ID: 932711054

View in Genome Browser
Species Human (GRCh38)
Location 2:74063254-74063276
Sequence TCCCACCGTTGGTGAAGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 90}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932711052_932711054 17 Left 932711052 2:74063214-74063236 CCAGGCTTCTCATGTAAGATCAC 0: 1
1: 0
2: 0
3: 12
4: 95
Right 932711054 2:74063254-74063276 TCCCACCGTTGGTGAAGCCCAGG 0: 1
1: 0
2: 0
3: 3
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932711054 Original CRISPR TCCCACCGTTGGTGAAGCCC AGG Intronic
900174958 1:1287580-1287602 ACCCACCGTGGGTGATGCCGGGG - Exonic
900188373 1:1343268-1343290 TCCCAGTGTGGGGGAAGCCCTGG - Intronic
900349338 1:2227503-2227525 TCCCACCCTGGGAGAACCCCGGG + Intergenic
902441533 1:16433330-16433352 TCCCACCCCTGGTGCAGCTCTGG + Intronic
924333470 1:242964026-242964048 TCCCAGCCTTGGAGCAGCCCTGG + Intergenic
1063104919 10:2984691-2984713 TCCCAGCGCTGGTGAAGGCGCGG + Intergenic
1067953297 10:50765180-50765202 TCCCAGCCTTGGTATAGCCCAGG + Intronic
1070847469 10:79535148-79535170 TCCCCTCGTTTGTGAAGCCGAGG - Intergenic
1071495586 10:86165522-86165544 GCCCACCCCTGCTGAAGCCCAGG + Intronic
1073104068 10:101022243-101022265 CCCCACGGATGTTGAAGCCCAGG + Exonic
1076076475 10:127537645-127537667 TCACAACGTTGGAGAAGCCAAGG - Intergenic
1077106580 11:844905-844927 TCCCACCCTGGGTGTTGCCCTGG + Intronic
1077515036 11:2996263-2996285 CCCCACAGCTGGTGAAGGCCTGG - Intergenic
1077529910 11:3090297-3090319 TCCCACCGCTGGGGAGCCCCTGG + Intronic
1078981235 11:16537156-16537178 ACCCACCGTTGGTGATACCCAGG + Intronic
1096732466 12:53625783-53625805 TCCCACTCTTTGGGAAGCCCTGG + Intronic
1098667203 12:73179524-73179546 TCCCAGTGTTGGTGGATCCCAGG + Intergenic
1106138372 13:26991248-26991270 TCTCACAGGTGGTGAAGACCAGG - Intergenic
1113167501 13:107458633-107458655 TCCCAGTGGTGGTGAAGTCCAGG - Intronic
1121576860 14:94995814-94995836 TCCCACTGTTGGTAACTCCCTGG + Intergenic
1122421075 14:101577797-101577819 TCCCTCCACTGGTGAGGCCCTGG + Intergenic
1124412547 15:29448272-29448294 TCCCATCATAGGTGAAGCACTGG - Intronic
1125084965 15:35719254-35719276 TCCCACCTATGGTCAAGACCAGG + Intergenic
1128806242 15:70533132-70533154 TCCCACCCTTCCTGAAGGCCAGG + Intergenic
1130964447 15:88686492-88686514 TCCCATTGTGGGTGCAGCCCTGG + Intergenic
1132210828 15:100020932-100020954 TCCCAGCACTGGAGAAGCCCAGG - Intronic
1132405872 15:101541622-101541644 TCCCACGGTTGGGGACTCCCTGG + Intergenic
1133730526 16:8574748-8574770 TCCCAGAGTTGGTGCAGCCATGG + Intronic
1138366431 16:56481889-56481911 TCCCACAGCTGGGTAAGCCCTGG - Intronic
1151972605 17:77466554-77466576 TCCCACAGTAGGTCAACCCCAGG + Intronic
1152247717 17:79193971-79193993 TCCCTCTGCTGGTGATGCCCTGG - Intronic
1152575687 17:81139896-81139918 ACCCACCATGGGTGAGGCCCTGG - Intronic
1158932206 18:62333228-62333250 CCCCACAGTTGGAGAACCCCTGG - Intronic
1159035326 18:63271887-63271909 TCCCAGGGTTGATGAACCCCTGG + Intronic
1160575762 18:79852970-79852992 TCCCACCGTGGGGCAGGCCCTGG + Intergenic
1162743368 19:12785974-12785996 TGCCACTGCTGGTGAAGCCTTGG - Intronic
1164086699 19:21909163-21909185 TCCCACTTTTGGTGAGGCCGTGG - Intergenic
1164514977 19:28926371-28926393 TCCTACAGTTGGTGATGCCTGGG - Intergenic
1168721434 19:58556912-58556934 TCCCACTCTTGTAGAAGCCCTGG + Exonic
932711054 2:74063254-74063276 TCCCACCGTTGGTGAAGCCCAGG + Intronic
937308603 2:120887476-120887498 TCCCCGCGCTGGCGAAGCCCGGG + Intronic
947673469 2:231957690-231957712 TCTCAGCCTTGGTGAAGGCCAGG + Intergenic
1170554515 20:17504680-17504702 CCCCACCGTTGGAGGAACCCTGG - Intronic
1173580076 20:44140891-44140913 TCCCACCGTTGGAGAAACTGAGG + Intronic
1173840026 20:46151150-46151172 CCCCACCTTGGGTGAAGGCCAGG + Intergenic
1177834171 21:26170984-26171006 TCCCACTGTTCACGAAGCCCAGG - Intronic
1178870969 21:36374919-36374941 TCCCAGCATTTGTGAAGCCGAGG - Intronic
1179903416 21:44406749-44406771 TCCTACCGTCGATGTAGCCCGGG - Exonic
1180083342 21:45496721-45496743 TCCCACGGAAGGTGAAGGCCTGG + Intronic
1180758904 22:18183821-18183843 TCCCACCCTAGCTGAAGCCATGG + Intergenic
1180769191 22:18367612-18367634 TCCCACCCTAGCTGAAGCCATGG + Intergenic
1180777121 22:18494783-18494805 TCCCACCCTAGCTGAAGCCATGG - Intergenic
1180809841 22:18752092-18752114 TCCCACCCTAGCTGAAGCCATGG - Intergenic
1180827063 22:18870841-18870863 TCCCACCCTAGCTGAAGCCATGG + Intergenic
1181195984 22:21186344-21186366 TCCCACCCTAGCTGAAGCCATGG - Intergenic
1181213544 22:21306780-21306802 TCCCACCCTAGCTGAAGCCATGG + Intergenic
1181524231 22:23470091-23470113 TCCCACCCCAGCTGAAGCCCGGG + Intergenic
1183931673 22:41239045-41239067 TGCCACAGTGGGTGATGCCCAGG - Intronic
1203230815 22_KI270731v1_random:108497-108519 TCCCACCCTAGCTGAAGCCATGG + Intergenic
1203277208 22_KI270734v1_random:96746-96768 TCCCACCCTAGCTGAAGCCATGG + Intergenic
950638393 3:14332419-14332441 CCACACAGCTGGTGAAGCCCAGG - Intergenic
956192639 3:66622043-66622065 TCCCACAGGTGGTGAAGGCCTGG + Intergenic
956753454 3:72363271-72363293 TCCTACTGTTGCTGAAGTCCTGG + Intergenic
959375179 3:105580985-105581007 TCCCACTTTTGTAGAAGCCCTGG - Intergenic
963923951 3:150931719-150931741 TCCTACCGTTTGTGAAGTCTTGG - Intronic
973313015 4:48729573-48729595 AGCCACCGCTGGTGAAACCCAGG + Intronic
973982755 4:56319920-56319942 TCCCACAGTTTGGGAAGCCAAGG + Intronic
975904096 4:79188901-79188923 TCTCACTGTTGGTGATCCCCAGG - Intergenic
978608149 4:110504856-110504878 TCCCACCGTAGGTGGAGCAATGG - Intronic
978714387 4:111824169-111824191 TCCCAGCATTTGTGAAGCCTGGG - Intergenic
998139989 5:139694306-139694328 CCCCAGCCTTGGTCAAGCCCAGG - Intergenic
1001520488 5:172388643-172388665 TCCAGGAGTTGGTGAAGCCCTGG + Intronic
1002373069 5:178769957-178769979 TCCCACCGCTGGGAAGGCCCTGG + Intergenic
1003184554 6:3819842-3819864 TGCCACTGTTTATGAAGCCCAGG + Intergenic
1005097879 6:22138352-22138374 TCCCACTGCTACTGAAGCCCAGG + Intergenic
1007258501 6:40545420-40545442 ACCCATCGTTGGTGCTGCCCAGG - Intronic
1007968195 6:46023418-46023440 TCCCTCCATTGCTAAAGCCCAGG + Intronic
1008700737 6:54096525-54096547 GCCCACAGCTGGTGAAGCCTTGG + Intronic
1010806362 6:80241564-80241586 ACCCTCCGCTGGTGATGCCCAGG - Intronic
1014200238 6:118601308-118601330 TCCCACCTTTGCTCAAACCCTGG + Intronic
1018969529 6:168516994-168517016 TCTTTCCGTTGGTGAACCCCTGG + Intronic
1029142859 7:98424048-98424070 TCCAACCTTTGGTGTATCCCTGG - Intergenic
1034348041 7:150398937-150398959 AACCACCCTTGCTGAAGCCCGGG + Intronic
1038647706 8:29374845-29374867 CCCCAGTGATGGTGAAGCCCTGG + Intergenic
1056170484 9:83980277-83980299 TCGCACCATCGCTGAAGCCCTGG - Intronic
1060994838 9:127870052-127870074 TCCCTCCTTCGGTGAAGCCCTGG + Intronic
1062289287 9:135787341-135787363 TACCTCCGTTGATGAAGCCATGG + Intronic
1187189847 X:17023753-17023775 TCCCACGGTGGTTGATGCCCTGG + Intronic
1194772467 X:97921870-97921892 AGCCTCCGTTGGTGAAACCCAGG + Intergenic
1198095627 X:133377176-133377198 TCCCACAGTTGGCAGAGCCCTGG - Intronic
1199896825 X:152134981-152135003 TCCCATCATAGGTGAGGCCCAGG + Exonic
1200226801 X:154422033-154422055 TCCCACCTATGATGCAGCCCAGG - Intergenic
1202391334 Y:24373362-24373384 TCCCAGCCTTGGAGCAGCCCTGG - Intergenic
1202479451 Y:25296755-25296777 TCCCAGCCTTGGAGCAGCCCTGG + Intergenic