ID: 932729519

View in Genome Browser
Species Human (GRCh38)
Location 2:74208673-74208695
Sequence ATGTTACCGGCTACTCCATG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 41
Summary {0: 1, 1: 2, 2: 0, 3: 2, 4: 36}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932729519 Original CRISPR ATGTTACCGGCTACTCCATG GGG Exonic
909588829 1:77322383-77322405 ATTTTACCGGCTACTTTATCTGG + Intronic
921049771 1:211502717-211502739 AGGTTTCCAGCGACTCCATGTGG - Intergenic
923884084 1:238135949-238135971 ATGTTACCTTCTACTCTTTGAGG + Intergenic
1073191879 10:101657153-101657175 ATGTTACCCATTACTCCCTGTGG + Intronic
1094354804 12:29566132-29566154 GTGTCATCGGCTTCTCCATGAGG - Intronic
1097380468 12:58889653-58889675 ATAATACCGGCAACTCCAGGAGG - Intronic
1101074834 12:101117989-101118011 ATCTTACTTGTTACTCCATGTGG - Intronic
1112729813 13:102348328-102348350 ATGTTACGGGATACAGCATGAGG + Intronic
1119748602 14:77061972-77061994 AGGTGACCTGCTACTCCTTGAGG - Intergenic
1120264930 14:82236723-82236745 ATATTACAGGCTACCACATGTGG - Intergenic
1134861670 16:17565692-17565714 AGGTTACCGGCCATGCCATGGGG - Intergenic
1144459803 17:15449186-15449208 ATGTTAGCTGTTACTCCACGTGG - Intronic
1146624442 17:34424834-34424856 ATGTTCCCAGCTGCTCCCTGGGG - Intergenic
1148959506 17:51381486-51381508 ATGTCACAGTCTACTCCAGGAGG - Intergenic
1155670288 18:28362624-28362646 ATTTTACTGGCAACTCCATGAGG - Intergenic
932729519 2:74208673-74208695 ATGTTACCGGCTACTCCATGGGG + Exonic
935383016 2:102472514-102472536 ATGTTCCTAGCTACTCAATGAGG + Intergenic
935937822 2:108205708-108205730 ATGGTACCAGCTCCTCCTTGTGG + Intergenic
943578640 2:189659042-189659064 GTGTTTCCGGCTACTCGATGTGG + Intergenic
1175440623 20:58988519-58988541 GTTTTTCTGGCTACTCCATGTGG + Intronic
1181960125 22:26616775-26616797 ATGATAGCAGCTACTCCATCGGG - Intronic
950726541 3:14920841-14920863 CTGTTACAGTCTACTGCATGAGG + Intronic
955318261 3:57956728-57956750 CTGTTCCTGGCTGCTCCATGTGG - Intergenic
958554371 3:95655481-95655503 ATGTTACCGGCTACCCCATGGGG - Intergenic
963503709 3:146160420-146160442 GTGTTACCGGCTGCTTCCTGGGG + Intronic
966392230 3:179464858-179464880 ATGTTACCGGCTACCCCATGCGG + Intergenic
985378567 4:189368283-189368305 ATGTTACAGGCTAACCCAAGTGG - Intergenic
993175568 5:84481014-84481036 ATCTTCACAGCTACTCCATGAGG - Intergenic
1011934193 6:92754390-92754412 CTGTTACAGCCTTCTCCATGGGG - Intergenic
1014257578 6:119178341-119178363 ATGTTTCAGCCTAATCCATGGGG + Exonic
1015128060 6:129776494-129776516 GTGGTACCGGCTACTCGAGGGGG - Intergenic
1027786794 7:82590299-82590321 ACGTTACCAGCTGCCCCATGGGG - Intergenic
1030848348 7:114451422-114451444 ATCATACTGTCTACTCCATGTGG + Intronic
1046369023 8:113276084-113276106 ATGCTACCAGCTACTCCCTCTGG + Intronic
1046391956 8:113586122-113586144 TAGTTTCCGGCTACTCAATGTGG + Intergenic
1056112379 9:83408559-83408581 ATGTTTCCAGCTACCCCAGGGGG + Intronic
1061924026 9:133797255-133797277 ATGTTACCCGGGACTCCCTGGGG + Intronic
1188722747 X:33543529-33543551 CTGTTACTGGCTGCTCCATCTGG + Intergenic
1192864615 X:75117621-75117643 ATGTTAACTGCTACTCTATTTGG + Intronic
1197525124 X:127552016-127552038 ATGTTGCCTCCTGCTCCATGAGG + Intergenic
1201432515 Y:13919027-13919049 ATATTGCCAGCTACTCCTTGAGG + Intergenic