ID: 932719647

View in Genome Browser
Species Human (GRCh38)
Location 2:74129744-74129766
Sequence AACAGACTCCTGCCTCTCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 4, 3: 16, 4: 209}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932719647_932719648 2 Left 932719647 2:74129744-74129766 CCAGAGAGAGGCAGGAGTCTGTT 0: 1
1: 0
2: 4
3: 16
4: 209
Right 932719648 2:74129769-74129791 TACACTCACACTGAATTCCCTGG 0: 1
1: 0
2: 0
3: 13
4: 121
932719647_932719653 24 Left 932719647 2:74129744-74129766 CCAGAGAGAGGCAGGAGTCTGTT 0: 1
1: 0
2: 4
3: 16
4: 209
Right 932719653 2:74129791-74129813 GTGGCTGCTTTATTGGCTTTAGG 0: 1
1: 1
2: 3
3: 19
4: 422
932719647_932719649 5 Left 932719647 2:74129744-74129766 CCAGAGAGAGGCAGGAGTCTGTT 0: 1
1: 0
2: 4
3: 16
4: 209
Right 932719649 2:74129772-74129794 ACTCACACTGAATTCCCTGGTGG 0: 1
1: 0
2: 1
3: 13
4: 135
932719647_932719650 17 Left 932719647 2:74129744-74129766 CCAGAGAGAGGCAGGAGTCTGTT 0: 1
1: 0
2: 4
3: 16
4: 209
Right 932719650 2:74129784-74129806 TTCCCTGGTGGCTGCTTTATTGG 0: 1
1: 1
2: 1
3: 21
4: 246
932719647_932719654 29 Left 932719647 2:74129744-74129766 CCAGAGAGAGGCAGGAGTCTGTT 0: 1
1: 0
2: 4
3: 16
4: 209
Right 932719654 2:74129796-74129818 TGCTTTATTGGCTTTAGGCCAGG 0: 2
1: 0
2: 0
3: 11
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932719647 Original CRISPR AACAGACTCCTGCCTCTCTC TGG (reversed) Intergenic
900502605 1:3013868-3013890 ACCAGGCTCCCGCCTCTCACTGG + Intergenic
901704808 1:11065373-11065395 AACAAACTCCAGCCTATCTTAGG + Intergenic
902140656 1:14350908-14350930 AACAGACGCCTGCCACTCAGGGG - Intergenic
902374533 1:16024079-16024101 GGCAGGCTCCTGCCCCTCTCTGG + Intronic
902379308 1:16045166-16045188 AGCAGACTCCTGCGTGTCCCAGG - Intronic
902379474 1:16045843-16045865 GGCAGGCTCCTGCCCCTCTCTGG + Intronic
902745323 1:18469969-18469991 ATCTGACTCTTGCCTCTCCCGGG - Intergenic
903466088 1:23553748-23553770 AGCAGGTTCCTGCCCCTCTCTGG + Intergenic
903691229 1:25175072-25175094 AACAGGCTGCTGCCTCTTTTGGG + Intergenic
904300421 1:29550205-29550227 AGCAGGCTCCTGCCTCTGCCTGG + Intergenic
905400007 1:37694214-37694236 TACAGCCTCCTGCATTTCTCCGG - Intronic
905809178 1:40899424-40899446 ACCAGCCTCCTCCCTGTCTCTGG - Intergenic
907233793 1:53025980-53026002 AACATACTCCTTTCTCCCTCAGG + Intronic
907562796 1:55406317-55406339 AATAGACTCCTTCCTCTTTGAGG + Intergenic
910698578 1:90048282-90048304 AAATGACTCCTGCCTGGCTCAGG - Intergenic
915108885 1:153550430-153550452 GACACACTTCTGCCTCGCTCAGG + Intergenic
916769143 1:167891279-167891301 CACACTCTCCTGCCTCTCTGGGG + Intronic
916878881 1:168999547-168999569 GACAGCTTCCTGCCTCTCTCTGG + Intergenic
920176861 1:204107547-204107569 CAGAGACACCTGCGTCTCTCTGG + Intronic
920576922 1:207068245-207068267 TACAGACTGCTGAATCTCTCGGG + Exonic
920674337 1:208028948-208028970 CACGGACGCCTGCCTCTCTGTGG - Exonic
923038285 1:230300885-230300907 CACAGACTCCCGTCTCTCCCAGG + Intergenic
924571390 1:245240800-245240822 CACAGCCTCCAGCCTCCCTCTGG - Intronic
1063462820 10:6225347-6225369 AAGGGACCCCAGCCTCTCTCAGG - Intronic
1064897267 10:20252012-20252034 AACTGACTCCTTTCTCTCTGAGG - Intronic
1067274034 10:44818887-44818909 AGCAGACTTCTGACTCTCTGAGG + Intergenic
1070393305 10:75989739-75989761 AACAGACCCCTGGCTATCTTTGG - Intronic
1070400860 10:76052485-76052507 AACATCCTCCTCTCTCTCTCAGG + Intronic
1070809060 10:79288453-79288475 AAGAGCCTCATGCCTCTGTCTGG - Intronic
1072605090 10:96974608-96974630 AACAGAAAATTGCCTCTCTCTGG + Intronic
1073418006 10:103400768-103400790 AACAGAGTCAGGCCTGTCTCTGG - Intronic
1075919896 10:126201901-126201923 ACTAGCCTGCTGCCTCTCTCTGG - Intronic
1076363015 10:129902928-129902950 AAGAGACGGCGGCCTCTCTCAGG + Intronic
1078107857 11:8369967-8369989 ATCAGACAACTGCCTCTCTCTGG - Intergenic
1079769996 11:24446576-24446598 ATCTGTCTCCTGCCTCTCCCTGG + Intergenic
1086070631 11:82795310-82795332 AACAGACATCTGACTCTCCCAGG + Intergenic
1089054940 11:115577880-115577902 AACAGACTGAGGCCTCGCTCGGG + Intergenic
1089295626 11:117465521-117465543 GACAGCTCCCTGCCTCTCTCTGG + Intronic
1089372238 11:117969587-117969609 AACAGACTTCTAGATCTCTCAGG - Intergenic
1089417377 11:118303431-118303453 AACATGCTGCTGCCTCTATCTGG + Intergenic
1090429504 11:126634379-126634401 CACAGGCTCCTGGCTCTCACTGG - Intronic
1091310534 11:134572420-134572442 AAGAGAATCGTGTCTCTCTCGGG + Intergenic
1093831195 12:23760643-23760665 AACAGCATCCTGCCTCTTTAGGG + Intronic
1094423535 12:30296574-30296596 GACAGCCTCCTTCCTCTCTTAGG - Intergenic
1095597345 12:43974136-43974158 AACAGTTTCCTGCCTTTGTCAGG + Intronic
1096548600 12:52357612-52357634 TTCACACTCCTGTCTCTCTCTGG - Intergenic
1097021050 12:56021040-56021062 CACACACTCTTGCCTCTCTCAGG + Intronic
1097901639 12:64879543-64879565 AAGAGACTGCTGCCTCTTCCAGG - Intronic
1098377872 12:69836740-69836762 CACAGAAACCTGCCTCTCTCAGG - Intronic
1100969899 12:100057242-100057264 CAGATACTCCTGCCTCTCTATGG - Intronic
1101421870 12:104557246-104557268 AACTCACTTCTGCCTCTTTCTGG + Intronic
1102892704 12:116572941-116572963 ACCAGACTCCAGACTGTCTCAGG - Intergenic
1105487598 13:20852021-20852043 AAGAGTCCCTTGCCTCTCTCAGG - Intronic
1105709249 13:22990302-22990324 ACAAAAGTCCTGCCTCTCTCTGG + Intergenic
1106032739 13:26017521-26017543 CCCAGCCTCCTGCCTCCCTCTGG - Intronic
1107918788 13:45182012-45182034 TTTAGACTCCTCCCTCTCTCTGG + Intronic
1108041104 13:46339991-46340013 ATCTGCCCCCTGCCTCTCTCCGG + Intergenic
1113867790 13:113539335-113539357 AGCTGCGTCCTGCCTCTCTCAGG + Exonic
1113911839 13:113845350-113845372 AAGAGACTCCTGCCTCTCCCAGG + Intronic
1118448253 14:65871302-65871324 TACAGATTCCTGCTCCTCTCTGG - Intergenic
1122080156 14:99261454-99261476 AACAGAGGCCTGGCTCTCTGAGG - Intronic
1125249378 15:37681975-37681997 AACAGACTCTTGCATCTCAGAGG + Intergenic
1126055946 15:44729506-44729528 CACAGACACCTGCTTCTCCCCGG - Exonic
1127920724 15:63492233-63492255 AGCAGTATCCTCCCTCTCTCTGG - Intergenic
1128387290 15:67158924-67158946 AATAGATTCCTGCCACTTTCTGG + Intronic
1129229504 15:74188991-74189013 GACACATTCCTTCCTCTCTCTGG - Intronic
1129319904 15:74768704-74768726 GACAGATTCCTGCCTCTCCGGGG - Intergenic
1129326392 15:74802302-74802324 GACTGACTCCTGCCTCCCCCTGG + Intronic
1129659065 15:77543057-77543079 AGCACAGCCCTGCCTCTCTCTGG + Intergenic
1130084260 15:80764108-80764130 GACAAACTCATGCCTCTCTCTGG - Intergenic
1133476850 16:6131830-6131852 CACATTCTCCTGCCACTCTCTGG + Intronic
1134182785 16:12061233-12061255 AACAGACTGCAGGCTCCCTCAGG + Intronic
1134266299 16:12695643-12695665 AACATACTCTTGCCAATCTCCGG + Intronic
1135521377 16:23181298-23181320 AACAGATCCTTTCCTCTCTCTGG + Intergenic
1135719608 16:24804155-24804177 AACAGTCTCCTGCCTTTATTAGG + Exonic
1138229892 16:55329126-55329148 GACAGCCTCCTGCCTCTGCCCGG + Exonic
1138862158 16:60771568-60771590 AACAGAGCCCTGCCTATCTCTGG + Intergenic
1139290794 16:65856095-65856117 AACAAGCCTCTGCCTCTCTCTGG + Intergenic
1141283120 16:82646808-82646830 AACATCATCCTTCCTCTCTCTGG - Intronic
1142158212 16:88542618-88542640 ACCAGGCTCCTCCCTGTCTCCGG - Intergenic
1142814547 17:2414988-2415010 AACTGACTCCTGCCTCCTGCGGG - Intronic
1143088262 17:4433226-4433248 GACACCCTCCTGCCTCTCACAGG + Intergenic
1144117863 17:12117678-12117700 AACAAACTGCTGTCTCTCTAGGG - Intronic
1144345691 17:14347003-14347025 GTCAGACTCCTTCCTCTGTCAGG - Exonic
1146011196 17:29196201-29196223 AACATACACCTGCCTCGCTGTGG - Intergenic
1146270219 17:31480218-31480240 GACAGATTACTGCCTCACTCAGG + Intronic
1146571133 17:33954242-33954264 AACACACTCCTCCCCATCTCAGG - Intronic
1147986243 17:44309090-44309112 ACCAGACTGCAGCCTCCCTCTGG - Intronic
1148751475 17:49947956-49947978 AACAGCCTCCTTTCTCTCTCAGG + Intergenic
1148751738 17:49949232-49949254 AACAGACTGCTGCTCCTCCCAGG + Intergenic
1149413247 17:56431031-56431053 GCCAGACTCCTTCCTGTCTCAGG - Intronic
1149777939 17:59372709-59372731 ACAAGGCTCCTGCCTCTCTTAGG - Intronic
1150598461 17:66628158-66628180 AACAGACCTCTGCCTCTCGGTGG + Intronic
1151716917 17:75835704-75835726 AACAGACTCTCGCCCATCTCTGG + Exonic
1151759669 17:76093433-76093455 AACAGACACCTCACTCTCTGAGG + Intronic
1155249389 18:23940521-23940543 AGCAGATTGCTACCTCTCTCTGG + Intronic
1156620743 18:38848491-38848513 GACAGACTCCTCCCTCCGTCAGG + Intergenic
1157933964 18:51853881-51853903 AAAAAACTCCTTCCCCTCTCAGG - Intergenic
1158536895 18:58316325-58316347 AACAGACACCTCCTTCACTCAGG + Intronic
1160594576 18:79964797-79964819 CCCCGACTCCTGCTTCTCTCTGG + Intronic
1161613989 19:5259930-5259952 AGCAGTCTCCTGACCCTCTCTGG - Intronic
1161648994 19:5472661-5472683 CACTGACTCCTTCCTCTCGCTGG - Intergenic
1161775966 19:6262338-6262360 ATCAGCCTCCTGCCTGTTTCAGG + Intronic
1162437541 19:10671275-10671297 AAGAAACTCCAGCCTCTCTGGGG + Intronic
1163014619 19:14446684-14446706 AACACATTCCTGACCCTCTCTGG + Intronic
1163245196 19:16089176-16089198 GACAGGCTCCTGCATCCCTCGGG - Intronic
1163270286 19:16248842-16248864 AACAGGCTCCTTGCCCTCTCTGG + Intergenic
1163875719 19:19866020-19866042 AACAGCCTCTCCCCTCTCTCGGG - Intronic
1164633820 19:29778524-29778546 GACACACTCCTGCCTCACCCGGG - Intergenic
1164861459 19:31565260-31565282 AATGGAACCCTGCCTCTCTCAGG + Intergenic
1165326622 19:35117853-35117875 CACAGACTCCTCCCTCTGCCTGG - Intronic
1165837644 19:38769655-38769677 AAAAGAATCCGGCCTCTCCCAGG + Intronic
1166519403 19:43470269-43470291 AACAGATACCTTCCTCTCTCTGG - Intergenic
1166740192 19:45109909-45109931 AACCGACTCTTCCCTCTGTCTGG + Intronic
1167169650 19:47822609-47822631 ATCACATTCCTGGCTCTCTCGGG - Intronic
1167237989 19:48326422-48326444 TGCAGACTCCTGGGTCTCTCAGG - Intronic
927300355 2:21505279-21505301 AGGAGACTCCTCCCTCTCTGTGG + Intergenic
928727418 2:34191262-34191284 GACAATCTCCTGCCTCTGTCTGG + Intergenic
931345180 2:61439741-61439763 CACAGCCTCCTGCCTCCCTGCGG - Intronic
931457864 2:62426270-62426292 AACAGACACCGGCCTCTGCCTGG + Intergenic
932025745 2:68130765-68130787 GCCAGCCTCCAGCCTCTCTCGGG - Exonic
932719647 2:74129744-74129766 AACAGACTCCTGCCTCTCTCTGG - Intergenic
933758105 2:85656400-85656422 AAGAGAAGCCTGCCTCTCACAGG - Intergenic
936536037 2:113312009-113312031 CACAGACTACTGATTCTCTCAGG - Intergenic
936654740 2:114472059-114472081 AACAGTCTCCTGCCTTTCGTTGG - Intronic
936770252 2:115903864-115903886 AACAGTCACCTGGCTCTCTAAGG + Intergenic
936918925 2:117668038-117668060 AACAGACAGCTCCATCTCTCAGG + Intergenic
937020952 2:118654533-118654555 AACAAAGTCCTGGCTGTCTCTGG - Intergenic
938776207 2:134543828-134543850 AAAGGACTTATGCCTCTCTCAGG + Intronic
939851473 2:147311227-147311249 AACAGACTCTGATCTCTCTCTGG - Intergenic
939982442 2:148797616-148797638 GACAAGCTCCTTCCTCTCTCTGG - Intergenic
941298308 2:163768812-163768834 ACGTGACTCCTGCTTCTCTCTGG - Intergenic
944153761 2:196590357-196590379 AACATAGTCCTCCCTCTTTCAGG + Intronic
945006433 2:205412225-205412247 CACAAACTCCTGCCTTTTTCTGG + Intronic
947581099 2:231319099-231319121 AACAGCTTCCCTCCTCTCTCAGG - Intronic
1169958129 20:11128905-11128927 AAGAGACTCTTGTCTGTCTCTGG + Intergenic
1172662329 20:36575688-36575710 AACAGACTCTGGCATCTCCCAGG - Intronic
1174182243 20:48682164-48682186 ACCAGACTCCTCCCTGCCTCGGG + Intronic
1174801865 20:53570846-53570868 ACCAGGCTCCTGCCTCTCACAGG + Intronic
1178413785 21:32387435-32387457 AAAAAAACCCTGCCTCTCTCTGG + Intronic
1179537694 21:42062990-42063012 AACCGTCCCCTGCCTCTCCCAGG + Intronic
1180163600 21:46009042-46009064 AGCAGGCTCCTGCCTCTTCCTGG + Intergenic
1182149227 22:28016957-28016979 ATCAGACTCCAGCCTTTCCCTGG - Intronic
1182896481 22:33863360-33863382 AACAGTCTCCTGCCTCACGATGG + Intronic
1183590914 22:38778886-38778908 AACAGACCACTGCATCTCACTGG - Exonic
1184244796 22:43230508-43230530 GACAGCCGCCTGCCTCTTTCAGG + Intronic
949836563 3:8276194-8276216 AACTGACTCCTGCCAATCACAGG - Intergenic
950319766 3:12040371-12040393 AATACCCTCCTGCCTCACTCTGG - Intronic
953990289 3:47478091-47478113 GACAGGCTCCTGACCCTCTCTGG - Intergenic
955406217 3:58627269-58627291 CCCAGAACCCTGCCTCTCTCAGG + Exonic
956304123 3:67805340-67805362 ACCAGACTGCTGCCTCTCTCAGG - Intergenic
957067566 3:75538236-75538258 CACTGTCTCCTGCCTGTCTCTGG + Intergenic
957564015 3:81862032-81862054 TACAGAATCCTGCCTCATTCTGG - Intergenic
957959461 3:87230623-87230645 AACCCACTCCTGACTCTCCCTGG + Intronic
960223988 3:115147997-115148019 TCCAGACACCTGCCTCTCACTGG - Intergenic
962429703 3:135307813-135307835 AAGAGAGCTCTGCCTCTCTCAGG + Intergenic
963082896 3:141410715-141410737 AACAGCCTTCTGTCTCTCCCAGG - Intronic
963839615 3:150092097-150092119 ACCAGACTCCTGTCTCTCCTGGG - Intergenic
967723452 3:192839312-192839334 AACAGCCTTCTGTTTCTCTCTGG + Intronic
969186588 4:5479029-5479051 AACTGTCTCCTGCCTCCCCCTGG - Intronic
971607253 4:28673663-28673685 TACAGACTCATACCTTTCTCAGG - Intergenic
975906947 4:79224657-79224679 AACATATTGCTCCCTCTCTCTGG - Intergenic
978203521 4:106051180-106051202 AACAGAATCATGTCTCTCACTGG + Intronic
978778302 4:112523922-112523944 TACAGCCTGCTGCCCCTCTCGGG + Intergenic
979549870 4:121978611-121978633 AACAGACTCCTTTCTCTCATGGG + Intergenic
985292535 4:188401263-188401285 AAGAGACTCCTTCCTCTCTCAGG + Intergenic
985571361 5:647310-647332 TACAAACTCCTGCCTGTTTCTGG - Intronic
986351527 5:6884791-6884813 AACAGAATCCTGACTGTCTTTGG - Intergenic
988687440 5:33538689-33538711 AACTGACTGCTGGCTCTCACAGG - Intronic
989133558 5:38130854-38130876 AACAAACTCCTGCTTCCATCAGG - Intergenic
992342475 5:75839582-75839604 ATCTGACTCCTGACTCTATCTGG - Intergenic
992670789 5:79058895-79058917 AACAAACCTCTCCCTCTCTCAGG + Intronic
999929602 5:156416673-156416695 GACAAACTCCTTCATCTCTCTGG + Intronic
1001866422 5:175109673-175109695 TACAGCCTTCTGCCTCTCCCTGG + Intergenic
1001873114 5:175175032-175175054 AAAAGCCTCTTGCCACTCTCAGG + Intergenic
1002082601 5:176746333-176746355 AACAGAGTCCACCCTCTCTCTGG - Intergenic
1002542559 5:179915713-179915735 ACCAGACTCCTGTCTCTGTTTGG - Intronic
1003066085 6:2904149-2904171 AACAGACAAATGGCTCTCTCTGG + Intergenic
1003086098 6:3063079-3063101 AACAGACAAATGGCTCTCTCTGG - Intergenic
1003418821 6:5937917-5937939 CACCGACTCCTGCCACTCTGAGG - Intergenic
1005898091 6:30195469-30195491 GACAAACTCCTCCCACTCTCTGG + Intronic
1006575134 6:35039673-35039695 AACACACACTTGCCTCTTTCAGG - Intronic
1006902490 6:37512145-37512167 GGCAGGCTCCTGCCTTTCTCGGG - Intergenic
1008589381 6:52977799-52977821 AACCGAATCCTGCTTCTCACAGG - Intergenic
1012152019 6:95765890-95765912 AACATGCTCCTACTTCTCTCAGG + Intergenic
1014159610 6:118152763-118152785 AAGAGACCCCTGCCTCCCTTTGG + Intronic
1014248595 6:119093718-119093740 ACCAGTCTCCTGCCTCTTGCTGG - Intronic
1014738739 6:125124242-125124264 AACAGACTCTTGGCTGTCTGCGG + Intronic
1017955214 6:159171441-159171463 GATAGACTGCTCCCTCTCTCTGG + Intronic
1019195249 6:170277620-170277642 AACAAACTGCTGTCTCTCTAGGG + Intergenic
1019286651 7:226580-226602 AAGAGACTCCACCCTCTCGCAGG + Intronic
1019709391 7:2511389-2511411 TCCAGCCTCCTGCCTCACTCTGG + Intergenic
1020056359 7:5120243-5120265 AACACACCCCTGCGTCCCTCTGG + Intergenic
1020171540 7:5848720-5848742 AACACACCCCTGCGTCCCTCTGG - Intergenic
1020708863 7:11580170-11580192 AACAGATTCCTGCCTCATTCAGG + Intronic
1024241297 7:47438587-47438609 CTCAGGCTCCTGCCTCTTTCTGG - Intronic
1024373940 7:48617462-48617484 ACCAGCCTCCTGCCTCTCCACGG - Intronic
1025578727 7:62682721-62682743 AACAGACTTAAGCCTCTCTTTGG + Intergenic
1029150437 7:98476632-98476654 GACAGCCTCTTGCCTCTCTGTGG + Intergenic
1030263804 7:107594909-107594931 ATTAGGCTCCTGCCTCTCTTTGG + Intronic
1032465312 7:132140717-132140739 CACAGACGCCTGCCTCTCTGTGG - Exonic
1035126888 7:156614866-156614888 AGCAGACCTCTGCCTTTCTCGGG - Intergenic
1036825279 8:11970992-11971014 AACAGAATCCTTCCTTTCTTAGG + Intergenic
1039893033 8:41697242-41697264 AACAGACTCCTGCCCTTGTGGGG + Intronic
1041858591 8:62485066-62485088 AACAGAGCCCTGCCCCTCTCAGG + Intronic
1046283932 8:112071395-112071417 AACAAACTCCCACCTCCCTCTGG + Intergenic
1046501473 8:115083415-115083437 GACAGAATCCTCCCTTTCTCAGG + Intergenic
1047957044 8:129984176-129984198 AACAGTCCCCTGCCTCTCTCTGG + Intronic
1049179550 8:141215141-141215163 GGCAGACTCTTGCCTCTTTCTGG - Intronic
1050362211 9:4840903-4840925 TAAAGACACCTGCCTCTCTGCGG - Intronic
1050965782 9:11800286-11800308 AACAGTCTCCTCCTTCTCTGAGG + Intergenic
1052458783 9:28736125-28736147 AACAGACTCTTGGTTCTGTCAGG + Intergenic
1052493667 9:29198697-29198719 TACAGAATCTTGCCTCTCCCAGG - Intergenic
1052713169 9:32082175-32082197 AACAGACTGCTGCCTCTCCAGGG - Intergenic
1053479942 9:38408769-38408791 AACAGATCCCTTCCCCTCTCTGG - Intergenic
1054731575 9:68706252-68706274 AACAGACTTCTGCGTTTCCCAGG + Intronic
1055508236 9:76969849-76969871 GACACACTCCTTCTTCTCTCAGG - Intergenic
1056132921 9:83603102-83603124 AACATGCTCCTCCCTCTCTCTGG + Intergenic
1056316884 9:85398715-85398737 CACAGACTCCTCCCTCTGGCTGG + Intergenic
1056816075 9:89802119-89802141 AGCAGCATTCTGCCTCTCTCTGG + Intergenic
1057553991 9:96073002-96073024 ATCAGATGTCTGCCTCTCTCAGG - Intergenic
1061355400 9:130100883-130100905 GGCATACTCCTGCCTCTCTGCGG + Intronic
1061589252 9:131588188-131588210 AATGGCCTCCTGCCTCTCTCCGG + Intronic
1062234665 9:135502117-135502139 AATAAACTCCTGCTTCTCTGTGG - Intronic
1186032649 X:5386747-5386769 TACAGATTACTGCCTCACTCAGG + Intergenic
1187339712 X:18410220-18410242 AACACACTGCTGCCTCCCACAGG - Intergenic
1196343781 X:114628193-114628215 AAAAGACTCCTGCCTTTGTTAGG - Intronic
1197183772 X:123563644-123563666 ACCTGACTCCAGCTTCTCTCTGG + Intergenic
1198150035 X:133899321-133899343 AACAGAGCCCTGCTTCTCTGAGG + Intronic
1199333065 X:146584569-146584591 AACTGACTCCTTCTGCTCTCAGG + Intergenic