ID: 932718444

View in Genome Browser
Species Human (GRCh38)
Location 2:74120429-74120451
Sequence GCCGCTCCACACACCTACCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932718439_932718444 -7 Left 932718439 2:74120413-74120435 CCGTGGCTACGCCCCGGCCGCTC No data
Right 932718444 2:74120429-74120451 GCCGCTCCACACACCTACCCGGG No data
932718428_932718444 27 Left 932718428 2:74120379-74120401 CCGTACCTCTCCGTCTTTCCCTC No data
Right 932718444 2:74120429-74120451 GCCGCTCCACACACCTACCCGGG No data
932718435_932718444 9 Left 932718435 2:74120397-74120419 CCCTCCTGGGCTGGTGCCGTGGC No data
Right 932718444 2:74120429-74120451 GCCGCTCCACACACCTACCCGGG No data
932718437_932718444 5 Left 932718437 2:74120401-74120423 CCTGGGCTGGTGCCGTGGCTACG No data
Right 932718444 2:74120429-74120451 GCCGCTCCACACACCTACCCGGG No data
932718430_932718444 22 Left 932718430 2:74120384-74120406 CCTCTCCGTCTTTCCCTCCTGGG No data
Right 932718444 2:74120429-74120451 GCCGCTCCACACACCTACCCGGG No data
932718433_932718444 17 Left 932718433 2:74120389-74120411 CCGTCTTTCCCTCCTGGGCTGGT No data
Right 932718444 2:74120429-74120451 GCCGCTCCACACACCTACCCGGG No data
932718436_932718444 8 Left 932718436 2:74120398-74120420 CCTCCTGGGCTGGTGCCGTGGCT No data
Right 932718444 2:74120429-74120451 GCCGCTCCACACACCTACCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932718444 Original CRISPR GCCGCTCCACACACCTACCC GGG Intergenic
No off target data available for this crispr