCTGG + Intronic
933006258 2:76999200-76999222 CTTCCCAGGGTACCTACAGCTGG - Intronic
935369607 2:102331581-102331603 GTTCCCATGGGACCTCCCAAGGG + Intronic
940868980 2:158844162-158844184 GTTCACACTGAGCCTCCAGCAGG + Intronic
945814831 2:214591554-214591576 TTTCCCAAGTGACCTCCAGAGGG - Intergenic
1169061592 20:2664193-2664215 CTTCCCACGCGACTTCCTGCGGG - Exonic
1169194389 20:3675386-3675408 GTTCCCAGGGGACCTGCAGCAGG + Intronic
1169843844 20:9968370-9968392 CTTACCATGGGATCTCCAGCAGG + Intergenic
1179888016 21:44322701-44322723 GTTCCCACGGGGAGCCCAGCGGG + Intronic
1179912412 21:44457100-44457122 GCTCCCACAGGGCCTCCTGCAGG - Exonic
1183418498 22:37696787-37696809 GCTCCCTGGGGACCCCCAGCGGG + Intronic
950881803 3:16328368-16328390 GTTCCCAAAGGGCCACCAGCAGG - Intronic
953069971 3:39509841-39509863 GTTCCCCAGGGACCCCCAGCAGG + Intronic
960972397 3:123149201-123149223 GTTACAATGGGACTTCCAGCTGG + Intronic
961390452 3:126549681-126549703 GTTCCCACCCCACTTCCAGCTGG - Exonic
961447665 3:126988406-126988428 GTGCCCACTGCACCTCCAGGAGG - Intergenic
968651240 4:1761100-1761122 GGGCCCACCTGACCTCCAGCCGG + Intergenic
969347486 4:6578525-6578547 GGTCCCTCAGGACCTCCAGTGGG + Intronic
969571445 4:8011082-8011104 GTCCCCAAGGGCCCTTCAGCTGG - Intronic
971996420 4:33971360-33971382 GTGCCCACAAGACCTTCAGCTGG - Intergenic
974318729 4:60315639-60315661 GTTCACACTGGGCCTCCATCAGG - Intergenic
979467554 4:121057908-121057930 GTTCCCAGGGGACTTGCAGTAGG - Intronic
981127790 4:141126615-141126637 GTTCCCATGTGCCCTCCAGTTGG - Intronic
982316149 4:154033972-154033994 GTTCCAAGGGGACCTACAGTAGG - Intergenic
985322622 4:188731655-188731677 GTTCCCATGTGACGTCCAGATGG - Intergenic
985678776 5:1245478-1245500 ATTTCCACGGTACCTGCAGCCGG + Intronic
988210069 5:28192588-28192610 GTTCCCATGGGATCTCAAGCTGG - Intergenic
990503536 5:56422219-56422241 ATTCCCACTGGACCTTAAGCAGG - Intergenic
991701005 5:69316496-69316518 CTTCCCACTGAACCTCCAGAAGG + Intronic
997528437 5:134568028-134568050 GTTTCCACTGGAGATCCAGCGGG - Intronic
997608350 5:135192548-135192570 GTTCCCATGGGGCCTTCAGCTGG + Intronic
999983080 5:156976502-156976524 GTTCCCACTTGAGCTCCAGTGGG + Intergenic
999983081 5:156976505-156976527 GTTCCCACTGGAGCTCAAGTGGG - Intergenic
1006855280 6:37128663-37128685 GTTCTCGTGGCACCTCCAGCTGG - Intergenic
1006916156 6:37595126-37595148 GATCCCACAGGAGCTCCAGGTGG + Intergenic
1019518751 7:1451198-1451220 AGCCCCACGTGACCTCCAGCTGG + Intronic
1019922158 7:4169806-4169828 GTGCCCAGGGGCCCTCCCGCAGG - Intronic
1019927993 7:4205928-4205950 GGTCCCACGTGACCTCCAGCTGG - Exonic
1023802442 7:43846567-43846589 GTGCCCATGGGACATCCAGGAGG + Intergenic
1031399478 7:121314440-121314462 GTTCCAAGGGGACCACCAGATGG - Intergenic
1032192557 7:129773066-129773088 TATCCCATGGGACCTGCAGCAGG + Intergenic
1034938740 7:155216445-155216467 GCTCCCACGGGGCCTTCACCAGG - Intergenic
1038001808 8:23398324-23398346 GTTGCCACAGGACATCCAGAGGG + Intronic
1048558361 8:135505370-135505392 GGTCCCAAGGGACCACAAGCAGG - Intronic
1049573153 8:143378862-143378884 GTTCCCACGGTTCCCGCAGCTGG - Intronic
1055406006 9:75974255-75974277 GGACCGACGGGAGCTCCAGCCGG + Intronic
1060828711 9:126700743-126700765 GCTCCCATGGGACCCCCAGGTGG - Exonic
1062157859 9:135063717-135063739 GTCCCCACTGGACCACCACCTGG - Intergenic
1190622631 X:52302879-52302901 GTTCACACAGGACCTGCAGATGG - Intergenic
1195004413 X:100671876-100671898 GTTCTCTGGGGCCCTCCAGCTGG + Intergenic