ID: 932713892

View in Genome Browser
Species Human (GRCh38)
Location 2:74087835-74087857
Sequence TCTCCTCCAGCGTGTGCCTG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 205}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932713892_932713893 -8 Left 932713892 2:74087835-74087857 CCGCAGGCACACGCTGGAGGAGA 0: 1
1: 0
2: 1
3: 19
4: 205
Right 932713893 2:74087850-74087872 GGAGGAGAAGCTACTCTGCCTGG 0: 1
1: 0
2: 1
3: 22
4: 217
932713892_932713897 8 Left 932713892 2:74087835-74087857 CCGCAGGCACACGCTGGAGGAGA 0: 1
1: 0
2: 1
3: 19
4: 205
Right 932713897 2:74087866-74087888 TGCCTGGTGCGGCACCGGGCAGG 0: 1
1: 0
2: 0
3: 8
4: 118
932713892_932713895 3 Left 932713892 2:74087835-74087857 CCGCAGGCACACGCTGGAGGAGA 0: 1
1: 0
2: 1
3: 19
4: 205
Right 932713895 2:74087861-74087883 TACTCTGCCTGGTGCGGCACCGG 0: 1
1: 0
2: 1
3: 7
4: 80
932713892_932713894 -3 Left 932713892 2:74087835-74087857 CCGCAGGCACACGCTGGAGGAGA 0: 1
1: 0
2: 1
3: 19
4: 205
Right 932713894 2:74087855-74087877 AGAAGCTACTCTGCCTGGTGCGG 0: 1
1: 0
2: 2
3: 27
4: 212
932713892_932713896 4 Left 932713892 2:74087835-74087857 CCGCAGGCACACGCTGGAGGAGA 0: 1
1: 0
2: 1
3: 19
4: 205
Right 932713896 2:74087862-74087884 ACTCTGCCTGGTGCGGCACCGGG 0: 1
1: 0
2: 0
3: 5
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932713892 Original CRISPR TCTCCTCCAGCGTGTGCCTG CGG (reversed) Exonic
900611350 1:3545835-3545857 TCCTCTCCAGCCTGTGCTTGTGG - Intronic
902053782 1:13583933-13583955 GCTCCTCCAGGCTGGGCCTGTGG + Exonic
904010144 1:27384700-27384722 TCTCCACCTGAGTGTCCCTGAGG + Intergenic
905173546 1:36123132-36123154 TCTCCTCTGGGGTGTGGCTGTGG - Intronic
906961588 1:50422492-50422514 CCTCCCCCAGCATTTGCCTGTGG - Intronic
906980114 1:50620966-50620988 CCTGCTCCAGCCTCTGCCTGAGG - Intronic
907243219 1:53092038-53092060 TCTCCCCCAGTCTGTGCATGAGG + Intronic
913396879 1:118381375-118381397 TATCCTCCAGGGAGTGCCTGTGG + Intergenic
914045093 1:144084651-144084673 TCCCCACCAGCCTGTTCCTGGGG - Intergenic
914133017 1:144876035-144876057 TCCCCACCAGCCTGTTCCTGGGG + Intergenic
914374064 1:147057039-147057061 TTTCCTCCACCGTGTGCCGTCGG - Intergenic
915459885 1:156063649-156063671 GCTCCTTCAGCGTCTGCCTCTGG - Intronic
916005744 1:160658524-160658546 ACTCCTCCAGCCTTGGCCTGGGG + Intergenic
916015147 1:160743005-160743027 CCTCCTCCAGCATGTGGCAGAGG - Intronic
917217183 1:172690609-172690631 TCTCCCCCAGCCTGTGCCAATGG - Intergenic
919985012 1:202667348-202667370 TCTCCACCAACGCCTGCCTGTGG + Intronic
920404216 1:205697074-205697096 CCTCCTCCAGAGTGGGCATGGGG - Intergenic
920682538 1:208083861-208083883 TCTTCTCCAGCTTTTGCCTGTGG + Intronic
922206849 1:223455553-223455575 TCTCCTCCAGCCTTTTCCTCTGG + Intergenic
924017151 1:239739649-239739671 AATCCTCCAGCATGTGACTGAGG - Intronic
1062805503 10:416773-416795 CGGCCTGCAGCGTGTGCCTGAGG - Intronic
1063667134 10:8069519-8069541 CCTCCTCCAGAGTGTGGTTGTGG - Exonic
1063918824 10:10911625-10911647 TCTCCGCAAGCCTGGGCCTGGGG + Intergenic
1064323595 10:14328807-14328829 TATCCTCCATCGTCTACCTGTGG - Intronic
1067036952 10:42927846-42927868 TCTCCACCAGCCTGTCCCAGAGG + Intergenic
1071437860 10:85663376-85663398 TCTCCCCCAGCGTTTGACAGTGG - Intronic
1075684385 10:124353593-124353615 GCTCCCCCAGCCTGTGCCTCAGG - Intergenic
1076731561 10:132441502-132441524 TCTGCTCCAACGTTTGCCTGGGG - Intergenic
1077029139 11:455886-455908 TCTTCTCCCGGGTGTGGCTGGGG + Intronic
1077141498 11:1026825-1026847 TGCCCTGCAGCGGGTGCCTGGGG - Intronic
1077318324 11:1928978-1929000 TCTTCTCCAGGGTGTGCCTGCGG - Intronic
1079061748 11:17254964-17254986 TCTCCTGAAGGGCGTGCCTGAGG + Intronic
1081564343 11:44248269-44248291 TCTCCTCCAGCCACTTCCTGAGG + Intergenic
1081864542 11:46352381-46352403 TAACTTCCAGCGAGTGCCTGTGG - Intronic
1084779049 11:71396816-71396838 TGTTCTTCAGCGTGTGTCTGTGG + Intergenic
1089261875 11:117229268-117229290 TCACCTCCATCCTTTGCCTGAGG - Intronic
1091686539 12:2566655-2566677 TCCCCTCCACCTTCTGCCTGTGG - Intronic
1091791660 12:3275385-3275407 TCCCCTGCAGCGAGTACCTGCGG + Intronic
1092069117 12:5618320-5618342 TCACCTCCAGCGTGGGCCAATGG + Intronic
1092162629 12:6324306-6324328 CCTCCTCCAGCCTCTTCCTGGGG + Intronic
1092574686 12:9767613-9767635 TCACATACAGCTTGTGCCTGTGG + Intergenic
1092817521 12:12324424-12324446 TCTGCTCCGGCGTGTCCCTGAGG + Intergenic
1096181859 12:49555652-49555674 TCTCCTCCAGCGTGGACATAAGG - Exonic
1101506497 12:105351742-105351764 TCCCCTGGAGCCTGTGCCTGTGG + Intronic
1101572367 12:105965625-105965647 TCTCTCCCAGCGTGTACCTATGG - Intergenic
1101830512 12:108253112-108253134 TCTCCTCCTGCTGCTGCCTGGGG + Intergenic
1102691225 12:114762648-114762670 TCTCCTCTAGCGTGTGTCTCTGG + Intergenic
1103361676 12:120358489-120358511 TCTCCTCCTGGGTGTGCCCCAGG + Intronic
1103848784 12:123917771-123917793 TCTCCTCCAGGGTGTGCACCAGG - Exonic
1104345497 12:127993086-127993108 TCTCCTCCACTGTGTCCATGTGG - Intergenic
1104638647 12:130453306-130453328 GCTCCTCCAGCCTGTGGCTGGGG - Intronic
1104710303 12:130980969-130980991 TCCCCCGCAGCGTGGGCCTGGGG + Intronic
1105298916 13:19116327-19116349 TCTCCTCCTGCTGGTGACTGTGG - Intergenic
1105893132 13:24696363-24696385 TCTCCTCCAACTTGTACATGAGG - Intronic
1106019690 13:25902811-25902833 ACTCAACCAGCGTGGGCCTGTGG - Intronic
1111994852 13:95155648-95155670 TTTTCTCCAGTGTGTGCGTGGGG - Intronic
1117341140 14:54792589-54792611 TCAGCTCCAGCTTGGGCCTGGGG + Exonic
1118905944 14:70023218-70023240 GCTCCTCCAGGGTGTGGCTGGGG - Exonic
1122841426 14:104465775-104465797 TCTCTCCCAGCCTGTGCCTGTGG - Intergenic
1125724756 15:41862582-41862604 CCTCCTGCTGCCTGTGCCTGAGG + Exonic
1126798863 15:52282371-52282393 TCTCTACCAGCGTATGCCTTGGG + Intronic
1127575406 15:60287035-60287057 TCTCCTCCAGCTTGGTTCTGTGG - Intergenic
1128616389 15:69113901-69113923 TCTCTTCCTGCTTGTGTCTGTGG + Intergenic
1134092973 16:11401377-11401399 TCTCCTCCTCCCTGTGGCTGGGG - Exonic
1136287470 16:29252943-29252965 TCTGCTGCAGCCTGTGTCTGTGG + Intergenic
1138555656 16:57769901-57769923 TCTCCTCCAGCATCTGCCCATGG + Exonic
1139845665 16:69919530-69919552 TCTCCTATACCGTGTCCCTGTGG + Intronic
1142201542 16:88763295-88763317 TCACCTCCAGCTTCTGCCTTGGG - Intronic
1143297762 17:5883890-5883912 TCTCCTCCTGCTTCTGCCTCTGG + Intronic
1143720273 17:8804270-8804292 TCTCCTCCTGCAAGTGACTGAGG + Intronic
1143878988 17:10015269-10015291 TCTTTTCCAGAGGGTGCCTGGGG - Intronic
1144780159 17:17804048-17804070 ACTCCTCAAGCAGGTGCCTGGGG - Intronic
1145016420 17:19401552-19401574 TCTCCTCCAGTCTGTCCCGGTGG + Intergenic
1147215855 17:38898636-38898658 TGCCCTCCAGGGTGGGCCTGGGG + Intronic
1148630330 17:49102523-49102545 TATCCTCCAGCCTGTGCTTCAGG - Intergenic
1148678151 17:49457016-49457038 TCTTCTCTGGGGTGTGCCTGGGG + Intronic
1148844265 17:50519579-50519601 TCTCCACCAGCATCTGGCTGAGG + Intronic
1148860569 17:50602335-50602357 CCTGCCCCAGCCTGTGCCTGGGG + Intronic
1149991329 17:61385140-61385162 TCTCTTCCAGAGCGTGGCTGAGG - Intronic
1150262601 17:63807714-63807736 TTTTCTCCAGGGTGTGCCTGTGG + Exonic
1150283202 17:63941172-63941194 TCTCCTCCATGGTCTGCTTGAGG + Exonic
1150485238 17:65538533-65538555 TCCCCACCAGCGTTTGCCTTGGG + Intronic
1151763532 17:76121014-76121036 TCTCCTGTAGTGAGTGCCTGGGG - Intronic
1156025276 18:32646260-32646282 GCACCTTCAGCTTGTGCCTGAGG - Intergenic
1158190995 18:54828528-54828550 TCTCCTCCAACCTGTGGCTCCGG - Exonic
1161864285 19:6822215-6822237 CCTCCTCCACCGTGTCGCTGTGG - Exonic
1162031069 19:7917463-7917485 TCTCCCCCAGTGTCTGCCTCAGG + Exonic
1163688404 19:18725270-18725292 TCTCCCCCAGCTCGGGCCTGAGG + Intronic
1163745248 19:19043006-19043028 TCCCCTCCAGCTTCTGCCCGAGG + Intronic
1165151495 19:33763337-33763359 TCTCCTCCAGCTTTGGCCTCTGG - Intronic
1168239275 19:55081225-55081247 ACTCCTCCTGCGTGGCCCTGCGG - Exonic
1202684651 1_KI270712v1_random:38055-38077 TCCCCACCAGCCTGTTCCTGGGG - Intergenic
924959990 2:26261-26283 TCTCCTTCTGCCTCTGCCTGGGG - Intergenic
925204902 2:1997287-1997309 TCCTCTCCAGCTTGTGACTGTGG + Exonic
925389479 2:3485644-3485666 TCTCCCCCAGCAGGTTCCTGTGG + Intergenic
925425053 2:3742505-3742527 TGGCCTCTAGCATGTGCCTGGGG + Intronic
925426282 2:3751332-3751354 TCTCCTCCCGCTGGGGCCTGGGG - Intronic
925626979 2:5851111-5851133 TCTCAGCCACCATGTGCCTGGGG + Intergenic
929135455 2:38619548-38619570 TCTTCTCCAACTTGTGGCTGGGG - Intergenic
930276915 2:49322383-49322405 TCTCCTACAGTGTCTGCCTGAGG - Intergenic
932713892 2:74087835-74087857 TCTCCTCCAGCGTGTGCCTGCGG - Exonic
934117636 2:88811863-88811885 TCTCCATCAGGGTGTCCCTGGGG + Intergenic
934247066 2:90316791-90316813 TCCCCACCAGCCTGTTCCTGGGG + Intergenic
934262260 2:91485812-91485834 TCCCCACCAGCCTGTTCCTGGGG - Intergenic
934305310 2:91816799-91816821 TCCCCACCAGCCTGTTCCTGGGG - Intergenic
934327947 2:92035949-92035971 TCCCCACCAGCCTGTTCCTGGGG + Intergenic
934466335 2:94266488-94266510 TCCCCACCAGCCTGTTCCTGGGG + Intergenic
936268560 2:111030461-111030483 TGTCCTCCAAACTGTGCCTGCGG + Intronic
937330039 2:121020986-121021008 TCTCCACCAGAGTGTCCCTAGGG - Intergenic
938058211 2:128232942-128232964 TCTCCTCCCGCGTGAGGCTGGGG + Intergenic
938312659 2:130302945-130302967 CCTCCTCCTGCTAGTGCCTGAGG + Intergenic
938490040 2:131756516-131756538 TCGAGTCCAGCGTGTGCCTGGGG + Intronic
945142887 2:206705839-206705861 TTTTCTCCAGCTTATGCCTGCGG - Exonic
945172170 2:207008254-207008276 TCCCCTCCTTCATGTGCCTGGGG + Intergenic
945723108 2:213443852-213443874 TCTCCTCCAGCTTGCTCCAGTGG - Intronic
946942317 2:224782501-224782523 TGTCCTCCAAAGTGTCCCTGAGG - Intronic
947969457 2:234310263-234310285 TGTCCTTTAGAGTGTGCCTGGGG - Intergenic
948206654 2:236166270-236166292 TCTCCTCCAGCGCGTGGCCCGGG + Exonic
948316893 2:237034765-237034787 TCTCCACCAGGGTGTGACAGTGG + Intergenic
948894446 2:240921762-240921784 TCTCTTCCAGCTTGTGGCTGAGG + Intronic
1168768819 20:400683-400705 TCTCCTCCAGCTTGTAGCTAAGG - Intergenic
1170272836 20:14547765-14547787 TCTCCTCGATTGTGTACCTGAGG + Intronic
1171471657 20:25377068-25377090 TCTCCTTCAGCTTTTTCCTGAGG + Intronic
1172771527 20:37384975-37384997 TGTGGCCCAGCGTGTGCCTGTGG - Intronic
1175012418 20:55752973-55752995 TCTCCTCCACCTTGTGCTTCTGG - Intergenic
1179948236 21:44695018-44695040 GCTCCTCCAGCCTGTGGCAGAGG - Intronic
1180587457 22:16905659-16905681 TCCCCACCAGCCTGTTCCTGGGG + Intergenic
1181058070 22:20269108-20269130 TCTCATGCAGGGTGGGCCTGGGG - Intronic
1181174745 22:21029117-21029139 TCTCCTCCAGGCTGCCCCTGGGG + Exonic
1181514615 22:23403557-23403579 TCTCATGCAGGGTGGGCCTGGGG - Intergenic
1181684707 22:24520377-24520399 TCTCTTACAGCGAGTCCCTGTGG + Exonic
1181975057 22:26723007-26723029 TCTCCTGCAGAGCCTGCCTGTGG + Intergenic
1182437471 22:30340000-30340022 TCTCCTTCAGTGTCTGCCTTTGG + Intronic
1184032545 22:41903442-41903464 TCCCACCCAGCATGTGCCTGGGG - Intronic
1185122492 22:48980615-48980637 TGTGCTCCAGCGTGAGCCTCAGG - Intergenic
950076901 3:10193777-10193799 CCACCTCCAGTGTGTGACTGAGG + Intronic
952287370 3:31981492-31981514 TCTCTTCCTTCGTGTCCCTGCGG + Intronic
954035544 3:47849136-47849158 TCACCTCCAGCCTGTGGCTAGGG + Intronic
954136035 3:48582641-48582663 TCTCCTCCAGGGGCTGCCAGGGG - Exonic
955341425 3:58128364-58128386 TCTCCTCAAACTTGTGCTTGCGG + Intronic
961329277 3:126129211-126129233 CCTCCTCCAGCCCGTGCTTGAGG + Intronic
961823049 3:129585052-129585074 TCTCCTCCCCCATGAGCCTGGGG + Intronic
962108385 3:132417177-132417199 GCCCCTCCGGCGTGTGCCTTAGG - Intergenic
965300491 3:167000433-167000455 TCTCCTGCTGGGTGTGCCTCTGG + Intergenic
966993532 3:185257817-185257839 TCTCCTCCAGGCTTTGCTTGTGG - Intronic
968829656 4:2926463-2926485 TCTCAGCCACCGTGTGTCTGTGG + Intronic
969210625 4:5684557-5684579 TCTCCTCCAGCCTGTACCCGGGG + Intronic
969603279 4:8189440-8189462 TCTCCTCCAGGCTGTGACGGCGG - Intronic
972279700 4:37590308-37590330 TCCCCTCCAGCGTCCCCCTGTGG - Exonic
973828181 4:54730709-54730731 TCTCCTTCAGAGTGTGCTGGTGG - Intronic
976102004 4:81574589-81574611 TTTCAACCAGCCTGTGCCTGGGG + Intronic
981731446 4:147903219-147903241 GCTCCTCCAGAGTGTGCTTTTGG + Intronic
982208893 4:153019254-153019276 TCTTCTCCTGCGTGTGGGTGGGG + Intergenic
984171859 4:176368817-176368839 TCTCCTCCATCGCAGGCCTGGGG - Intergenic
988235558 5:28539389-28539411 TCTCCTCTAGAGTGTGCTTTGGG + Intergenic
991488634 5:67163568-67163590 TCACCTCCAGGCTGTGCTTGCGG - Exonic
994790091 5:104213820-104213842 ACTCCTGCAGAATGTGCCTGAGG - Intergenic
997753201 5:136369916-136369938 TATCCTTCAGGGTGTGCCTCAGG + Intronic
997776534 5:136612876-136612898 TTTTCTCCAACGTGTGCTTGTGG - Intergenic
1001135308 5:169097832-169097854 GATCCTCCAACTTGTGCCTGGGG - Intronic
1002107554 5:176887595-176887617 TCTCCTCCAGCAGGCGCCGGTGG + Exonic
1004374476 6:15079698-15079720 TCGACTCCTGCGTGTGCCTGTGG + Intergenic
1007115659 6:39341343-39341365 GCTTCTCCAGCTTGTGCCTGAGG + Intronic
1008070749 6:47096677-47096699 AATCCACCAGGGTGTGCCTGGGG - Intergenic
1011209228 6:84936712-84936734 CCTCCTCAAGTGTGTCCCTGAGG + Intergenic
1013630294 6:111979943-111979965 TCTTCTCCATCCTGTCCCTGAGG + Intergenic
1014249459 6:119100524-119100546 TGACCTCCAGCGTGGGCCGGAGG + Intronic
1015099999 6:129466342-129466364 CCTCATCCAGCTTGTGCCTCAGG - Intronic
1018351031 6:162959392-162959414 TCTCCTCCACAGAGTGCGTGTGG - Intronic
1018753467 6:166828057-166828079 TTTCCTCCAGCATGTTTCTGTGG - Intronic
1019126833 6:169846269-169846291 TCTCCTGCTCCCTGTGCCTGGGG + Intergenic
1022311742 7:29202919-29202941 TCTCCTGCAGCATGTGTCAGAGG + Intronic
1022440247 7:30427179-30427201 TCTCCTCCAGACTGTGGCTCTGG - Intronic
1029453983 7:100658141-100658163 TCTCTTCCAGGGTGGGCATGTGG - Intergenic
1030616080 7:111739395-111739417 TCTGCTCCATCGAGTGCCAGAGG - Exonic
1032075209 7:128832790-128832812 TCCCCTCCAGCCTCAGCCTGGGG - Intronic
1034547104 7:151796324-151796346 TCTCGTCCAGCTGGGGCCTGTGG - Intronic
1035254992 7:157620683-157620705 TTTCCTCCAGCACGGGCCTGGGG - Intronic
1035355371 7:158273408-158273430 GCTCCTCCCGCGTCTGTCTGCGG - Intronic
1035355375 7:158273430-158273452 GCTCCTCCCGCGTCTGTCTGCGG - Intronic
1035355484 7:158273896-158273918 GCTCCTCCCGCGTCTGTCTGCGG - Intronic
1036038641 8:5048573-5048595 TCACTCCCAGCCTGTGCCTGTGG - Intergenic
1036138668 8:6185934-6185956 TCTCCTCCAGGCTGTGACTCGGG - Intergenic
1039854092 8:41397821-41397843 TCTGCTGCAGCCTGTTCCTGGGG - Intergenic
1040073263 8:43205179-43205201 TCTCCTCCAGCTGGTGGCTGGGG + Intergenic
1051145673 9:14024900-14024922 TCTGCTCCAGCGTCTGCCTCTGG + Intergenic
1053696383 9:40643259-40643281 TCCCCACCAGCCTGTTCCTGGGG + Intergenic
1054307634 9:63442487-63442509 TCCCCACCAGCCTGTTCCTGGGG + Intergenic
1054350353 9:64014141-64014163 TCGAGCCCAGCGTGTGCCTGGGG - Intergenic
1054406361 9:64766489-64766511 TCCCCACCAGCCTGTTCCTGGGG + Intergenic
1054439988 9:65251962-65251984 TCCCCACCAGCCTGTTCCTGGGG + Intergenic
1054490417 9:65769977-65769999 TCCCCACCAGCCTGTTCCTGGGG - Intergenic
1057843053 9:98501668-98501690 TCTCCATCAGCCCGTGCCTGTGG - Intronic
1057900722 9:98945879-98945901 TCTCCTCCTGTGTGTGTCTCTGG + Intronic
1059351688 9:113669950-113669972 TCTCCTCCAGGGGGTGACTCGGG - Intergenic
1060210662 9:121708264-121708286 TTTCCTCCAGTGTGTGACTTTGG - Intronic
1062710182 9:137971292-137971314 TGTCCTCCAGAGTGCGTCTGTGG + Intronic
1202778831 9_KI270717v1_random:16920-16942 TCCCCACCAGCCTGTTCCTGGGG + Intergenic
1203585906 Un_KI270747v1:3328-3350 TCCCCACCAGCCTGTTCCTGGGG + Intergenic
1186046862 X:5545862-5545884 TCTCATCCACCGAGAGCCTGAGG + Intergenic
1186405843 X:9301589-9301611 TCTCCTCGAACGTCTTCCTGAGG - Intergenic
1189659951 X:43286217-43286239 TCTCCTCCATACTGTGGCTGTGG + Intergenic
1191103747 X:56759696-56759718 TCTCCTCCTGCTTCAGCCTGTGG - Intergenic
1191110992 X:56803137-56803159 TCTCGTCCAGCTTCAGCCTGGGG - Intergenic
1195858305 X:109354452-109354474 TCTCTTCCAGTGTGTGTCTGTGG + Intergenic
1196442115 X:115727573-115727595 TCTCCTCCAGTGGGTCCCTCAGG - Intergenic
1196442775 X:115730527-115730549 TCTCCTCCAGTGGGTCCCTCAGG - Intergenic
1196443447 X:115733341-115733363 TCTCCTCCAGTGGGTCCCTCAGG + Intergenic
1196445771 X:115845261-115845283 TCTCCTCCAGTGGGTCCCTCAGG + Intergenic
1196446442 X:115848242-115848264 TCTCCTCCAGTGGGTCCCTCAGG + Intergenic
1196447782 X:115854206-115854228 TCTCCTCCAGTGGGTCCCTCAGG + Intergenic
1196449121 X:115860176-115860198 TCTCCTCCAGTGGGTCCCTCAGG + Intergenic
1196449792 X:115863167-115863189 TCTCCTCCAGTGGGTCCCTCAGG + Intergenic
1196450461 X:115866150-115866172 TCTCCTCCAGTGGGTCCCTCAGG + Intergenic
1196451131 X:115869135-115869157 TCTCCTCCAGTGGGTCCCTCAGG + Intergenic
1196451802 X:115872114-115872136 TCTCCTCCAGTGGGTCCCTCAGG + Intergenic
1196452473 X:115875101-115875123 TCTCCTCCAGTGGGTCCCTCAGG + Intergenic
1196453143 X:115878070-115878092 TCTCCTCCAGTGGGTCCCTCAGG + Intergenic
1196453813 X:115881063-115881085 TCTCCTCCAGTGGGTCCCTCAGG + Intergenic
1196454893 X:115886174-115886196 TCTCCTCCAGTGGGTCCCTCAGG + Intergenic
1196455557 X:115889134-115889156 TCTCCTCCAGTGGGTCCCTCAGG + Intergenic
1199536135 X:148905466-148905488 GCTCCTCCACTGTGAGCCTGTGG + Intronic
1200001934 X:153066606-153066628 TGTCCTCCAGGGAGAGCCTGGGG - Intergenic
1200005798 X:153083419-153083441 TGTCCTCCAGGGAGAGCCTGGGG + Intergenic
1201194129 Y:11475192-11475214 TCCCCACCAGCCTGTTCCTGGGG + Intergenic
1201398915 Y:13581544-13581566 TCTCTTTCAGCCTGTGCCTATGG + Intergenic