ID: 932713150

View in Genome Browser
Species Human (GRCh38)
Location 2:74082464-74082486
Sequence GGGTGTCACTGAGCCCTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 212}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932713150 Original CRISPR GGGTGTCACTGAGCCCTGGT GGG Intronic
901269489 1:7940911-7940933 GGCTGTCACAGAGCTGTGGTGGG - Exonic
902412078 1:16217578-16217600 GCGTGGCGCTGAGCCTTGGTTGG - Intergenic
902922062 1:19672021-19672043 GGGTGGCACTGAGCCATCCTTGG + Intronic
903005032 1:20292836-20292858 GGTGGTCACTGTGCCCGGGTGGG + Intronic
903358664 1:22763404-22763426 CTGTGTGACTGGGCCCTGGTGGG - Intronic
903931009 1:26862614-26862636 GTGTGTCACAGAGACATGGTGGG + Intergenic
905004583 1:34699478-34699500 GGGTGTTAATGAACCCTGTTGGG - Intergenic
908608826 1:65832678-65832700 ATGTATCACTGAGTCCTGGTAGG + Intronic
911497726 1:98651150-98651172 GGGTGCCGATGAGCACTGGTGGG - Intergenic
915861917 1:159453692-159453714 AGGTGTCAGTGTGCCCTGCTGGG - Intergenic
916166899 1:161972855-161972877 AGGGGCCACTGGGCCCTGGTGGG + Intergenic
917262855 1:173188800-173188822 GGGAATCACTGAGCCCAGGGAGG - Intronic
920304938 1:205012682-205012704 GAGTGTCAGTGAGCCCAGGGCGG + Intronic
920810237 1:209278593-209278615 GGGTCTCACTGTGCCCAGGCTGG - Intergenic
922901251 1:229138542-229138564 GGGTATCAGTGAGCCCAGTTGGG + Intergenic
923933130 1:238726498-238726520 TGGTGTCACTGAGGCCCAGTGGG - Intergenic
1062762533 10:36200-36222 AGGTGTCAGTGTGCCCTGCTGGG - Intergenic
1067047330 10:42991946-42991968 GGGTGCCACTCAGCCCTTGGAGG + Intergenic
1067295686 10:44974121-44974143 GGGTGGCAGTGAGACCTGGAGGG - Intronic
1070003643 10:72401082-72401104 GTGTGCCACTGAGCCCAGCTTGG + Intronic
1070305044 10:75234812-75234834 GGTTGTCACAGAGCCCGGGCCGG - Intronic
1070919467 10:80175124-80175146 GGGTGTCCCTGAGGCTGGGTGGG + Intronic
1070952749 10:80444151-80444173 GGGTGGGGCAGAGCCCTGGTGGG + Intergenic
1074361215 10:112825305-112825327 GGGTGTGCCTGTGCCCAGGTTGG - Intergenic
1075704058 10:124488378-124488400 GAGTGCCACGGAGCCCTGGGAGG - Intronic
1076267458 10:129119850-129119872 GGGTATCTCTGAACCTTGGTTGG - Intergenic
1076479980 10:130778502-130778524 GTGTGTCACTCAGACCTGGGAGG + Intergenic
1076782527 10:132732063-132732085 GCGTGTGAATGAGCCGTGGTGGG - Intronic
1077056289 11:595434-595456 GGGGCTCACTGAGGCCTGTTAGG + Intronic
1077073421 11:688509-688531 GCGTGTCACTGAGCCCAGCTGGG + Intronic
1077111416 11:863809-863831 GGGTGTCACTGACCCCCGCATGG + Intronic
1077115561 11:883095-883117 AGGTGTCACTGGGCGCGGGTGGG - Intronic
1077352545 11:2099585-2099607 GGATCCCAATGAGCCCTGGTGGG - Intergenic
1080655776 11:34256960-34256982 GTGTGTAGATGAGCCCTGGTTGG - Intronic
1083195083 11:61081322-61081344 GGGGCACACTGAGCCCTGGGTGG - Intergenic
1083276357 11:61599245-61599267 GGGTGGCACAGAGCCCTGGCTGG - Intergenic
1083947598 11:65933054-65933076 GTGTGCCACTGTGCCCAGGTTGG - Intergenic
1083962189 11:66020739-66020761 TGGGGTCACTGAGCCCTGGCCGG + Intronic
1088592320 11:111414422-111414444 GGGATTCCCTGAGCCCTGATAGG - Intronic
1089565113 11:119367067-119367089 GGGTCTCACAGAGACCTGGCTGG - Intronic
1090185683 11:124737940-124737962 GGGTGTCTCTGAACACTGGAGGG - Intergenic
1091217526 11:133912135-133912157 GGGTGTCATGGAGCCATCGTGGG - Intronic
1091818526 12:3457173-3457195 TGGTGTCCCTGAGCACTGCTGGG + Intronic
1091973344 12:4806597-4806619 GGGTTTCACTGTGCCCAGGGAGG - Intronic
1092336819 12:7640667-7640689 GGGTGTCTCTCTGCCTTGGTGGG + Intergenic
1093089063 12:14901391-14901413 GGCTGTCACTGAGCCTTTGGTGG + Intronic
1096527916 12:52223612-52223634 GGGTGTCACTAAAGGCTGGTCGG - Intergenic
1102000916 12:109557718-109557740 GGGTGCCACTGGCACCTGGTGGG - Intronic
1104449355 12:128856547-128856569 GGCTGTCACTGAGATCTGGAGGG + Intronic
1104746668 12:131215167-131215189 GGGGATCAGTGGGCCCTGGTGGG + Intergenic
1104785892 12:131447747-131447769 GGGGATCAGTGGGCCCTGGTGGG - Intergenic
1105211458 13:18259451-18259473 GGGTGGGACTGTGCCCTGGGAGG + Intergenic
1106285162 13:28312329-28312351 GGGTATCCATGAGCTCTGGTGGG - Intronic
1107490480 13:40876438-40876460 GGCTGTGACTGATGCCTGGTAGG + Intergenic
1108103450 13:46983064-46983086 TGTTGGCACTGGGCCCTGGTAGG + Intergenic
1109426180 13:62168255-62168277 GGGTGCCACTGAGCACAGGATGG + Intergenic
1113640949 13:111956368-111956390 GGGTGCCTCTGAGCCCCGTTCGG + Intergenic
1114182035 14:20375716-20375738 GGGTGGCACAGAGCCCAGCTGGG - Intronic
1119705663 14:76781246-76781268 TGGGGTCAATGAGCCCTGGGAGG + Exonic
1119947532 14:78710703-78710725 GGGAGTGACTGAGCTTTGGTGGG + Intronic
1121214147 14:92234232-92234254 GGGTGACAAAGAGCCCTGTTGGG - Intergenic
1122205802 14:100147391-100147413 GTGTGACACTGTGGCCTGGTAGG - Intronic
1124205433 15:27714813-27714835 GGTGGTCACTGTGCCCTGGCAGG + Intergenic
1124423272 15:29540471-29540493 GAGTTTCACTGAGCCCTGGTGGG - Intronic
1125431021 15:39593555-39593577 GAGTATCCCTGAGCCCTCGTGGG - Exonic
1126888344 15:53176342-53176364 GGATGTATCTGAGCACTGGTGGG - Intergenic
1127740285 15:61896979-61897001 AGGTGTCACTGTGCCCCTGTTGG - Intronic
1128180145 15:65595134-65595156 GGGTGGCACTGTGCTGTGGTGGG - Intronic
1128940596 15:71784843-71784865 TGGTCACACTGAGCCCGGGTAGG - Intergenic
1128997326 15:72306616-72306638 GGGTGTGTCAGAGCCCTGGGTGG - Intronic
1130919291 15:88330629-88330651 GGGTGTCGCTGAGACAGGGTGGG + Intergenic
1131440320 15:92454759-92454781 GGGTGGCACGGAGCCCTGGCTGG + Intronic
1132761002 16:1508686-1508708 GGCTGGCACTGCGCCCAGGTGGG - Intronic
1133141196 16:3746010-3746032 GGAGGTGACGGAGCCCTGGTGGG - Intronic
1137525935 16:49236402-49236424 ATCTGTCACTGGGCCCTGGTAGG - Intergenic
1137977429 16:53043357-53043379 GGGGGGCATGGAGCCCTGGTGGG - Intergenic
1140017850 16:71205625-71205647 AGCTGACACTGAGCCCTGGCTGG - Intronic
1140173153 16:72628014-72628036 AGGTGTCAGTGTGCCCTGCTGGG - Intergenic
1140273926 16:73491781-73491803 GGGTGTCACTGACATCTAGTAGG + Intergenic
1140971796 16:80020500-80020522 GGGTGTCTTTGTGCCCTGATTGG - Intergenic
1142811018 17:2395535-2395557 GGGTGTCACTGAGTACTGACTGG - Intronic
1146329596 17:31916915-31916937 AGGGGTCGCTGAGCCCGGGTCGG - Intergenic
1146627318 17:34444445-34444467 GATTGTCACTGAGCCGGGGTGGG - Intergenic
1146833707 17:36092397-36092419 GGGTATCACTGAGAGCTGGGAGG - Intergenic
1147261257 17:39210766-39210788 GGGTGTAACTGTGCCCAGGATGG + Exonic
1147336573 17:39730015-39730037 GGGTGTCACAGAGGCCTGTGGGG - Intronic
1147553575 17:41462311-41462333 TTGTGTAATTGAGCCCTGGTGGG - Intronic
1147729017 17:42585527-42585549 GGGTGTCACTGAGCCATAAATGG + Intronic
1148337123 17:46849450-46849472 GGGTGTGGCTGGGGCCTGGTGGG + Intronic
1151212223 17:72553108-72553130 TGGTGTAAGTGACCCCTGGTGGG + Intergenic
1151765923 17:76133024-76133046 GAGAGTCACTGGGCCCTGGGTGG + Intergenic
1151789306 17:76294007-76294029 AAGTGTTTCTGAGCCCTGGTTGG + Exonic
1152541640 17:80979694-80979716 GGGGGCCACTGAGGCCTGGAGGG - Intergenic
1152671763 17:81612216-81612238 GGGTCTGACTGAGCCCCGGAGGG - Intronic
1152912720 17:83014292-83014314 GCATGTCTCTGAGCCCTGGAGGG - Intronic
1152987143 18:331236-331258 GGGTGCCCCTGACCCCTAGTTGG - Intronic
1156484317 18:37455431-37455453 GGGTGTCACTGTACCCTTGTGGG + Intronic
1157106497 18:44778996-44779018 GGTGGTCACTGAGCAATGGTTGG + Intronic
1157429568 18:47613659-47613681 GGGTGTCTCTGAGCCTTTCTGGG + Intergenic
1162045156 19:7994307-7994329 GGGTGCTACTGACACCTGGTGGG + Intronic
1163725933 19:18923006-18923028 GGGTGTCACTGAGCTTTCCTGGG + Intronic
1164883713 19:31759549-31759571 GTGAGTCACTGAGCCCTACTGGG + Intergenic
1166336182 19:42109109-42109131 AGGTGGAACTGAGCCCTGGTAGG - Intronic
1166390875 19:42408136-42408158 GGGTGTCAGGGAGCCCCAGTGGG + Intronic
1167791807 19:51688090-51688112 GGGTGACAGGGAGCCCTGGAAGG - Intergenic
1168118590 19:54239878-54239900 GTGAGTCACTGAGGCCTCGTGGG - Intronic
1168128052 19:54298124-54298146 GGGGGTCACTGTGCCCTGACCGG + Intergenic
925498567 2:4479724-4479746 GGGTCCCTTTGAGCCCTGGTAGG + Intergenic
926275029 2:11397029-11397051 GTGTGTTATTGAGCCCTGATGGG - Intergenic
926310356 2:11670250-11670272 GGGTGTCCCTGAGCCAACGTGGG + Intergenic
926801482 2:16664538-16664560 GGCTTTCACTGATCTCTGGTTGG - Intronic
927511686 2:23647994-23648016 GGAAGTCACAGAACCCTGGTGGG - Intronic
928175810 2:29033668-29033690 GGGTATCGCTGAGACCTAGTTGG + Intronic
931939287 2:67234367-67234389 GGGTCTCACTGAGACCTTGAAGG - Intergenic
932713150 2:74082464-74082486 GGGTGTCACTGAGCCCTGGTGGG + Intronic
933051572 2:77609368-77609390 GAGTGTCACGGAGCCATGGCAGG + Intergenic
936109542 2:109653630-109653652 GGGTGTCTCTGAGTCCTTCTGGG + Intergenic
937226991 2:120375763-120375785 AGGGTTCACTAAGCCCTGGTGGG - Intergenic
937287113 2:120760645-120760667 TGGTGCCACTGAGCCTTGCTTGG + Intronic
939842313 2:147204372-147204394 ATGTGTCACTGAGCCCTGGTAGG + Intergenic
943475872 2:188354258-188354280 AGTTGTCTCTGAGCCCTGTTGGG + Intronic
943655281 2:190502365-190502387 GGGTGTCACAGAGCCCAGGCTGG + Intronic
947522031 2:230853726-230853748 GTGTGTCACTGGGCTCTAGTGGG - Intergenic
947893246 2:233644691-233644713 GAGAATCCCTGAGCCCTGGTGGG - Intronic
948154829 2:235772840-235772862 GGAGGTCACTGAGTCCTTGTGGG + Intronic
948753149 2:240144005-240144027 GGATGTCACTGAGCCTGGGGTGG + Intronic
948778828 2:240304639-240304661 TGGTGTCTCTGAGGGCTGGTCGG - Intergenic
948859837 2:240747460-240747482 GGTTGTCACTGAGCCACGGGTGG - Intronic
948962815 2:241354712-241354734 GGGTGGTACTGACCCCTGGTAGG - Intergenic
1170435254 20:16319949-16319971 GTGTTTCATTTAGCCCTGGTCGG - Intronic
1172174031 20:32961494-32961516 GGGGGTCACTGACCCCTGCAGGG - Intergenic
1172756277 20:37287104-37287126 GGGTGACACTGAGGCCTGCAGGG - Intergenic
1173928635 20:46799845-46799867 GGGTCTCACTGAGACCTAGGCGG + Intergenic
1175238107 20:57526669-57526691 AGGGGGCACTGAGACCTGGTGGG + Intergenic
1176382365 21:6119805-6119827 GGGTGCCACTGAGCCCCGCGGGG - Exonic
1178629517 21:34247210-34247232 GTGTGTTGTTGAGCCCTGGTAGG + Intergenic
1178847084 21:36182891-36182913 GGATGTCACTGAGCCCTTGCAGG + Intronic
1179741107 21:43418434-43418456 GGGTGCCACTGAGCCCCGCGGGG + Exonic
1180089274 21:45525490-45525512 TGGTGTCCTTGAGCCCTGGCTGG - Intronic
1180764770 22:18339987-18340009 GGGTGGGACTGTGCCCTGGGAGG - Intergenic
1180814259 22:18779697-18779719 GGGTGGGACTGTGCCCTGGGAGG + Intergenic
1180854907 22:19039526-19039548 GGGAGGCACTGGGCCCAGGTGGG + Intronic
1180960342 22:19759579-19759601 GGAGGACCCTGAGCCCTGGTGGG - Exonic
1181200445 22:21214032-21214054 GGGTGGGACTGTGCCCTGGGAGG + Intronic
1181701293 22:24622927-24622949 GGGTGGGACTGTGCCCTGGGAGG - Intronic
1182080493 22:27525352-27525374 GGGTGTCACAGAACCCAGGAAGG + Intergenic
1183075863 22:35426380-35426402 AGGTGTCACTGAGGCCTGACTGG - Intergenic
1183946019 22:41326203-41326225 GGGTGACCCTGGGCCTTGGTGGG + Intronic
1185142488 22:49110698-49110720 AGGTATCACAGAGCCCTGGTTGG - Intergenic
1203226393 22_KI270731v1_random:80892-80914 GGGTGGGACTGTGCCCTGGGAGG - Intergenic
1203264358 22_KI270734v1_random:5384-5406 GGGTGGGACTGTGCCCTGGGAGG + Intergenic
950967881 3:17158882-17158904 GTCTGTCCCAGAGCCCTGGTGGG + Intronic
952584990 3:34881254-34881276 GGGTGTCAGTGAGAACTTGTGGG - Intergenic
952916682 3:38251309-38251331 GGGTGTCAGTGTGCCATGCTAGG - Intronic
952964228 3:38611105-38611127 GAGTGCCTCTGAGCCCTGGGTGG - Intronic
954575294 3:51672368-51672390 GGGGGTCTCAGAGCCTTGGTCGG - Intronic
958075325 3:88668923-88668945 GTGTGACACTGAGACCTGGCTGG + Intergenic
961481580 3:127184056-127184078 CTGTGTCACTGATCACTGGTGGG + Intergenic
961618545 3:128204775-128204797 GGGTCTCACTGAGCTCGGGAGGG - Intronic
961667895 3:128504956-128504978 GGGTGTAACAAAGACCTGGTGGG - Intergenic
965812777 3:172609036-172609058 AGCTGTCACTGAGCCCATGTAGG + Intergenic
966919417 3:184602218-184602240 CGGTGTCGCTGACCCCTGGGCGG + Intronic
967946905 3:194811276-194811298 GTGTGTCACTGAGCCCAGGACGG + Intergenic
969832667 4:9810409-9810431 GGGTCTCCCTGAGGCCTGGCTGG - Intronic
970565026 4:17323594-17323616 GGGTGTAAGGGAGCCCTGCTTGG - Intergenic
972322678 4:37986865-37986887 GGGTGTCTCTGCAGCCTGGTAGG + Intronic
978613729 4:110572200-110572222 TGGTGTCAGTGGGCCCTGGCAGG - Intergenic
978957396 4:114631197-114631219 GTGAGCCACTGAGCCCTGCTGGG - Intronic
981529492 4:145738165-145738187 GTGAGCCACTGAGCCCTGCTGGG - Intronic
983446454 4:167858626-167858648 AGGTGTCAGTGTGCCCTGCTGGG - Intergenic
985017286 4:185649620-185649642 GGGTGTGACTGAGCACTGTAGGG + Exonic
985644876 5:1080164-1080186 GGGTGTCTCTGAGCCGCGGGTGG - Intronic
986134252 5:4959438-4959460 GGGCCTCTCTGAGCCCTGGAAGG - Intergenic
986729591 5:10625512-10625534 CGGTGTCCCTGAGCCCTGCCAGG + Intronic
989971384 5:50529050-50529072 GGGTCTTACAGAGCCCTGGGTGG + Intergenic
990024748 5:51172907-51172929 AGGTGCCACTGTGCCCTGCTGGG - Intergenic
991687605 5:69196130-69196152 GGGTCTCACTGTGCCCAGGCTGG + Intronic
992653756 5:78887737-78887759 GGGTGTCACACAGACCTTGTTGG - Intronic
995343870 5:111090149-111090171 AGGTGTCAGTGTGCCCTGCTGGG + Intergenic
995560006 5:113370349-113370371 TGGTGTCACTTTGCCCTGTTTGG - Intronic
995610983 5:113910046-113910068 CTGTGTCCCTGAGCCCTGGGAGG + Intergenic
997653673 5:135539830-135539852 GGATGGAACTGAGCCCTGGCAGG + Intergenic
998148212 5:139742452-139742474 GGCTGCCACTGAGGCCTGGAGGG - Intergenic
1000518255 5:162267430-162267452 GGGTGTGTCTGGGCCCTAGTAGG - Intergenic
1001550270 5:172597805-172597827 GGGTGTCACTGATGACTGGGCGG + Intergenic
1002066648 5:176655150-176655172 GGGTGGCACTGAGGCCTGTTGGG + Intronic
1005140833 6:22629713-22629735 GGTTGACACTGAGCCCAGCTGGG - Intergenic
1005258695 6:24033437-24033459 GGGTGTCACTGTGCTCTAGTGGG + Intergenic
1008497240 6:52145616-52145638 AGGTGTTACTGAGCCCAGTTAGG - Intergenic
1009628686 6:66166988-66167010 GGGCCTCACTGAGCTGTGGTGGG - Intergenic
1019391326 7:788186-788208 GGGTGTCTGTGAACCCTTGTAGG - Intergenic
1020864555 7:13541256-13541278 GGGTATGACTGAGCACTGGCAGG + Intergenic
1023033756 7:36112574-36112596 GGCTGTGTGTGAGCCCTGGTGGG - Intergenic
1023244735 7:38189421-38189443 TGGTGTGTCTGAGCCTTGGTAGG + Intronic
1024273402 7:47659132-47659154 TGGTTTCACTGACCCCTGGAAGG + Exonic
1027265700 7:76494163-76494185 GGGTGCCCCTGACCCCTCGTGGG + Intronic
1027317070 7:76992280-76992302 GGGTGCCCCTGACCCCTCGTGGG + Intergenic
1028452845 7:91005145-91005167 GGGTGCCAGTGGGCCCAGGTTGG + Intronic
1030905138 7:115173026-115173048 AGGTGTCAGTGTGCCCTGCTGGG + Intergenic
1031518560 7:122733710-122733732 GGATATCACTGGGCCCTGATTGG - Intronic
1034234658 7:149557260-149557282 GGGTGTGAGTGAGCCCTGCGTGG - Intergenic
1034239438 7:149598492-149598514 GGGTGTGAGTGAGCCCTGCGTGG - Intergenic
1035555741 8:565849-565871 GGGGGTCTCTGAGCCCTCCTTGG - Intergenic
1035564536 8:632697-632719 GTGTGTCTCTGAGCACTGGTGGG - Intronic
1036117511 8:5973925-5973947 CGGTGTCCCTGAGCCCTATTGGG - Intergenic
1039790068 8:40868551-40868573 GGCTGCCACTGAGCCCTCCTTGG - Intronic
1040090719 8:43396323-43396345 AGGTGTCAGTGTGCCCTGCTGGG + Intergenic
1040111311 8:43568283-43568305 GGAAGGCACTGACCCCTGGTGGG + Intergenic
1042462800 8:69090735-69090757 GGGTCTCAAGGAGCCCTGATAGG - Intergenic
1045063314 8:98426464-98426486 GGGAGTCGCTGAGTTCTGGTCGG - Intronic
1045092592 8:98761935-98761957 GGGTGTCACTGAGCACCCCTTGG - Intronic
1046110175 8:109713403-109713425 TGGTGTATCTGAGCCCTGTTGGG - Intergenic
1047177792 8:122557911-122557933 GGGTGTCTTTGGCCCCTGGTAGG - Intergenic
1049312883 8:141942788-141942810 GTGCGTCCCTGAGCCCTGCTTGG - Intergenic
1049357297 8:142195202-142195224 GGGGGTCAGGGAGCCCTGGAGGG - Intergenic
1049362918 8:142220768-142220790 TGGTGACCCTGAGACCTGGTGGG - Intronic
1052937647 9:34106323-34106345 GTGAGTCACTGAGCCCGGCTGGG + Intronic
1053016197 9:34663678-34663700 GGGTGTGACTGAACCCGGGTAGG - Intronic
1053254496 9:36604489-36604511 GGGTTTGACTCAACCCTGGTGGG + Intronic
1057467739 9:95331023-95331045 AGGTGTCACTCAGCCCTTTTGGG - Intergenic
1057474389 9:95386236-95386258 GGGTGTCCATGGGACCTGGTTGG - Intergenic
1057517578 9:95735105-95735127 GGGTGTCTCTGAACCTGGGTTGG + Intergenic
1057879709 9:98783940-98783962 GGCTGGCACTGACCCATGGTAGG + Exonic
1060762999 9:126271797-126271819 GAGTGCCAGTGAGCACTGGTGGG + Intergenic
1061943932 9:133897997-133898019 GAGTGTCCCTAAGCCCTGCTGGG - Intronic
1062358951 9:136178417-136178439 GTGTGTGACTGAGCCCCGGTGGG - Intergenic
1062394625 9:136347862-136347884 GGGTGTCGCTCAGCCCTGCGGGG - Intronic
1186633032 X:11371015-11371037 GGGTTGCACTGAGCACTGATAGG + Intronic
1190314744 X:49143302-49143324 GGCTGTGACTGATGCCTGGTAGG + Intergenic
1193022204 X:76802507-76802529 AGGTGGCACTGTGCCCTTGTAGG + Intergenic
1201124779 Y:10902838-10902860 ATGTGTCACAAAGCCCTGGTAGG - Intergenic