ID: 932720469

View in Genome Browser
Species Human (GRCh38)
Location 2:74135078-74135100
Sequence CAGGAAAAGAACCCGGATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 175}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932720464_932720469 13 Left 932720464 2:74135042-74135064 CCTACCAAGAATCAAAGGGTGGA 0: 1
1: 0
2: 4
3: 18
4: 183
Right 932720469 2:74135078-74135100 CAGGAAAAGAACCCGGATCCTGG 0: 1
1: 0
2: 1
3: 10
4: 175
932720462_932720469 16 Left 932720462 2:74135039-74135061 CCTCCTACCAAGAATCAAAGGGT 0: 1
1: 0
2: 0
3: 10
4: 98
Right 932720469 2:74135078-74135100 CAGGAAAAGAACCCGGATCCTGG 0: 1
1: 0
2: 1
3: 10
4: 175
932720466_932720469 9 Left 932720466 2:74135046-74135068 CCAAGAATCAAAGGGTGGAGGAT 0: 1
1: 0
2: 2
3: 19
4: 252
Right 932720469 2:74135078-74135100 CAGGAAAAGAACCCGGATCCTGG 0: 1
1: 0
2: 1
3: 10
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932720469 Original CRISPR CAGGAAAAGAACCCGGATCC TGG Intronic
900622582 1:3594070-3594092 CAGGAACAGAACCCAGCTCTAGG - Intronic
901948846 1:12725410-12725432 CAGGATCTGAGCCCGGATCCGGG - Exonic
902797108 1:18807152-18807174 GAGGAAAAGAACCCAAGTCCGGG - Intergenic
903312438 1:22470122-22470144 CAGGGCCAGAACCAGGATCCAGG - Intronic
903401635 1:23056432-23056454 CAGGAAAAAAACCAGTATCTTGG - Intronic
904612124 1:31731519-31731541 CAGGAAAGGAAACTGGGTCCTGG + Intronic
904957250 1:34295297-34295319 CAGGAAAATAAACCCGAGCCAGG - Intergenic
906185451 1:43858936-43858958 CAGGCAAAGAGTCCAGATCCAGG + Intronic
910426640 1:87125560-87125582 AAGGAAAAGCACTCAGATCCTGG - Intronic
910558689 1:88566246-88566268 CCTGAAAAGAACCAGGATTCAGG - Intergenic
911839445 1:102661295-102661317 CAGGACAAGAACCTGGCACCTGG + Intergenic
915684389 1:157616928-157616950 CAGCAAAGGAGCCAGGATCCAGG + Intergenic
919161453 1:193835806-193835828 CAGGAGAAGCACTTGGATCCGGG + Intergenic
920004032 1:202819718-202819740 CTGGAAAAGAACACGAATTCAGG + Intergenic
920989333 1:210921784-210921806 CATGAAAAGAGCCTGGGTCCCGG + Intronic
922182240 1:223244394-223244416 CAGGAAAAGGGCCCGGGTCTAGG + Intronic
922274470 1:224064371-224064393 AAGGAAAAGAAAGCGGATCCAGG + Intergenic
922806194 1:228391318-228391340 CAGGGAAAGCACAGGGATCCGGG + Intergenic
1063910492 10:10824892-10824914 CAGGAAAAGAACATGGACCTGGG + Intergenic
1064129659 10:12697742-12697764 CAGGAAAAGTACCCGTGTCAAGG - Intronic
1065303815 10:24349969-24349991 CAGGAATAGAATCCTGGTCCTGG + Intronic
1067244408 10:44525278-44525300 CAGGAAAGGAAACTGGACCCAGG - Intergenic
1067823105 10:49548361-49548383 CAGGAATTGAACCCTGAACCCGG + Intergenic
1069143221 10:64854946-64854968 CAGGAAAAGAAACCGTTTTCGGG - Intergenic
1069561723 10:69435502-69435524 CAGGACAAGAACTCGGGACCTGG - Intergenic
1069912167 10:71766272-71766294 CAGGAAAATGACCCGGGGCCTGG + Intronic
1073037574 10:100574908-100574930 CAGGAAAAGAACCCTAGGCCAGG - Intergenic
1073583324 10:104686728-104686750 ATGGAAAAGATCCAGGATCCTGG + Intronic
1074352451 10:112751062-112751084 AAGGAAAACAACCCAAATCCAGG - Intronic
1074608705 10:115000351-115000373 CAGGAGAATAGCCTGGATCCGGG + Intergenic
1076561004 10:131363512-131363534 AAGGAAAAGTCCCAGGATCCTGG - Intergenic
1077350783 11:2092277-2092299 CAGGCACAGACCCCGGACCCTGG - Intergenic
1081424125 11:42906402-42906424 CAGGACAGGGACCCTGATCCAGG + Intergenic
1082655966 11:55857320-55857342 AAGGAAAAGGACCTGGAGCCTGG - Intergenic
1082760559 11:57123389-57123411 CAGGAGAACAACCCAGAACCTGG - Intergenic
1082847374 11:57737417-57737439 CAGGAGTAGAACCTGAATCCAGG + Intronic
1086089963 11:82995760-82995782 CAGGCTAAGAACCTGGAACCCGG + Intronic
1088704209 11:112447381-112447403 CAGGAAAAGAACTCGGACAAAGG - Intergenic
1089338027 11:117738873-117738895 CATGAAAAGTACCCAGATGCAGG - Intronic
1093999315 12:25677363-25677385 CAGGAAAAGTGCCTGGTTCCTGG - Intergenic
1098786054 12:74757003-74757025 CAGGAAAAGGACACGGATCCAGG + Intergenic
1099960359 12:89391299-89391321 TAGGAAAAGAACCCAAATACAGG - Intergenic
1101759917 12:107650022-107650044 CAGCAAAAGAGCCAGGATCTCGG + Intronic
1102434227 12:112908233-112908255 TGGGAAAAGAACACAGATCCTGG + Intronic
1102594467 12:113981934-113981956 CAGGAAAGGAACCCAGATGCAGG + Intergenic
1104062955 12:125283415-125283437 CAGGAACAGAAGACGGACCCTGG - Intronic
1104894477 12:132155062-132155084 CAGGAAATGAACGCGGCTGCCGG + Intergenic
1105766754 13:23567394-23567416 TATGAAAAGAACACGGATGCTGG - Intergenic
1106510638 13:30409480-30409502 CACAAAAAGAACCAGGATACAGG + Intergenic
1107329781 13:39286533-39286555 CAGGAAAACGGCACGGATCCGGG + Intergenic
1108508001 13:51129969-51129991 CAGGAATTGAACCCTGAACCCGG - Intergenic
1109869877 13:68320952-68320974 CAGGAAAAGAAGCCAGCTCCTGG - Intergenic
1113760329 13:112842020-112842042 GAGGAAAAGAACTTGGCTCCGGG - Intronic
1115646046 14:35369131-35369153 CAGGAAATAAACCCGGACCTCGG - Intergenic
1117369974 14:55068822-55068844 CTGGCAAAGAACCTGGATCAAGG - Exonic
1118115913 14:62776419-62776441 CAGGAAAAGAACCCTCACCAGGG + Intronic
1121302257 14:92881132-92881154 CAGAGAAAGAACTCGAATCCAGG - Intergenic
1122174906 14:99909670-99909692 CAGGGAAAGGACCTGGACCCAGG + Intronic
1122847548 14:104508303-104508325 CTGGAAAAGAAACATGATCCTGG + Intronic
1127827513 15:62718049-62718071 CAGGAAATGAACCCTGCTCCAGG - Intronic
1129780212 15:78264866-78264888 CCGGACAAGAACCCGGATGAGGG + Exonic
1130602996 15:85290376-85290398 CATGAAAAGAACCTGGATTTGGG - Intergenic
1132698810 16:1213570-1213592 CAGGAAAAGGACCCTGTTCTAGG - Intronic
1132894643 16:2223094-2223116 CGGGAAAAGAACACGGGTCGGGG - Intergenic
1135221600 16:20619506-20619528 CAGGAAAACAACCCCCATCTTGG + Intronic
1135676136 16:24416559-24416581 CAGGAGAAGAACCTGAATGCTGG + Intergenic
1137508809 16:49080236-49080258 CAGAGAAAGAACCCAGAGCCAGG - Intergenic
1137586762 16:49668470-49668492 CAGAAAAAGAACCTGGACACAGG + Intronic
1138178231 16:54923052-54923074 CAGGAAAAGAACCCCTGTGCAGG + Intergenic
1138560142 16:57796404-57796426 CAGGCAAAGAACCGGAAGCCTGG + Intronic
1140209229 16:72958053-72958075 AAGGAGAAGCACCCGGAGCCGGG - Exonic
1141473105 16:84252688-84252710 CAGGGAAGGAACCAGGATCTGGG + Intergenic
1142995218 17:3756010-3756032 CAGGAAGAGAACCCGGCTGAGGG + Intronic
1144599699 17:16600940-16600962 AATGAGAAGAACCCGGAACCCGG - Intergenic
1145901576 17:28493727-28493749 CAAGAAAAAAGCCCGGCTCCCGG - Exonic
1148575048 17:48704575-48704597 CAGGAAATGAGGCAGGATCCAGG - Intergenic
1149499535 17:57141457-57141479 CAGGGCAAGAACCCAGGTCCTGG - Intergenic
1151961412 17:77407854-77407876 CAGGAAAAGAGCAGGGATCCAGG - Intronic
1155317431 18:24586480-24586502 CAGCAACAGAACAAGGATCCTGG - Intergenic
1157713634 18:49867067-49867089 CAGGGAAGGAAGCTGGATCCAGG + Intronic
1158220879 18:55149588-55149610 CAGAGAAAGAAACCGGATCCTGG - Intergenic
1159353112 18:67300172-67300194 CAGAAAAAGAACCCTCTTCCAGG + Intergenic
1162606277 19:11710538-11710560 CAGGAAAAACACGAGGATCCTGG + Intergenic
1162939065 19:13997219-13997241 CAAGAGCAGAACCTGGATCCCGG - Intronic
1164974340 19:32560637-32560659 GAGGAAAGGGACCTGGATCCTGG - Intergenic
1167508254 19:49882377-49882399 CAGGAAATGACCTCGAATCCAGG - Exonic
1168696663 19:58407794-58407816 CAGGAGAATAACCGGGCTCCTGG - Intronic
927646276 2:24878956-24878978 CAGGGAAACAACCCGTGTCCCGG - Intronic
929712054 2:44275626-44275648 CTGGAGCAGACCCCGGATCCAGG + Exonic
930873949 2:56193074-56193096 CAGCAAAGGCACCCGCATCCAGG + Exonic
931090586 2:58881970-58881992 CAGCAATAGAACCAGGACCCTGG + Intergenic
932128166 2:69163671-69163693 GAGGAAAAGAACACGCATTCAGG + Intronic
932720469 2:74135078-74135100 CAGGAAAAGAACCCGGATCCTGG + Intronic
932974489 2:76581742-76581764 CAGAAATAGAAACCAGATCCAGG - Intergenic
934925646 2:98380235-98380257 CAGGAAAAGAGTCCGGTCCCTGG - Exonic
935972100 2:108539795-108539817 GAGGAAAAGAACCAGGATGATGG - Intronic
937615541 2:123917747-123917769 CAGGAAAAGAACCAGGTTTAGGG - Intergenic
941639559 2:167972499-167972521 CAGGAATTGAACCCTGAACCCGG - Intronic
942124372 2:172809069-172809091 AAGGAAAAGAACCTGGAATCTGG + Intronic
945992601 2:216408647-216408669 CAGGAAAGGAGCCTGGCTCCAGG - Intergenic
946163556 2:217850108-217850130 CAGGAAAGGGACGCGGGTCCTGG + Intronic
946948513 2:224847365-224847387 CAGGACAAGAACCCACATCTTGG + Intronic
947834602 2:233166394-233166416 GAGGAAAAGAAGCCAGTTCCTGG + Intronic
1169009412 20:2237836-2237858 CATGGAAAGAACCTGGTTCCTGG - Intergenic
1169084057 20:2816129-2816151 CAGGAAAGGGACAGGGATCCAGG + Intergenic
1175479923 20:59303460-59303482 CAAGACAAGAACTCGGTTCCTGG - Intronic
1178435843 21:32557830-32557852 CAGGAATTGAACCCTGAACCTGG + Intergenic
1181363040 22:22353476-22353498 CAGAACAAGAACCCAGATCAGGG - Intergenic
1181406058 22:22685860-22685882 CAGGACAATAACCAGGAACCTGG + Intergenic
1182710706 22:32321357-32321379 CAGGAAAATCACTCGAATCCAGG + Intergenic
1184457568 22:44620420-44620442 CAGGCCAAGGACCCGGAGCCCGG - Intergenic
1185004020 22:48264804-48264826 CAGGAAAGGAGGCCGGTTCCAGG + Intergenic
950400205 3:12763880-12763902 CATGTAAAGAACCAGGCTCCTGG - Intronic
951643705 3:24864303-24864325 AAGGAAAAGAACAAGGAACCAGG - Intergenic
952878580 3:37968874-37968896 CAGGAAAAGAGCCCTGGGCCAGG - Intronic
954937346 3:54338685-54338707 CAGGACTTGAACCTGGATCCAGG - Intronic
956133606 3:66077308-66077330 AAGGCAGAGAAACCGGATCCAGG - Intergenic
956767946 3:72500213-72500235 CAGGACAAGAATTCAGATCCTGG - Intergenic
956837481 3:73107317-73107339 CAGGATATGAACCCAGATGCTGG + Intergenic
957463507 3:80555101-80555123 CAGGAAAGTTACCAGGATCCTGG + Intergenic
961470447 3:127107941-127107963 CAGGAAAAGGCCCAGGAGCCAGG - Intergenic
964133202 3:153314226-153314248 CAGACAAAGACCTCGGATCCTGG - Intergenic
966192342 3:177282962-177282984 CAGGGAAGGAACCTGGCTCCTGG - Intergenic
966902672 3:184498325-184498347 CAGGAAAAGAACACGGAGGAGGG - Intronic
967100535 3:186211745-186211767 CAGGAGCAGAACCAAGATCCAGG + Intronic
969634665 4:8360152-8360174 CAGGAATTGAACCCTGAACCTGG - Intergenic
971555691 4:28011593-28011615 CAGGGAAAGAACCCTCCTCCGGG - Intergenic
975582149 4:75916870-75916892 CAGGAAAATCACTCGAATCCGGG - Intronic
975706491 4:77117246-77117268 AAGAAAAAGAATCAGGATCCTGG + Intergenic
978261005 4:106759221-106759243 CAGGAGAGGAACCCTGATCTTGG - Intergenic
980548468 4:134301912-134301934 CAGGAAAAGCACTCTGTTCCAGG - Intergenic
980778520 4:137466178-137466200 CAGGAATTGAACCCTGACCCCGG - Intergenic
981403122 4:144337642-144337664 CAGGAAGAGTTCCTGGATCCAGG - Intergenic
982233298 4:153228986-153229008 CAGGAAAAGATCTGGGAGCCTGG + Intronic
986438130 5:7755306-7755328 CAAGAAGTGAACCCGGAACCTGG + Intronic
993745552 5:91592780-91592802 CAGGAATTGAACCCTGAACCAGG + Intergenic
995014548 5:107295125-107295147 CAGGCAAAGAACCCTGGACCAGG + Intergenic
996702695 5:126465911-126465933 GAGGAAAAGAATCCCCATCCCGG + Intronic
998108388 5:139482699-139482721 CAGAAAAAGAATCTGCATCCTGG - Exonic
1000793312 5:165633396-165633418 CAGGAAATGAACCTGTAACCAGG + Intergenic
1001402560 5:171454342-171454364 CAGGCAAAGAACCTGGATTCAGG + Intronic
1001758897 5:174191503-174191525 CAGGACAAGAAGCCAGACCCAGG - Intronic
1002462099 5:179379071-179379093 CAGAACAAGAACCAGGATGCAGG - Intergenic
1002465566 5:179406536-179406558 CATGGGAAGAACCCGGAGCCAGG + Intergenic
1006033965 6:31197702-31197724 CAGGAAGAGTTTCCGGATCCTGG + Intergenic
1006177054 6:32128765-32128787 CAGGGGAAGAACCAGGATGCAGG - Exonic
1006321060 6:33319788-33319810 AATGAAAAGAACCTGGAACCTGG - Exonic
1007744687 6:44036321-44036343 CAGGAACTGAACCAGGAGCCTGG - Intergenic
1008043650 6:46829614-46829636 GAGGAGAAGAAGCAGGATCCCGG - Intronic
1013637673 6:112044596-112044618 CTGGAATAGAACCCAGCTCCTGG - Intergenic
1013877453 6:114850305-114850327 CTGGAAAACAATCAGGATCCTGG + Intergenic
1015343637 6:132130696-132130718 CAGGAAAAGAAGGCAGATGCTGG - Intergenic
1015772592 6:136784202-136784224 AAGGAAAGAAACCAGGATCCTGG + Intronic
1016938658 6:149467056-149467078 CAGGAAGGGAACCTGGACCCTGG + Intronic
1017348623 6:153414344-153414366 CAGGAATTGAACCCTGATCCTGG + Intergenic
1017764218 6:157593557-157593579 CAGGAAAAGAGGCAGGATCCGGG + Intronic
1017941589 6:159057977-159057999 CAGGAAAAGACCCCGAATGATGG + Intergenic
1018138057 6:160797236-160797258 CAGGAATTGAACCCTGAACCTGG - Intergenic
1019021655 6:168923599-168923621 CAGGAAAAGAGCACGGGGCCCGG - Intergenic
1020341952 7:7121352-7121374 CAGGAAAAGCACTTGAATCCGGG - Intergenic
1024973722 7:55094232-55094254 CAGGATAAGAAGCTGGATGCTGG - Intronic
1027053246 7:75032637-75032659 CAGGAAGAGAACCTGGAGACCGG + Intronic
1029111910 7:98217063-98217085 CAGGACTAGAACCGGGAACCTGG - Exonic
1030156115 7:106457334-106457356 CAGGAAAATAACTTGAATCCAGG + Intergenic
1031178249 7:118379752-118379774 CAGGAAAAAAACCAGGATTTTGG + Intergenic
1032580588 7:133099751-133099773 CAGGAAAAGAACATGGGACCAGG - Intergenic
1033093356 7:138407127-138407149 CAGGAAAAGCACCCTGAGCTTGG + Intergenic
1034702864 7:153111418-153111440 CAGGTAAGCAGCCCGGATCCAGG + Intergenic
1035531614 8:356677-356699 CAGTGAAAGAAGCCGGACCCGGG + Intergenic
1037689558 8:21170715-21170737 AAGGACAAGAACCCGGAACAGGG + Intergenic
1037855913 8:22370526-22370548 CAGTGAAAGAAACTGGATCCAGG + Intronic
1038413416 8:27375676-27375698 CAGGGAAAGAACACGGCCCCCGG - Intronic
1042772984 8:72399073-72399095 CAGCAAAGGGACCCTGATCCTGG + Intergenic
1043648925 8:82562132-82562154 CAGGGAAAGAACACTGATCTTGG + Intergenic
1048318390 8:133378769-133378791 GAGGAAAAGTACCTGGCTCCAGG - Intergenic
1049390785 8:142369289-142369311 CAGCAACAAAACCCGAATCCAGG + Intronic
1050018537 9:1260617-1260639 CATGAACAGAGCCCAGATCCTGG + Intergenic
1050090995 9:2016420-2016442 AAGCAAAAGAACACGGACCCGGG - Intronic
1051389151 9:16544715-16544737 CAGGAGAATCACCCGAATCCAGG + Intronic
1053314407 9:37039263-37039285 CAGGGAAAGCACCCCAATCCTGG - Intergenic
1057371739 9:94480003-94480025 CAGGAACAGAAACCGGCACCTGG + Intergenic
1058116248 9:101087083-101087105 CAGGAGAATCACCTGGATCCAGG + Intronic
1062044282 9:134417931-134417953 CAGGAGAAGAGCCCGGGACCAGG - Intronic
1062635321 9:137487500-137487522 CAGGAAAAGAACCGGGGCACTGG + Intronic
1192730784 X:73800834-73800856 TAGGAAAAGGATCCTGATCCAGG + Intergenic
1197171944 X:123444367-123444389 AAGGAAAAGAACCAGGAGCCAGG + Intronic
1197366097 X:125566596-125566618 CAGAAAAAAAACCCAGTTCCTGG + Intergenic