ID: 932711612

View in Genome Browser
Species Human (GRCh38)
Location 2:74069513-74069535
Sequence GATCCAGGTGGTGGTCACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 1, 1: 0, 2: 6, 3: 48, 4: 236}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932711612_932711616 6 Left 932711612 2:74069513-74069535 CCTGTGTGACCACCACCTGGATC 0: 1
1: 0
2: 6
3: 48
4: 236
Right 932711616 2:74069542-74069564 TAGACCACTTCTAGCCCCCCAGG 0: 1
1: 0
2: 0
3: 3
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932711612 Original CRISPR GATCCAGGTGGTGGTCACAC AGG (reversed) Intronic
901158733 1:7158693-7158715 AATCCAGGTGGTGGAAACAAGGG + Intronic
902768857 1:18634162-18634184 AATCCCGGTGGTCCTCACACTGG - Intronic
905752017 1:40473763-40473785 AATCCACGAGGTGGTTACACAGG - Intergenic
908094030 1:60718430-60718452 AATCCAGGTGGTGATCACATGGG + Intergenic
909137872 1:71823904-71823926 CATGCAGGTGGTGATCACACAGG + Intronic
911563928 1:99440105-99440127 GATCTGGGTGGTGGTTACATAGG + Intergenic
911566750 1:99471449-99471471 GAACAATGTGGTGGTCACAATGG - Intergenic
916674393 1:167053918-167053940 CCTCCAGGTGCTGGGCACACAGG + Exonic
916936545 1:169633662-169633684 GCTCCTGGTGGTGGTGACACTGG - Intergenic
917861349 1:179147752-179147774 TATTCAGGTGATGGTTACACTGG + Intronic
918378396 1:183931613-183931635 GATCCAGGTGGTCTTAAAACTGG - Intronic
918584916 1:186175645-186175667 GATCCAGCTGGTGGCCAAATTGG - Intronic
920053514 1:203177295-203177317 GACCTGGGTGGTGGTTACACAGG + Intergenic
920385256 1:205567065-205567087 GATCTAGGTGGTAGTTACACAGG - Intergenic
920799329 1:209172931-209172953 GTTCCAGGTGGTAGTGAGACGGG + Intergenic
921503867 1:215942260-215942282 GATACAGCAAGTGGTCACACTGG - Intronic
923054914 1:230418814-230418836 GATCTGGGTGGTAGTGACACAGG + Intronic
923143244 1:231179350-231179372 GGTTAAGGTGGGGGTCACACTGG - Intronic
923165152 1:231354469-231354491 GATCCGGGTGGTAGTTACACAGG - Exonic
923298470 1:232618027-232618049 GATCCAGGAGGTGGGTACAGAGG + Intergenic
923646487 1:235826646-235826668 GATCTGGGTGGTGATGACACAGG + Intronic
1064289636 10:14021703-14021725 AATCTGGGTGGTGGTTACACAGG + Intronic
1065093744 10:22261283-22261305 GATCCAGGTGCTGGTTATACAGG - Intergenic
1065270289 10:24024026-24024048 GGTCTGGGTGGTGGTTACACAGG + Intronic
1066048809 10:31617438-31617460 GATCCAGGTGGAGGGCACAGGGG - Intergenic
1067949744 10:50721889-50721911 GATCTAGGTGCTGGTTACATAGG - Intergenic
1068961439 10:62870477-62870499 GAGCTGGGTGCTGGTCACACAGG + Intronic
1069760150 10:70804530-70804552 GATCTATGTGGTGGTTACATGGG + Intergenic
1072631969 10:97152381-97152403 GGTCCAGGTGCAGGTCACGCTGG + Intronic
1074214517 10:111371067-111371089 GATGCAGCTGGAGGTCACGCAGG - Intergenic
1074384544 10:113006537-113006559 GATCTGGGTCGTGGTTACACAGG - Intronic
1075232933 10:120699539-120699561 GAGCCAGTGGGTGGTCTCACTGG - Intergenic
1075572017 10:123552995-123553017 GAGCCAGGTGTTGGCCACAGAGG - Intergenic
1077649291 11:3955288-3955310 GATTGGGGTGGTGGTTACACAGG + Intronic
1077661829 11:4075317-4075339 GATCTGGGTGGTAGTAACACAGG - Intronic
1078329422 11:10407536-10407558 GATCATGGTAGTGGTGACACTGG + Intronic
1080650039 11:34215025-34215047 GCCCCAGGTGGTGGTGACTCAGG + Intronic
1080730410 11:34945804-34945826 GATCTAGGTGGTGGTAACATGGG - Intronic
1083443635 11:62692749-62692771 GCTCCAGATGCTGGACACACTGG - Exonic
1083701332 11:64479992-64480014 GATGAAGGTGGTGGTTACACAGG - Intergenic
1084287036 11:68138699-68138721 GAGCTAGGTGGTGGGTACACAGG + Intergenic
1084428371 11:69097810-69097832 GATCCAGGTGGGGACCACGCAGG - Intergenic
1085553703 11:77399978-77400000 AATCTAGGTGGTGGGTACACAGG + Intronic
1087696719 11:101387021-101387043 GATCTAGGTAATGGTTACACAGG - Intergenic
1088796966 11:113273046-113273068 GGTCAGGGTGGTGGTCTCACTGG - Intronic
1089516104 11:119032762-119032784 AATTTAGGTGGTGGTTACACGGG - Intergenic
1090162830 11:124514011-124514033 AATCCAGCTTGTGGTTACACAGG + Intergenic
1091338417 11:134791851-134791873 GTACCGGGTGGTGGTCACACAGG + Intergenic
1094655798 12:32418695-32418717 TAGCCAGGTAGTGGTTACACCGG - Intronic
1096237315 12:49938462-49938484 GAACCAGGTTCTGGTTACACAGG - Intergenic
1098905747 12:76160569-76160591 TATCCAGGTGCTGGTTGCACAGG - Intergenic
1099118723 12:78661037-78661059 GATCAAGGTGGAGGTCCCAGAGG + Intergenic
1099136255 12:78906676-78906698 GATGCAGGTCGTGGACAGACTGG + Intronic
1100439572 12:94603686-94603708 GATCCAGGTGGCAGTCACTCAGG + Intronic
1100517911 12:95345796-95345818 GATCTGGGTGGTGATTACACAGG + Intergenic
1100624001 12:96310636-96310658 GATCCAGGTACTGGTTACACAGG + Intronic
1101062140 12:100983455-100983477 AATCAAGGTGTTGGTCACCCTGG + Intronic
1101980176 12:109399262-109399284 GATCTGGGTGGTGGTTACAGAGG - Intronic
1101981655 12:109412627-109412649 GATCCGCATGGTGGTTACACAGG - Intronic
1102316483 12:111891908-111891930 GATCTAGGTGCTGGTTACAGAGG - Intronic
1102473449 12:113173569-113173591 GACCCAGGCGGGGGTCACACAGG + Intronic
1102895028 12:116592093-116592115 GATCCAGGTGCTGGAGATACAGG - Intergenic
1104067213 12:125315931-125315953 CATCCAGGGGGTGGTGACCCAGG - Intronic
1105790486 13:23793441-23793463 GATCTGGGTGGTGGTTCCACAGG + Intronic
1107524114 13:41213519-41213541 TAGCCAGGTGGTGGTTACAATGG - Intergenic
1108202054 13:48053887-48053909 GATCTAGGTGGTGGTTATATAGG - Intronic
1108950680 13:56088224-56088246 GATGCAAGTGGTGGGCTCACAGG - Intergenic
1110077571 13:71267918-71267940 GATCCAGGTTCTGGACACATGGG + Intergenic
1112677977 13:101726470-101726492 GATCTAGGTGATGGTTGCACAGG - Intronic
1114613861 14:24058188-24058210 GATCCAGGTGCAGGTCACTGAGG - Exonic
1116828094 14:49691606-49691628 GATTGAGGTGGTGGTTACATGGG - Intergenic
1117764720 14:59069772-59069794 GAGCCTGGTGGTGCTCACAGAGG - Intergenic
1118478222 14:66138928-66138950 GATCTTGGTGGTGGTCACACAGG - Intergenic
1118507866 14:66434410-66434432 GATCAAGGTGGTGGTGACTGTGG - Intergenic
1118720468 14:68590371-68590393 GATCCAAGGGGTGGCCAGACTGG - Intronic
1118985641 14:70752513-70752535 TATCCAGGTAGTGGTCATGCTGG + Intronic
1120864610 14:89285061-89285083 AATCCAGGTGGTTCTCACAATGG - Intronic
1121240572 14:92427198-92427220 CATCCAGGCAGAGGTCACACTGG + Intronic
1121624843 14:95376228-95376250 GATCAAGGTGGTGGTCACTTAGG - Intergenic
1121673912 14:95736679-95736701 GAGCTGGGTGCTGGTCACACAGG + Intergenic
1121705545 14:95990572-95990594 CTTCTAGGTGGTGGTCACCCTGG + Intergenic
1122256968 14:100485501-100485523 GATACAGGAGGTGGGAACACAGG + Intronic
1123117207 14:105900115-105900137 GGTCAAGGTCGGGGTCACACTGG + Intergenic
1124644959 15:31432001-31432023 GATGCAAGTGGTGGCTACACAGG + Intronic
1125391559 15:39198169-39198191 GATCCTGTTGGAGGTGACACTGG - Intergenic
1125447288 15:39771761-39771783 AATCCAGGAGGTGGTTAAACAGG + Intronic
1125762704 15:42108017-42108039 GATCAAGGTGGTGGTTACAGGGG + Intergenic
1127323102 15:57866605-57866627 GATCCAGGTGGTGGGTATATTGG - Intergenic
1129155277 15:73713725-73713747 GAAGCATGTGCTGGTCACACTGG + Exonic
1129744323 15:78007658-78007680 CATCCAGGGGCTGGCCACACTGG + Intronic
1131018435 15:89077084-89077106 GAGCTGGGTGGTGGTTACACAGG - Intergenic
1133574942 16:7079738-7079760 GATCTAGGTGGTGGTTACACAGG + Intronic
1137432947 16:48433315-48433337 GCTCCAGGTGGGAGTCACAGAGG - Intronic
1137866929 16:51907410-51907432 GATCTGGGTAGTGGACACACAGG - Intergenic
1139389608 16:66598512-66598534 GATTGGGGTGGTGGTTACACAGG - Intergenic
1139521949 16:67488208-67488230 GATCTCAGTGGTGGTCACGCAGG + Intergenic
1139594608 16:67950450-67950472 GAACTTGGTGGTGGGCACACTGG - Exonic
1139797558 16:69495865-69495887 GGCCCAGGAGGAGGTCACACAGG - Intergenic
1140692631 16:77498965-77498987 GTTCCAGACGGTGGTAACACAGG + Intergenic
1141161490 16:81632123-81632145 GATCCAGGTGGTGGTTACTCAGG - Intronic
1142191685 16:88721051-88721073 GATCCAGGTGGGCCTCGCACTGG + Intronic
1143413793 17:6729746-6729768 TATCCAGATAGTGGTCACAGTGG + Intergenic
1143566983 17:7728236-7728258 AATCTGGGTGGTGGTCATACAGG + Intronic
1144362329 17:14507341-14507363 GATTATGGTGGTGGTAACACAGG + Intergenic
1144771236 17:17760725-17760747 GTTCCAGGTGCTGGTGCCACAGG + Intronic
1144887668 17:18474718-18474740 GTTCTGGGTGGTGGTCCCACAGG - Intergenic
1144957149 17:19024450-19024472 GTTCCAGGTGGTAGTGAGACGGG - Intronic
1145144548 17:20469582-20469604 GTTCTGGGTGGTGGTCCCACAGG + Intergenic
1145176000 17:20700984-20701006 GTTCTGGGTGGTGGTCCCACAGG + Intergenic
1145243775 17:21254340-21254362 GATTTGGATGGTGGTCACACGGG - Intergenic
1145806884 17:27740731-27740753 GTTCTGGGTGGTGGTCACACAGG - Intergenic
1147673922 17:42192334-42192356 GCTGCAGGTGGTGGTGACTCTGG - Exonic
1147744014 17:42684109-42684131 GATCCGGGCCGTGGCCACACAGG + Exonic
1148641084 17:49188156-49188178 GATCTAGGTGATGGTGACACAGG + Intergenic
1151167229 17:72215356-72215378 GATCCAGGCGCTGATTACACAGG + Intergenic
1151457734 17:74236559-74236581 GGGCCACGTGGTGGGCACACAGG + Intronic
1152017475 17:77761132-77761154 GATCAAGGTGGAGGCCACAGAGG + Intergenic
1152128676 17:78462747-78462769 CATCCACGGGCTGGTCACACTGG - Intronic
1152568605 17:81111441-81111463 GAGCCAGGTGTTGGGCCCACTGG + Intronic
1153734035 18:8045737-8045759 GATTGTGGTGATGGTCACACAGG + Intronic
1153890938 18:9514472-9514494 GATCCTTGTAGTGGTTACACAGG - Intronic
1156460037 18:37316447-37316469 GATCCTGGTGGTGGTAGCAGGGG + Intronic
1157065166 18:44341454-44341476 TAGCCAGGTAGTGGTTACACTGG - Intergenic
1157885936 18:51366383-51366405 GATCTCAGTGGTGGTTACACAGG - Intergenic
1157966188 18:52211020-52211042 GATCCAGGTGGTGGGCAGAGAGG + Intergenic
1158014364 18:52766396-52766418 GATACAGGAGGCTGTCACACTGG - Intronic
1159064047 18:63549824-63549846 GAGCCACATGGTGGTCACTCAGG + Intergenic
1159561013 18:69994863-69994885 GATTCAGGTTATGGTAACACAGG - Intergenic
1159875756 18:73809187-73809209 AATCAAGGTGGTGGTCGCCCAGG - Intergenic
1160097767 18:75890747-75890769 GATGCCAGTGGAGGTCACACAGG + Intergenic
1160257359 18:77258987-77259009 GATGGTGGTGGTGGTCACAGTGG + Intronic
1160257410 18:77259235-77259257 GATGGTGGTGGTGGTCACAGTGG + Intronic
1160257435 18:77259353-77259375 GATGGTGGTGGTGGTCACAGTGG + Intronic
1160307012 18:77749365-77749387 GCTCCAGGTGGCGGTCTCCCGGG - Intergenic
1162535588 19:11261706-11261728 GAACCAGCTGGTGGGCAGACGGG - Intronic
1162728898 19:12705969-12705991 GAACCAGGAGGTGGTAACCCAGG - Intronic
1163739182 19:19000144-19000166 AATCCGGGGGGTGGTCACACAGG - Intronic
1164487370 19:28670304-28670326 GATCTGGGTGGTGGTTACATGGG + Intergenic
1166229839 19:41420155-41420177 AATCCAGAGTGTGGTCACACAGG - Intronic
1166865587 19:45834678-45834700 GATCTGGGTGATGGTTACACTGG + Intronic
1168637383 19:58007101-58007123 GATCTGGGTGGTGGTTACACAGG + Exonic
927576642 2:24206835-24206857 GGTCCAGGTAGAAGTCACACTGG + Intronic
927962402 2:27249323-27249345 GGACCAGGACGTGGTCACACAGG - Intergenic
928773917 2:34736162-34736184 GATCCAGGTATTGGTTGCACAGG - Intergenic
929171705 2:38938656-38938678 GATCTGGGTGGTGATCACAGGGG - Intronic
932704309 2:74011325-74011347 GATCCAGGTGCTGATTACACAGG - Intronic
932711612 2:74069513-74069535 GATCCAGGTGGTGGTCACACAGG - Intronic
934876147 2:97922811-97922833 AATCTGGGTGGTGGTTACACAGG + Intronic
935668183 2:105532252-105532274 GATCTGGGTGGTGGTTACAGAGG + Intergenic
940754584 2:157667384-157667406 GATCTAGGTGTTGGTTACATGGG + Intergenic
942182246 2:173391149-173391171 GATCTAGGGGGTGGTGACATGGG - Intergenic
945740579 2:213655634-213655656 GATCCTGGGGCTGGTCACATAGG + Intronic
947387234 2:229603675-229603697 GATCTGAGTGGTGGTTACACAGG + Intronic
948791365 2:240378847-240378869 GGACCCGGTGGTGGCCACACAGG + Intergenic
1171380314 20:24729610-24729632 TATACGGGTGGTAGTCACACGGG + Intergenic
1172041444 20:32049392-32049414 GATTGGGGTGGTGGTTACACAGG + Intergenic
1172422556 20:34829638-34829660 GATCTAGGTGGTGGTAACACAGG - Intergenic
1172781613 20:37439911-37439933 GGGGCAGGTGGTGGTCACAGAGG - Intergenic
1173384141 20:42572784-42572806 GCTCCAGGTGGTGTTTACACAGG - Intronic
1173547003 20:43905355-43905377 AATCCAGGTGGTGGATACACAGG - Intergenic
1173713638 20:45181876-45181898 GATCCAGATGGTGGAAACAAAGG - Intergenic
1173979107 20:47209086-47209108 CAGCCAGGTGGTGGGCACACTGG - Intergenic
1174389771 20:50211303-50211325 TATCCAAGTGCTGCTCACACTGG - Intergenic
1174530095 20:51204881-51204903 GATCATGGTGGTGGTTACATGGG - Intergenic
1176078508 20:63260109-63260131 GAGCCAGGTGGGTGTCAGACCGG - Intronic
1176898770 21:14415779-14415801 GATCAGTGTGGTGGTTACACAGG + Intergenic
1177207173 21:18023374-18023396 GTTCCAGCTGGTAGTCATACAGG + Intronic
1178205167 21:30456345-30456367 GCTCCAGGTCCTGGGCACACTGG + Intergenic
1178749256 21:35284807-35284829 GATCTGGGTGGTGGTTACACGGG - Intronic
1181172116 22:21015630-21015652 GATACAGCTGGTGGTCTCTCTGG - Intronic
1181717027 22:24738410-24738432 TAGCCTGGTGGTGGTCACAGTGG + Intronic
1183497969 22:38160949-38160971 GATTCGAGTGGTGGTTACACAGG + Intronic
1184796210 22:46734557-46734579 GATCCGGGTGATGTTTACACAGG + Intronic
950396027 3:12734719-12734741 GGTCGCAGTGGTGGTCACACTGG + Exonic
950472779 3:13196915-13196937 GATCCGGGTGGGGGTGTCACCGG + Intergenic
950634616 3:14306079-14306101 GATCCGGGTGGTGGCTCCACGGG + Intergenic
950651116 3:14407403-14407425 GATTTGGGTGGTGGTTACACAGG - Intronic
952295699 3:32060026-32060048 GATCTGGTTGGTGGTTACACAGG + Intronic
953758677 3:45669504-45669526 GATCTGGGTGGTGGTTACAGGGG - Intronic
954151657 3:48660810-48660832 GATCCAGGTGGTGGCACCTCTGG - Exonic
954165850 3:48757334-48757356 GATCTAGGAGGTGGTTATACAGG - Intronic
955402105 3:58599621-58599643 GATCTGAGTGGTGGTTACACAGG + Intronic
956398805 3:68854206-68854228 GCTCCAGGTGGAGGGAACACAGG + Intronic
956615141 3:71163433-71163455 GACTCAGGTGGTGGAAACACAGG + Intronic
957036143 3:75294833-75294855 GATTGTGGTGATGGTCACACAGG + Intergenic
958840070 3:99192411-99192433 TATCCAGGTAGTGGTTACACCGG + Intergenic
960611552 3:119559332-119559354 GATCCAGGAGGTGGTAGCAGAGG + Intronic
961035005 3:123636099-123636121 GATCCGGGTAGAGGTTACACAGG + Intronic
961072771 3:123950699-123950721 GATCTAGGTGGTGGCTACAGGGG + Intronic
961495287 3:127287152-127287174 GATGGAGGTGGTGGTCCCAAAGG + Intergenic
961537997 3:127581515-127581537 GATCCAGGTGGTGGGTACACAGG + Intronic
961860356 3:129912369-129912391 GATCTGGGTGGTGGTTACACAGG + Intergenic
962542710 3:136399298-136399320 GATGTGGGTGGTGGTTACACAGG - Intronic
964187698 3:153966386-153966408 GATCTAAGTGGTGGTCAGCCCGG - Intergenic
964651763 3:159019414-159019436 GATCTGGATGGTGGTTACACAGG - Intronic
965282490 3:166771358-166771380 GATACAGAAAGTGGTCACACTGG + Intergenic
966813760 3:183871781-183871803 GATTTAGGTGATAGTCACACAGG + Intronic
967275705 3:187772474-187772496 GATCCAGGTGGTGATCAAAGAGG + Intergenic
968233008 3:197015349-197015371 GATCCAGGTGGGAGTCACGCAGG - Exonic
968643279 4:1725762-1725784 GGCCCAGGTGGTGGTCACTGTGG + Intronic
969713264 4:8856579-8856601 GATGCGGGTGGTGGCTACACGGG + Intronic
971201115 4:24509868-24509890 GATGCAGGGGGTGGATACACGGG + Intergenic
971241715 4:24895260-24895282 GCTCTGGGTGGTGGTTACACAGG + Intronic
971388003 4:26159332-26159354 CATCCAGGTGGTGGAAAAACTGG - Intergenic
973705404 4:53575749-53575771 CATCCTGGTGGTAGTCACAGTGG + Intronic
974769990 4:66400421-66400443 TATCCAGGTAGTGGTTACAGAGG - Intergenic
974877591 4:67717278-67717300 GAACCAGGTGGTGGCCACCATGG + Intergenic
975547054 4:75570556-75570578 GGTCTGGGTGGTGGTCACAGGGG + Intergenic
979722615 4:123919691-123919713 GATCAAGGTGGTGATCACTCTGG - Intergenic
987198535 5:15551410-15551432 TATCCAACTGGTAGTCACACTGG + Intronic
987255854 5:16150080-16150102 GATCTGGGTGGTGGTGACACAGG + Intronic
988387931 5:30590770-30590792 GATCCACGTGGTGGTCTTAAGGG - Intergenic
989203982 5:38793419-38793441 GAGCCCAGTGGTGATCACACAGG + Intergenic
990744346 5:58943455-58943477 GATCCAGATGGTGATCCTACTGG + Intergenic
991617953 5:68516800-68516822 GATCCAGGTGTGGGACGCACTGG - Intergenic
993029746 5:82692185-82692207 AATCTAGGTGGTGGTTACCCAGG - Intergenic
993044794 5:82854845-82854867 GATGCAGATGGTTCTCACACTGG + Intergenic
996014844 5:118521734-118521756 AATGCAGATGGTGGTCACATGGG - Intergenic
996605767 5:125319707-125319729 GATCAAGGTGTTGGTTACATGGG - Intergenic
998042496 5:138960961-138960983 GATCTGGGTGGTGGTTACATGGG + Intronic
998649028 5:144096870-144096892 GATCTGGATGGTGGTTACACAGG - Intergenic
998917274 5:147028366-147028388 GATCTAGGTGGTGGTAAAATGGG - Intronic
999667201 5:153925301-153925323 GATCCAGGTGCTGGAGTCACTGG - Intergenic
999804632 5:155070344-155070366 GATCCAGGTGGTGGCAACAGGGG - Intergenic
999984658 5:156991805-156991827 GGTAAAGGTGGTGGCCACACAGG + Intergenic
1000651805 5:163827459-163827481 GATCTAGGGAGTGGTCACACAGG - Intergenic
1000729715 5:164818388-164818410 AATCTAGGTGGTGATTACACAGG + Intergenic
1001345758 5:170896931-170896953 GACCCAGTTGGTGGTCATACTGG + Intronic
1001878506 5:175221908-175221930 AATCTAGGGGGTGGGCACACAGG + Intergenic
1002299282 5:178248281-178248303 GATACAGGTGCTGGACACAAAGG - Intronic
1002571168 5:180140097-180140119 GACCCAGGTGCTGGGCACATGGG + Intronic
1006669237 6:35719379-35719401 GATCTAGGTGATGGTTACATGGG + Intronic
1006745600 6:36339811-36339833 CATCTGGGTGGTGGTTACACAGG - Intergenic
1006787694 6:36679335-36679357 CAGCCAGGTGGTGGACACAGTGG - Intronic
1011322755 6:86115422-86115444 TAGCCAGGTGGTGGTTACAGTGG - Intergenic
1012709552 6:102581972-102581994 GTTCCAGGTGGAGTACACACCGG + Intergenic
1012749203 6:103136224-103136246 GATCATGGTGATGGTAACACAGG + Intergenic
1013821589 6:114159614-114159636 GATCCAAGTGCTAGTTACACAGG + Intronic
1015767204 6:136731188-136731210 GATCTAGGTGCTGGTTACTCTGG + Intronic
1018240874 6:161773146-161773168 GATCCAGGTGGTGGTTACAGAGG + Intronic
1019652265 7:2166409-2166431 CATCCCTGGGGTGGTCACACGGG - Intronic
1020734474 7:11930108-11930130 GCTCCAGGTGGGGGTCAAAATGG - Intergenic
1023278989 7:38550626-38550648 TATCCAGGTGATGGTTACACTGG - Intronic
1026016458 7:66674851-66674873 GATCTAGGTGGTGGTTGGACGGG + Intronic
1026512184 7:71036758-71036780 GACCTCGGTGGTGGTCACACAGG - Intergenic
1029138900 7:98395541-98395563 GATCTGGGTGGTGGTTACACAGG + Intronic
1033409334 7:141102959-141102981 GATCCAGATGGTGGTTCCAGAGG - Intronic
1035729745 8:1845715-1845737 AATCCAGGTGGTGGTACCGCTGG - Intronic
1035926787 8:3736552-3736574 GAGGCAGGTGGTAGACACACTGG - Intronic
1039651169 8:39340648-39340670 GATCTAGGTGGAGGTCACCATGG + Intergenic
1041579815 8:59446353-59446375 GAGGCAGGTGGTGGTTACAGTGG - Intergenic
1042139588 8:65664493-65664515 GATCTAGGTGGTGGTTACAAAGG + Intronic
1043425131 8:80141034-80141056 GATCCACGTGTTGCTAACACTGG - Intronic
1044605090 8:94041422-94041444 GATTTAGGTGGGGGTGACACAGG - Intergenic
1046665208 8:116994671-116994693 GATTCAGGAAGTGGTTACACAGG + Intronic
1048331834 8:133475911-133475933 GAACCAGGTGGTGGCCACCATGG + Exonic
1049295360 8:141830901-141830923 GATGCCAGTGTTGGTCACACAGG - Intergenic
1051115235 9:13686797-13686819 GATCTAGGTGGTGCTTACACAGG + Intergenic
1053241910 9:36502750-36502772 GATCCAGATCATGGTTACACAGG - Intergenic
1053509406 9:38674848-38674870 GACCTAGGTGATGGTTACACAGG + Intergenic
1054705671 9:68459286-68459308 GATCCAGATGGTAGTTACACGGG - Intronic
1054833435 9:69651325-69651347 GATCTGGGTGGTGGTTACACAGG + Intronic
1055050812 9:71978690-71978712 GATCCAGGTGGTAGCTACACAGG + Intronic
1055935035 9:81596826-81596848 GATCCAAGGGCTGGTTACACAGG + Intronic
1056232364 9:84559519-84559541 GATTTAGGTGGTAGTCACAGAGG + Intergenic
1056762386 9:89424744-89424766 GAGCCAGGTGGAGGCCTCACAGG - Intronic
1057009897 9:91591514-91591536 GACCCAGGTGGTGCTCACAGGGG - Intronic
1057186828 9:93061807-93061829 GACCCAGATTGAGGTCACACAGG + Intronic
1057531589 9:95851900-95851922 GCTCCAGATGGTGGTTACACAGG + Intergenic
1060498667 9:124136443-124136465 GAACCAGGTAGTGGTTACAAGGG - Intergenic
1060934448 9:127507149-127507171 GACGCAGGTGGTGGTGACTCAGG + Exonic
1062053529 9:134459148-134459170 GAACTAGCTGGGGGTCACACAGG - Intergenic
1062065202 9:134523029-134523051 AATCCAGGTGGTGGTCGTATGGG - Intergenic
1062676387 9:137747746-137747768 GATCTGGGTGGTGGCCACACAGG - Intronic
1185913893 X:4013407-4013429 GATACAGGTGGTGAAGACACAGG - Intergenic
1187312362 X:18157539-18157561 GATCTGGGTAGTTGTCACACAGG - Intergenic
1187491145 X:19752627-19752649 GGTCTGGGTGGTGGTTACACAGG + Intronic
1187867030 X:23732485-23732507 AATCCAGGTGGTGGGTACACAGG + Intronic
1189235341 X:39482659-39482681 GATCTGGGTGGTGGTTACATGGG + Intergenic
1189488638 X:41452271-41452293 GATTGGGGTGGTGGTTACACAGG + Intronic
1190015222 X:46820526-46820548 TAACCAGGTGGTGGTTACAGAGG + Intergenic
1190278685 X:48915322-48915344 GGTGCAGGTGGTGGGCACCCTGG - Exonic
1191188429 X:57638848-57638870 TAACCAGGTAGTGGTCACAGTGG + Intergenic
1192221757 X:69202141-69202163 GACCTAGGTGGTGGTTACAGAGG - Intergenic
1194500794 X:94678848-94678870 TAGCCAGGTGGTGGTTACAGTGG - Intergenic
1195997720 X:110747687-110747709 GATCCACGTGGTAGTCACATGGG - Intronic
1196475585 X:116080545-116080567 GGTCCCGGTGGTGGTAACAGTGG - Intergenic
1199880622 X:151971942-151971964 GATCTAGGTGTTGGTTACACGGG + Intronic
1200388808 X:155921329-155921351 GATCTGGGTGGTGGTTACATGGG - Intronic
1200951394 Y:8902854-8902876 GAGCCAGGTGGTAGGCACAGGGG - Intergenic
1201372330 Y:13278898-13278920 GAGCCAGGCAGTGGTCACCCTGG + Intronic