ID: 932730527

View in Genome Browser
Species Human (GRCh38)
Location 2:74218490-74218512
Sequence ATAGATCTCCAGTTTTCTAT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 184}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932730527 Original CRISPR ATAGATCTCCAGTTTTCTAT AGG Exonic
904059512 1:27697063-27697085 ATACTTCTCCAGCTCTCTATTGG - Intergenic
904589975 1:31607763-31607785 ATGGATATCCAGTTTTCAAGGGG - Intergenic
908559199 1:65288079-65288101 ATAAATCTCTAGTCTTCTGTTGG + Intronic
910748854 1:90605528-90605550 TTAAATCTCCAGTTTTCTCCTGG + Intergenic
914376137 1:147075608-147075630 ATAAATCTCCAGTTGTCTGCAGG + Intergenic
914505592 1:148286495-148286517 ATAAATCTCCAGTTGTCTGCAGG + Intergenic
915702974 1:157813248-157813270 ATAAATCTCCAGTTAGTTATTGG - Intronic
920902934 1:210129711-210129733 ATAGACCTCAAGTTTCCTAAAGG - Intronic
1063291393 10:4753652-4753674 ATAGATCTCCAGATCTATTTTGG + Intergenic
1067307161 10:45074793-45074815 TTAAATCTACAGTTTTCTAAAGG + Intergenic
1067366828 10:45639214-45639236 ATATTTTTCCATTTTTCTATTGG - Intronic
1073647047 10:105315943-105315965 ACAGCTCTCCATCTTTCTATGGG - Intergenic
1078967795 11:16367271-16367293 ATATATCTTCAGTTTTCAACTGG + Intronic
1085157495 11:74309669-74309691 ATAGTTGTCTAGTATTCTATGGG - Intronic
1085558369 11:77446662-77446684 ATGCAACTTCAGTTTTCTATTGG + Intronic
1086887391 11:92221951-92221973 ATAGATCTGCAATTTTTTATAGG + Intergenic
1087786465 11:102360619-102360641 ATAGATCTCCATTTCTTTGTGGG + Intronic
1090543226 11:127731990-127732012 ATATGTCTACATTTTTCTATGGG + Intergenic
1091424730 12:377166-377188 GTAAATCTCCAGTTTTCTGCTGG - Intronic
1092003964 12:5053377-5053399 ATAAATCTTCAGTTTTATAACGG - Intergenic
1093797634 12:23332102-23332124 ATAAATCTCCATTTTTCTGTAGG - Intergenic
1093833819 12:23801203-23801225 ACAGGTCTCCAGTTTTATCTTGG - Intronic
1093954274 12:25198141-25198163 ATAAACCTCTAGTCTTCTATGGG - Intronic
1095289049 12:40454641-40454663 ATAGATCTTAAGTTTTTTGTTGG + Intronic
1095992950 12:48050567-48050589 ACTGATCTCCAGTTATCTATTGG - Intronic
1096123443 12:49103323-49103345 TAGGATCTCCAGTTTACTATAGG - Intronic
1096535810 12:52273718-52273740 ATATATCTCTATTTTCCTATAGG - Intronic
1096729814 12:53600106-53600128 TGAGATCTCAAGTTCTCTATTGG + Intronic
1097639703 12:62165486-62165508 ACAAATTTCCAGTTTCCTATTGG + Intronic
1097687744 12:62707042-62707064 CTAGGTGCCCAGTTTTCTATAGG + Intronic
1098757977 12:74389426-74389448 TTAGGTCTCCTTTTTTCTATAGG - Intergenic
1098999669 12:77164697-77164719 ATAAATCTACAGTTTACTTTTGG - Intergenic
1099139880 12:78959570-78959592 ATAGATATCCATTATTCTGTTGG + Intronic
1100133719 12:91527958-91527980 ATAGCCCCCCAGTTTTCTCTCGG - Intergenic
1101318860 12:103654848-103654870 AGAGATTCCCAGGTTTCTATTGG - Intronic
1107253513 13:38394461-38394483 ATAAATTTCCAGTTTTTTATTGG - Intergenic
1109133401 13:58616762-58616784 ATAAATTTACAGATTTCTATAGG - Intergenic
1109529941 13:63629532-63629554 ATAGATATACAGTTTTCCTTTGG - Intergenic
1111879726 13:93941156-93941178 ATAGAACAAAAGTTTTCTATAGG - Intronic
1115825839 14:37273638-37273660 AAAGATGTCCAGTTCTCTGTAGG + Intronic
1116093976 14:40344180-40344202 ATCTTTCTCCAGTTTGCTATAGG + Intergenic
1119693055 14:76691921-76691943 ACACATCTCCAGGTTTGTATTGG - Intergenic
1125215569 15:37269615-37269637 ATAGATCTCCAGTCTTATGCTGG + Intergenic
1125835598 15:42747834-42747856 AAAGATCCCCATGTTTCTATGGG + Intronic
1130562944 15:84972867-84972889 ATAGATCTCTCTTTTTCTGTGGG + Intergenic
1131883836 15:96887828-96887850 CAAGATCTCAAGTTTTCTACTGG + Intergenic
1133748241 16:8703702-8703724 ATGGATCACCAGTTTGTTATTGG + Intronic
1136562500 16:31048476-31048498 ATGGGTCTCCAAATTTCTATGGG + Intergenic
1140563817 16:76016160-76016182 ATAGATCTCCATTTCTTTTTTGG + Intergenic
1142825744 17:2509114-2509136 AGAGATCTTCAGTTTACTACTGG + Intronic
1146414202 17:32616718-32616740 ATAGACCTCTATCTTTCTATGGG - Intronic
1147114103 17:38285971-38285993 ATATATCTCATGTTTTCTACAGG + Intergenic
1148415501 17:47503219-47503241 ATATATCTCACGTTTTCTACAGG - Intergenic
1151078059 17:71296966-71296988 ATCTTTCCCCAGTTTTCTATGGG - Intergenic
1153406670 18:4748598-4748620 ATAAAACTGCAGTTTTCCATGGG - Intergenic
1155450624 18:25959301-25959323 ATACTTCTGCAGTATTCTATTGG + Intergenic
1158101866 18:53838729-53838751 ATAAATCTACTGTTTTATATGGG - Intergenic
1158542657 18:58370742-58370764 ATAGATCTTCAGCTGTCTCTTGG - Intronic
926039470 2:9661310-9661332 ATAGATTTTCAGTTCTCTCTTGG + Intergenic
926431181 2:12787037-12787059 ATAGGTCTCAAGTTATCTATTGG - Intergenic
928741671 2:34361595-34361617 TGACATCTCCAGTTTTCTCTGGG + Intergenic
929749637 2:44696520-44696542 ATAAACCTCCAGTTTTTTGTTGG - Intronic
930366764 2:50448936-50448958 ATAAATATCCAGCTTTCCATAGG - Intronic
931514404 2:63037052-63037074 ATATATCTCTAGTTTACTTTTGG + Intronic
932730527 2:74218490-74218512 ATAGATCTCCAGTTTTCTATAGG + Exonic
932957456 2:76370507-76370529 AATGATCTCTAGTTTTATATAGG - Intergenic
933425300 2:82103652-82103674 GTAATTCTCCAGTTTTCTATTGG - Intergenic
934160390 2:89243988-89244010 GTACTTTTCCAGTTTTCTATGGG + Intergenic
934206885 2:89938450-89938472 GTACTTTTCCAGTTTTCTATGGG - Intergenic
935701397 2:105815360-105815382 ATAGAATTCGATTTTTCTATGGG + Intronic
936494044 2:113002314-113002336 ATAGAGCTCCAAGTATCTATGGG + Intergenic
938471085 2:131562545-131562567 AGATAACTTCAGTTTTCTATTGG - Intergenic
938630667 2:133163419-133163441 ATTCATCTCCCGTCTTCTATGGG - Intronic
939873612 2:147551868-147551890 ATAGATATTCAGCTGTCTATAGG - Intergenic
940181440 2:150938133-150938155 AAAGACCTTCAGTTTTCTTTGGG - Intergenic
941156278 2:161982049-161982071 ATAAAACTCCATTTTTCTATGGG - Intronic
943258804 2:185631372-185631394 ATTGATTTTTAGTTTTCTATTGG - Intergenic
943575795 2:189629722-189629744 GTAGTTCTCCAGATTTCTGTTGG - Intergenic
947137568 2:226990357-226990379 ATAAATCACCAGTGTTCTCTGGG - Intronic
947517579 2:230820935-230820957 ATACATCTCCACTTTTTTAAGGG - Exonic
1170460172 20:16570313-16570335 ATAGATTTCCAATTTTTTAAGGG + Intronic
1170686392 20:18573665-18573687 TTGGGTCTCCATTTTTCTATGGG - Intronic
1171002258 20:21426343-21426365 ATAGATCTCAAGCTTTTGATTGG + Intergenic
1174968152 20:55242877-55242899 TTAGATGTCCAGTGTTCTTTAGG + Intergenic
1176387880 21:6148301-6148323 TCAGCTCTCCAGTTTTCTAGTGG + Intergenic
1176634603 21:9179348-9179370 ATAGATCTCCAAGTTTATAGAGG + Intergenic
1177107747 21:16980985-16981007 TTGGATCTCTAGTTTTCTTTTGG - Intergenic
1177679505 21:24347497-24347519 ATAGATCTAAAGTCATCTATAGG - Intergenic
1178283207 21:31302177-31302199 ATATATCTCCACTTTTTTAAGGG + Intronic
1179735592 21:43389947-43389969 TCAGCTCTCCAGTTTTCTAGTGG - Intergenic
1183886442 22:40887169-40887191 ACAGATCTGCAGTTTATTATAGG + Intronic
1184738542 22:46413204-46413226 ATAAATCTTCAGTTTTTAATAGG + Intronic
949919496 3:8990074-8990096 TTAGATCTCCATTTTACTGTTGG + Intronic
951553002 3:23894431-23894453 CCAGAGCTCCAGTTTTCTAGGGG + Intronic
951946628 3:28144462-28144484 AGAAATCACCAGTTTTCTGTTGG + Intergenic
953643882 3:44735459-44735481 AAATATCCCCATTTTTCTATTGG - Exonic
953749541 3:45598709-45598731 AGAGATTTCCAGTTTTAAATTGG + Intronic
954639533 3:52089752-52089774 ATAGTTATACAGTTTTCCATGGG - Intronic
955814804 3:62830624-62830646 ATAAAGCTCCAATTTTCTGTAGG - Intronic
957273716 3:78063541-78063563 ATAGATCTCCATGTTTTTCTTGG - Intergenic
957983359 3:87541514-87541536 ACAGAACTCCAGTTTTATTTAGG + Intergenic
961736696 3:129006290-129006312 ACAGAACTCCAGTTTTGTTTGGG - Intronic
962032451 3:131615638-131615660 ATAGATCATAAGTTTTTTATAGG + Intronic
963406014 3:144864926-144864948 AGATATCTCCAGTTTTATACAGG - Intergenic
963877246 3:150490300-150490322 ATAGCTCTCAAGTTTTCTCTGGG - Intergenic
964681264 3:159341999-159342021 ATAGTTCTTCATTATTCTATTGG + Intronic
964692389 3:159464915-159464937 CTAGAACTACAGTTTTTTATGGG + Intronic
965171687 3:165273893-165273915 AGAGATCTTCAGTTGTGTATAGG - Intergenic
965485360 3:169272248-169272270 TTAGATCTCCAGTAGTCTCTGGG - Intronic
965552545 3:169983272-169983294 CTAGAAGTTCAGTTTTCTATAGG + Intronic
966081398 3:176007001-176007023 AAAGATGTCCAGTTTGGTATTGG - Intergenic
966081834 3:176014377-176014399 ATAGTTCCCCACTTTTCTTTAGG - Intergenic
966697275 3:182803344-182803366 ATAGATTGCCCGTTTTCCATTGG + Intronic
968064833 3:195752917-195752939 ACAGAGCTCCAGATTTCTCTGGG - Intronic
973117732 4:46482347-46482369 AGAGCTCTCCAGTTTTCCACTGG + Intergenic
973649945 4:52988757-52988779 ATACATTTCCATTTTACTATAGG + Intronic
973767508 4:54176712-54176734 AGAGATCCCCATTTTGCTATGGG - Intronic
974259194 4:59502946-59502968 ATAAATGTGCAGTTTTCTGTTGG + Intergenic
977801708 4:101242387-101242409 ATAGCTTACCAGTTTTCAATTGG - Intronic
979230417 4:118342866-118342888 ATAGGCCTCCAGTTTTATAAAGG + Intronic
979887814 4:126052473-126052495 ATAGATACCCTATTTTCTATTGG - Intergenic
980277550 4:130674376-130674398 ATTTATCTCCAGAATTCTATGGG + Intergenic
981334439 4:143554299-143554321 ACAGTTCTCCATTTTTCTAAGGG + Exonic
982673586 4:158350212-158350234 ACAGAGTACCAGTTTTCTATTGG + Intronic
984525519 4:180854691-180854713 ACAGATTCCCAGTTTTCTGTGGG + Intergenic
985201042 4:187485827-187485849 ATAGCTACCCAGTTTTCTCTAGG - Intergenic
987345473 5:16975142-16975164 TTAGATTGCCAGTTTTCCATGGG + Intergenic
987553855 5:19419440-19419462 ATCTATCTCCAGTTGTCCATAGG + Intergenic
987623819 5:20371292-20371314 ATGGATCAACAGTTCTCTATTGG + Intronic
990195845 5:53315076-53315098 ATATACATCTAGTTTTCTATTGG - Intergenic
991092042 5:62702913-62702935 AAAGAACTCAAGTTTTCTAAAGG + Intergenic
992229867 5:74653595-74653617 ATAGATTTACAGTTTGCTAAGGG + Intronic
993238008 5:85340847-85340869 AGAGATCTCAAGTATTATATTGG + Intergenic
993490596 5:88542341-88542363 ATAGATCTTCAATGTTCTCTAGG + Intergenic
993983127 5:94567057-94567079 ATAGAGATGAAGTTTTCTATTGG - Intronic
994836410 5:104859833-104859855 ATACATTTCCAGTTTGCTACAGG + Intergenic
995084155 5:108088130-108088152 ATTGATCTCCAGGTTTATAATGG - Intronic
996172886 5:120316750-120316772 ATACATTGCCAGTTTTCTACTGG - Intergenic
997830018 5:137141614-137141636 ATTGATCTCCATTTTTCTCTTGG - Intronic
998241340 5:140447957-140447979 ATAGAACTCCAGTTTCATCTGGG - Intronic
999116425 5:149168150-149168172 CTAGTTCACCAGTTCTCTATTGG - Intronic
999939358 5:156524156-156524178 ATAAAACTACAGTTTTATATAGG + Intronic
1000709869 5:164559406-164559428 ATAAATTTACATTTTTCTATTGG - Intergenic
1002298489 5:178244519-178244541 GTAGAACTCCAGTGTTCTACAGG - Intronic
1003049133 6:2764912-2764934 ATAGAAAACCAGTGTTCTATTGG - Intergenic
1003049134 6:2764915-2764937 ATAGAACACTGGTTTTCTATTGG + Intergenic
1003362348 6:5440191-5440213 AAAGATTTACAGTTTTATATAGG - Intronic
1004700223 6:18071824-18071846 ATAAATCTCCAGTTTTTTGGAGG + Intergenic
1005065038 6:21809439-21809461 ATATATCTACAGTTTACTAATGG + Intergenic
1005196016 6:23284923-23284945 ACAGATCTTTAGTTTCCTATAGG + Intergenic
1005764019 6:28992924-28992946 ATAAACCTCCAGTCTTCTTTGGG + Intergenic
1005811445 6:29519234-29519256 GAAGATGCCCAGTTTTCTATAGG - Intergenic
1007048229 6:38799000-38799022 ATAGCTCTCCTGTCTTCTCTTGG + Intronic
1007615168 6:43175523-43175545 ACTGAGCTACAGTTTTCTATCGG - Intronic
1008833734 6:55801662-55801684 ATAAATCTCCACTTTGCTCTTGG + Intronic
1009264373 6:61534446-61534468 AGAGTTCTGTAGTTTTCTATTGG - Intergenic
1009889910 6:69668089-69668111 ATTGATCTTCAGATTTCTTTGGG - Intergenic
1013702759 6:112794315-112794337 ATAGATCTTCATTTTTTTCTGGG + Intergenic
1014444723 6:121514035-121514057 AATGATCTCCAGTTCTCTCTTGG - Intergenic
1019784395 7:2965847-2965869 AGAGATCACCAGTTTTGTTTGGG + Intronic
1020002422 7:4763472-4763494 ATTGATCTGCTGTTTTCAATTGG + Exonic
1020400183 7:7768072-7768094 ATAAATTTCCAGGTTCCTATGGG - Intronic
1021891793 7:25193755-25193777 AAAGATATCCAGTTTTCTGTAGG - Intergenic
1022730698 7:33021741-33021763 AAAGTACTTCAGTTTTCTATAGG - Intronic
1022933010 7:35141731-35141753 ATACATTTCCAGTTTTCCTTCGG + Intergenic
1025897837 7:65720374-65720396 ACAGATCTACAGTATTTTATTGG - Intergenic
1027395727 7:77751835-77751857 CTAAATGTCCGGTTTTCTATTGG + Intronic
1031338863 7:120573618-120573640 ATAGATCTTCAGTTGGCAATTGG + Intronic
1032204356 7:129848881-129848903 TAAGATCTCCAGATTTCTTTAGG + Intronic
1032967251 7:137113102-137113124 ATAAATCAGCAGTTTTCAATGGG - Intergenic
1033201221 7:139372161-139372183 AGAGATCTCCATGTTTTTATAGG + Intronic
1033262369 7:139854829-139854851 TTAGTTCTCCTGTTTTCTGTAGG + Intronic
1033682889 7:143613357-143613379 AGAGAGCTCCAGTTGACTATGGG - Intergenic
1033701722 7:143844285-143844307 AGAGAGCTCCAGTTGACTATGGG + Intergenic
1041877422 8:62706307-62706329 ATACATCTCCAGATTTTTAGGGG + Intronic
1042685675 8:71437466-71437488 ATAGCTCTTAGGTTTTCTATGGG + Intronic
1042694820 8:71545488-71545510 ATACATCTCGACTTTTTTATAGG + Intronic
1044889752 8:96821505-96821527 ATAGCTATCCAGTTTTTGATAGG + Intronic
1046320289 8:112565579-112565601 ATATATTTACAGTTTTCTCTTGG + Intronic
1047098705 8:121652722-121652744 ATATATGTCAAGTTTGCTATTGG + Intergenic
1047157565 8:122337879-122337901 ATCAACCACCAGTTTTCTATGGG - Intergenic
1048392797 8:133984165-133984187 ATTGATCACCAGTTCTCTTTGGG - Intergenic
1050344880 9:4676492-4676514 ACAGAACTCCAGTTTTGTTTAGG + Intergenic
1055143277 9:72901046-72901068 CTACATGTCAAGTTTTCTATGGG + Exonic
1058382028 9:104388065-104388087 ACAGATCTCCTGTTATCTTTTGG - Intergenic
1058451818 9:105104182-105104204 ATAGCACTCCAGTTTCCTATTGG + Intergenic
1059094389 9:111397122-111397144 ATAGAACTTCAGTTCACTATTGG - Exonic
1059284719 9:113162561-113162583 ATAAATCTCGAGTTTTTTCTGGG + Intronic
1059785237 9:117574997-117575019 ATCTATTTCCAGGTTTCTATGGG + Intergenic
1059881988 9:118701234-118701256 ATTGATCTCCAATTATATATGGG + Intergenic
1188236540 X:27738721-27738743 ACAAATCTCCATTTCTCTATTGG + Intronic
1190003939 X:46716664-46716686 TTAGATCTCCAATTTGCTAATGG - Intronic
1190922598 X:54870231-54870253 ATAGATCTCCATTTCTTTATGGG + Intergenic
1191964851 X:66746750-66746772 ATAAATCTCCATTTTTCTGTAGG - Intergenic
1194816118 X:98443873-98443895 ATAAATCTTTAGTTTTCTCTAGG - Intergenic
1198176694 X:134163347-134163369 TTTTATCTCCATTTTTCTATTGG + Intergenic
1198850324 X:140959688-140959710 ATAGTTTTCCAGTTTTTTCTTGG + Intergenic
1200147104 X:153932044-153932066 GTAGATCTCGATTTTTCTAATGG - Intronic