ID: 932735844

View in Genome Browser
Species Human (GRCh38)
Location 2:74254054-74254076
Sequence CTGGCGGTGCTTGCGGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 145}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932735844_932735849 -1 Left 932735844 2:74254054-74254076 CCTGCAGCCGCAAGCACCGCCAG 0: 1
1: 0
2: 1
3: 13
4: 145
Right 932735849 2:74254076-74254098 GTGAGTATTCTTGGCACAAACGG 0: 1
1: 0
2: 8
3: 27
4: 189
932735844_932735846 -10 Left 932735844 2:74254054-74254076 CCTGCAGCCGCAAGCACCGCCAG 0: 1
1: 0
2: 1
3: 13
4: 145
Right 932735846 2:74254067-74254089 GCACCGCCAGTGAGTATTCTTGG 0: 1
1: 6
2: 4
3: 23
4: 67
932735844_932735850 22 Left 932735844 2:74254054-74254076 CCTGCAGCCGCAAGCACCGCCAG 0: 1
1: 0
2: 1
3: 13
4: 145
Right 932735850 2:74254099-74254121 AAAAAGAGTTAAAGTCCTCTAGG 0: 1
1: 1
2: 2
3: 33
4: 383

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932735844 Original CRISPR CTGGCGGTGCTTGCGGCTGC AGG (reversed) Intronic
900158661 1:1213336-1213358 CAGGCGGGGCTGGCGGCTGGAGG - Intronic
901294872 1:8153471-8153493 CTGGCGGAGATTACCGCTGCTGG + Intergenic
901626323 1:10627204-10627226 CGGGCGGGGCCTGCGGCTGCAGG - Intronic
901633062 1:10657252-10657274 CTGGCGGTGGCGGCGGCGGCTGG - Intronic
902954005 1:19912164-19912186 CTGCCAGTCCTTGCGGCTGGCGG + Exonic
903373854 1:22853703-22853725 CTGGCAGTGCCTGCGGTGGCTGG + Intronic
903425991 1:23254624-23254646 CTGGCTGGGCTTGCTGCAGCGGG - Intergenic
904107274 1:28096342-28096364 CTGGTGGTGCTTCCAACTGCGGG - Intergenic
906161187 1:43650231-43650253 CTGGCGGGGCTTTGGGCTGTAGG + Exonic
906306779 1:44724663-44724685 CTGGAGGTGCGCGCGGCGGCTGG + Exonic
906733474 1:48102865-48102887 CTGACGGTGCTGGAGGCTGTGGG + Intergenic
912386035 1:109271664-109271686 AGGGCTGGGCTTGCGGCTGCAGG - Exonic
921112877 1:212055770-212055792 CTGGTGGTGCATGCAGGTGCTGG - Intronic
922505029 1:226121518-226121540 CTGGCGCTGCTGGCGGCCGGAGG - Intergenic
922766354 1:228158489-228158511 CGGGCAGGGCTGGCGGCTGCAGG - Exonic
1062937814 10:1401124-1401146 CTGACGGTGTTTGTGGCTGCCGG - Intronic
1064446642 10:15399420-15399442 CTGGTGGTGGTGGTGGCTGCAGG + Intergenic
1067468111 10:46516407-46516429 CTGGCTGGGCTTGGGGCTGGGGG - Intergenic
1067669645 10:48307057-48307079 CGGGCGGGGCTCGCGGCGGCAGG - Intronic
1069999573 10:72366275-72366297 CTGGAGGTTCTGGGGGCTGCAGG + Intergenic
1070570861 10:77638448-77638470 CTGCTGCTGCTGGCGGCTGCGGG - Intronic
1072095925 10:92179748-92179770 CTGGCAGTGCTTGATGATGCAGG - Intronic
1076195242 10:128513059-128513081 CTGGAGGTCCTTGGGGGTGCCGG + Intergenic
1076809355 10:132878668-132878690 CTGGCAGTGGTTGAGGCTGGTGG + Intronic
1080637227 11:34134622-34134644 CTGGCGGTGCTTTAGGGTGGGGG + Intronic
1080910704 11:36594910-36594932 CTGGAGGTGCTTGGGGCGGGAGG + Exonic
1084190265 11:67495452-67495474 CTGGTGGTGCTGGGGGCGGCTGG + Exonic
1084423334 11:69071440-69071462 CTGGCTGTGCCTGGAGCTGCCGG + Intronic
1085195480 11:74669382-74669404 CTGGCAGTACTTGCGGCTGCTGG - Intergenic
1085229101 11:74949344-74949366 CTGGTGGTGCTTCCAACTGCGGG + Exonic
1089196732 11:116697887-116697909 CTGGGGCTGCTGGAGGCTGCTGG - Intergenic
1091228941 11:133975284-133975306 CTGGCTGTGCTTGCGGCGTTTGG + Intergenic
1092708271 12:11308322-11308344 CAGGAGGTGCCTGAGGCTGCTGG + Exonic
1092712412 12:11353172-11353194 CAGGAGGTGCCTGAGGCTGCTGG + Exonic
1092716148 12:11392892-11392914 CAGGAGGTGCCTGAGGCTGCTGG + Exonic
1094126001 12:27022798-27022820 CGGGCGGTGCTTGAAGGTGCGGG + Intronic
1094646540 12:32329975-32329997 CTGGCACTGCTTGCGTTTGCAGG - Intronic
1095478515 12:42610473-42610495 CTGGCGGGGGTTGCCACTGCTGG + Intergenic
1105356131 13:19661716-19661738 CTGGTGATGCTTGCCGCCGCCGG + Exonic
1105816279 13:24039245-24039267 CTGGCTGTGGCTGCAGCTGCTGG + Intronic
1109829060 13:67761815-67761837 TTGGGGTTGTTTGCGGCTGCTGG + Intergenic
1113634350 13:111909658-111909680 CTGGCGGTGCTAGGAGGTGCTGG + Intergenic
1114549507 14:23524923-23524945 CTGGGGGAGCCTCCGGCTGCAGG - Exonic
1118321082 14:64753742-64753764 CCGGCGGTGGTGGCTGCTGCAGG + Exonic
1121633695 14:95439628-95439650 GTGGCGGGCCTTGAGGCTGCTGG - Exonic
1122188337 14:100019486-100019508 CTGGCGGAGCTGGAGGCTGCAGG + Intronic
1122273916 14:100581451-100581473 CTGGAGGGGCTTCCGGCTCCTGG + Intronic
1125516366 15:40323524-40323546 CCGGCGGGGCTCGCGGCTCCCGG + Intergenic
1131182388 15:90249571-90249593 GTGGCCGTGGCTGCGGCTGCCGG - Exonic
1132398210 15:101489505-101489527 CTGGCGCTGGCTGCTGCTGCTGG - Exonic
1132547660 16:540663-540685 CTGGGGTCGCTGGCGGCTGCAGG + Intronic
1132885566 16:2180654-2180676 CTGCTGGTGCCTGCGGCTGCCGG - Exonic
1134066728 16:11233139-11233161 CTGGGGGTGGCAGCGGCTGCCGG + Intergenic
1134406948 16:13969395-13969417 CTGGAGCTGCGTGGGGCTGCAGG - Intergenic
1141690086 16:85591626-85591648 CTGGGGGTGCTGGGGGCTCCTGG + Intergenic
1142749351 17:1978051-1978073 GTTGCGGTGCGTGCAGCTGCGGG - Intronic
1142972722 17:3623656-3623678 CTGGCTTTGCTTGGGGCAGCTGG - Intronic
1143399877 17:6637246-6637268 CTGGGGGTGCTTGCAGCTGTAGG - Intronic
1144456301 17:15421793-15421815 CTGGCTGTGGTGGCGGGTGCCGG + Intergenic
1147402878 17:40191575-40191597 CTGGTTCTGCTTGCAGCTGCGGG - Exonic
1150249954 17:63699831-63699853 CTGGCGGGGCTCGCGGCGTCGGG - Intronic
1152175084 17:78782113-78782135 CCGGCAGCGCTTGCGGCGGCTGG - Intronic
1152197275 17:78925134-78925156 CGGGCGCTGCTCGCGGCGGCGGG + Exonic
1152560994 17:81078687-81078709 CTGGGCGTGTTTGCGGCTGTTGG + Intronic
1152712395 17:81879459-81879481 CTGGCTGTGCTTGTTGCTTCTGG - Intergenic
1154040522 18:10850412-10850434 GTGGGGGTGCTTGCTTCTGCTGG - Intronic
1154241476 18:12657627-12657649 GTGGCGGGGCTGGCGGCGGCGGG + Exonic
1159782337 18:72674853-72674875 CTGGGGGTGGCTGCGGCTGGAGG - Intergenic
1160266063 18:77341474-77341496 GTGGCGGTGCTGGCTCCTGCAGG + Intergenic
1160538721 18:79609231-79609253 CTGTTGGTGCAGGCGGCTGCAGG - Intergenic
1160904519 19:1446096-1446118 CTGGGGGTGCTCGCGGGGGCTGG - Intergenic
1161328763 19:3676283-3676305 CTCGCTGGGCTTGGGGCTGCAGG - Intronic
1161967679 19:7557305-7557327 CGGGAGGTGCTTGCGTGTGCGGG - Intronic
1162835225 19:13312477-13312499 CTGGCGGTGGTTGAGGGTTCTGG + Intronic
1163343846 19:16727381-16727403 CTGGAGGTGGTGGGGGCTGCAGG + Intronic
1165711371 19:38013141-38013163 CTGGCGCTGCTAGCAGGTGCTGG + Intronic
1165914154 19:39247727-39247749 CTGGAGCTGCTGGCGGCCGCGGG - Intergenic
1168669270 19:58228908-58228930 ATGGCGGTGCTTCCGGTGGCCGG - Intronic
1168694455 19:58396699-58396721 CTGGCGGTGCTGGTGGCCGCGGG + Exonic
925331507 2:3062421-3062443 CTGAGGGTGCTTTCGGCTGGTGG - Intergenic
926008100 2:9388489-9388511 CTGGTGGTGCTGGGGGCTGCAGG - Exonic
927262939 2:21112682-21112704 GTGGCTGTGCTTCAGGCTGCTGG + Intergenic
928757933 2:34547810-34547832 CTGGCGGTGGCAGCAGCTGCAGG + Intergenic
932735844 2:74254054-74254076 CTGGCGGTGCTTGCGGCTGCAGG - Intronic
934564320 2:95330054-95330076 CTGGCGGTGGCTGCGGCCGGAGG - Intronic
937914552 2:127092539-127092561 CTGGTGGTGCTAGGGACTGCGGG - Intronic
943306766 2:186272290-186272312 CTGGCTGTGCTTCTGGCTGCAGG - Intergenic
945251188 2:207767828-207767850 GTGGTTGTGCTCGCGGCTGCAGG + Exonic
945739710 2:213645119-213645141 CCTGCGGTGGTTGTGGCTGCAGG - Intronic
1168731528 20:86361-86383 CTGGTGGCACTTGCAGCTGCAGG + Intergenic
1170566359 20:17610027-17610049 CTTGCTGTGCCTGCGGCAGCCGG - Intergenic
1171368367 20:24642856-24642878 CTGGGTGTGCTTGTGGCTTCTGG + Intronic
1171409160 20:24934587-24934609 CTGGGGGTGCTAGAGGCTGAGGG - Intergenic
1171449733 20:25226957-25226979 CTGGCCGTGCTGTGGGCTGCTGG - Intergenic
1172080152 20:32334085-32334107 CTGGCTTTGCTAGCTGCTGCCGG - Exonic
1173153420 20:40587211-40587233 CAGGCGGTGCTTGTGCCCGCAGG - Intergenic
1174806945 20:53612478-53612500 CTGGTGGTGGTGGGGGCTGCGGG - Intergenic
1175152364 20:56945314-56945336 CCAGCGGTGCTTGTGCCTGCTGG + Intergenic
1175875202 20:62226240-62226262 CTGGCCGTGGTTGGGGCGGCAGG + Intergenic
1176002806 20:62840557-62840579 CTGGCCGTCCTTGCTGGTGCCGG - Exonic
1178152449 21:29811076-29811098 CTGGTGGTGCTCGCTGCTGCTGG + Intronic
1178942983 21:36923046-36923068 CTGGCGGTGGGTGCGGCGGTGGG - Intronic
1179573449 21:42291910-42291932 GTGGCTGTGCTTGGGGCTACAGG - Intronic
1180620578 22:17159175-17159197 CGGGCGGCGCGCGCGGCTGCGGG - Exonic
1182792821 22:32967199-32967221 CTGGCGGTGCCTGAGGCAGATGG - Intronic
1183600110 22:38835210-38835232 CTGGCGGTGCTCCCAGCTGGCGG + Intronic
1184492816 22:44820116-44820138 CAGGTGGTGCCTGTGGCTGCAGG + Intronic
1185419104 22:50725498-50725520 CTTCCGGTGCTTCTGGCTGCAGG + Intergenic
949480912 3:4493253-4493275 GTGGCGGCGCCTGAGGCTGCGGG - Intergenic
952828414 3:37543232-37543254 CTGGCAGTGCCTGATGCTGCAGG + Intronic
954621802 3:52000684-52000706 GTGGCGGTGCTCGCGGGGGCTGG + Intergenic
954757992 3:52852524-52852546 CTGGCCTTGCTTTCTGCTGCTGG - Intronic
955342050 3:58132521-58132543 CTGCCTGTGCTTGCTGCTGGAGG - Intronic
956049390 3:65231244-65231266 CTGGAGGTGCTAGAGGCTGGTGG - Intergenic
964852053 3:161105312-161105334 CCGGCCGTGCGTGCGGATGCGGG - Exonic
965521271 3:169669748-169669770 CTGGCGATGCTTGATGTTGCTGG - Intergenic
966772959 3:183520336-183520358 CTGGGGATGCTTGCGGGTGAAGG + Intronic
968641802 4:1718534-1718556 CTGGCGGCTCTTCCTGCTGCTGG - Exonic
972551992 4:40142303-40142325 CTGGCGGTGGTGGCGACGGCTGG + Intronic
975734767 4:77370542-77370564 CTGGCAGTGCTTCTGGCAGCTGG + Intronic
985608460 5:872085-872107 CTGGCGGTGCCTGCAGCAGGTGG + Intronic
985773116 5:1825307-1825329 CTCCCAGTGCATGCGGCTGCAGG - Intergenic
988424310 5:31045479-31045501 CTGGAGGTCCTTGTGGATGCAGG - Intergenic
993364637 5:87020459-87020481 CTGGCAGTGGTGGCTGCTGCAGG - Intergenic
996153103 5:120064146-120064168 CTGGCTGTGCTTCCATCTGCAGG + Intergenic
1001599840 5:172921706-172921728 GTGGCGGTGCTGGCAGCAGCAGG - Intronic
1002795948 6:471103-471125 CCGGCGGGGCTCGAGGCTGCAGG + Intergenic
1003156730 6:3603303-3603325 CTGGTGGTGCATGCGTATGCTGG + Intergenic
1006717269 6:36128687-36128709 CAGGCTGTGCCTGAGGCTGCAGG + Intronic
1009940363 6:70282437-70282459 CTAGCGGTGCTGGCGGCTCCGGG - Intronic
1016814138 6:148288071-148288093 CTGGCCGTGCTTGTGGCAGTGGG + Intronic
1019314645 7:378930-378952 CTGGGGGTCCTGGCGCCTGCGGG - Intergenic
1019448401 7:1083226-1083248 CTGAAGGCGCGTGCGGCTGCTGG - Intronic
1019476671 7:1247682-1247704 CAGCCGGTCCTTGCGGCCGCGGG + Intergenic
1024561850 7:50651336-50651358 CTGGAGGTTCTGGCGGCTGCTGG + Intronic
1025228801 7:57185285-57185307 CTGGGAGTTCTTGAGGCTGCAGG - Intergenic
1027250168 7:76393803-76393825 GTGGCGGTGCCTGGGTCTGCGGG - Intronic
1029154281 7:98503954-98503976 CTGCCTCTGCCTGCGGCTGCCGG - Intergenic
1035607163 8:937588-937610 CTGGAGTTGCTTGGGGCTGGAGG + Intergenic
1036218022 8:6896997-6897019 CTGGCAGTGCTTGCCGCTTATGG - Intergenic
1036556132 8:9862111-9862133 CTGGGGGTGCTGGCAGCTGGAGG - Intergenic
1036651925 8:10649761-10649783 CTGGCTGTGCTTCCGGCTCCAGG + Intronic
1037674363 8:21041279-21041301 CTGGCTGGGCTGCCGGCTGCGGG - Intergenic
1038319555 8:26514399-26514421 CTGCCGGGGCTTGGGGCTGCCGG - Intronic
1039419031 8:37420290-37420312 ATGGAGGTGCTAGGGGCTGCTGG - Intergenic
1042188719 8:66164243-66164265 TTGGCCGTGCTTGTGGCTGAAGG - Intronic
1042190037 8:66177288-66177310 CCGGCCGAGCCTGCGGCTGCTGG + Exonic
1049223114 8:141436863-141436885 CTGGGGGTGGTGGCGGCTGGTGG + Intergenic
1049923404 9:386397-386419 CTGGCTGGCCTTGGGGCTGCAGG - Exonic
1051265540 9:15306196-15306218 CTGTGGGTGCTGGCTGCTGCTGG + Intronic
1056931770 9:90883613-90883635 CTGGTGGTGCATTCAGCTGCTGG - Intronic
1057039012 9:91833943-91833965 CTGTGGGTGCTTGAGGCTGGGGG - Intronic
1059443287 9:114323086-114323108 CAGGCAGTGCTGGTGGCTGCAGG - Exonic
1059444479 9:114329857-114329879 CAGGCAGTGCTGGTGGCTGCAGG - Exonic
1060734152 9:126055630-126055652 CTGGCGGTGCTGGGCGCTGAGGG + Intergenic
1061755373 9:132808828-132808850 CTGCCTGTGCTCCCGGCTGCTGG - Intronic
1062309258 9:135927160-135927182 CTGGAGGAGCCTGTGGCTGCAGG - Intergenic
1062423699 9:136496496-136496518 GTGGTGGTGGTGGCGGCTGCAGG + Exonic
1062489813 9:136799647-136799669 CTGGAGGAGCCAGCGGCTGCGGG + Intronic
1062513409 9:136920460-136920482 CAGCCGGTGCTGCCGGCTGCAGG - Exonic