ID: 932736895

View in Genome Browser
Species Human (GRCh38)
Location 2:74260599-74260621
Sequence CTGTCTAAAGGGCTGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 174}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932736895_932736902 -2 Left 932736895 2:74260599-74260621 CCATCCACCAGCCCTTTAGACAG 0: 1
1: 0
2: 0
3: 20
4: 174
Right 932736902 2:74260620-74260642 AGAAATCTAGGAGCAGCCTTGGG 0: 1
1: 0
2: 1
3: 16
4: 179
932736895_932736901 -3 Left 932736895 2:74260599-74260621 CCATCCACCAGCCCTTTAGACAG 0: 1
1: 0
2: 0
3: 20
4: 174
Right 932736901 2:74260619-74260641 CAGAAATCTAGGAGCAGCCTTGG 0: 1
1: 1
2: 3
3: 98
4: 1399

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932736895 Original CRISPR CTGTCTAAAGGGCTGGTGGA TGG (reversed) Intronic
900477132 1:2881361-2881383 CTGTCTAGAGGGGTGGGGGCAGG + Intergenic
901859282 1:12063835-12063857 CTGGCTGAAGGGCTAGTGGTGGG + Intronic
903265075 1:22153358-22153380 CTCTCTCTTGGGCTGGTGGAAGG + Intergenic
903757017 1:25669439-25669461 CTGGCAAAAGGGCTGGTACATGG + Intronic
907337865 1:53712175-53712197 CTGTGCAAAGGCCTGGTAGAAGG - Intronic
907871376 1:58446521-58446543 CAGTCAAAAGGGCTGGGGGTGGG + Intronic
909700856 1:78521077-78521099 GTGTCTATAGAGCTGGGGGATGG - Intronic
911181494 1:94864451-94864473 CACCCTAAAGGGTTGGTGGATGG + Intronic
912175183 1:107146301-107146323 CTTTCCAAAGGGCCGGGGGATGG - Intronic
912937597 1:114017429-114017451 GTGTCTAAATTGCTGGAGGAAGG + Intergenic
914447160 1:147759848-147759870 ATGTTTAAATGGCTGTTGGATGG + Intronic
917155164 1:171989776-171989798 CTGTTTAAAGTGATTGTGGAAGG + Intronic
920412731 1:205774916-205774938 CTGTTCAAAGTGCTGGTGGTGGG - Exonic
920503087 1:206497671-206497693 CACTCTAAAGGCCTGGGGGAAGG + Exonic
921825071 1:219663346-219663368 CTTTTTAAAGGGGTGGTGGCTGG - Intergenic
923548164 1:234939990-234940012 CTGCCGCCAGGGCTGGTGGATGG - Intergenic
1063134158 10:3201853-3201875 CTTTCTGAGGGGCTGGGGGAGGG + Intergenic
1067186210 10:44030122-44030144 CTGTCTAAAGGACTGCTTGAAGG - Intergenic
1072430748 10:95368814-95368836 CAGCCAAAAGGGCTGGAGGATGG - Intronic
1073347663 10:102796442-102796464 CTGTCTACAGGGCTAGAGGCTGG - Intronic
1075541308 10:123316791-123316813 CTGTCTTCTGGGCTGTTGGAGGG - Intergenic
1075948530 10:126458029-126458051 CTGTCTAAAGACCTCGGGGAAGG - Intronic
1080104721 11:28499978-28500000 TTGTTTAAAGGGCAGGTGGTTGG + Intergenic
1080124450 11:28715924-28715946 CTGTCAAGAGTGCTGGTGGACGG - Intergenic
1081012025 11:37825453-37825475 ATGTCTAAAAGGTTTGTGGAAGG - Intergenic
1081776330 11:45678276-45678298 GTGTCAAAACGGCAGGTGGAGGG - Intergenic
1084733154 11:71087408-71087430 CTGGCAAAAGGGCTGGCGGCTGG + Intronic
1085802457 11:79602977-79602999 CTGACTAAAGGACAGGTGGTTGG + Intergenic
1086930973 11:92692662-92692684 CTGTCTGAAAGGATGGTGAAGGG + Intronic
1089133639 11:116232108-116232130 CTGCTTGAAGGGCTGGGGGAAGG - Intergenic
1089220999 11:116871570-116871592 GTGTGAAAAGGGCTGGTGGCAGG + Intronic
1089254487 11:117187070-117187092 CTGTCTGGAGGGCTCGTGGGCGG + Intronic
1091279629 11:134374592-134374614 CTGTTTCAAGGGCTGGGAGAAGG + Exonic
1091770054 12:3145700-3145722 CTGTCCAGATGGCTGGGGGAAGG + Intronic
1094446171 12:30532966-30532988 CTGTCTACAAGGCTGATGCACGG + Intergenic
1096033496 12:48442514-48442536 CTGTGTTCAGGGCTGGTGGGGGG - Intergenic
1096412024 12:51383910-51383932 CTTTCTCCAAGGCTGGTGGAGGG - Intronic
1096826327 12:54280900-54280922 CTGTAGAATGGGCTGGTGCAAGG - Intronic
1097724397 12:63058334-63058356 ATGTCTAAAAGGCTGGTGGGAGG + Intergenic
1098981715 12:76963218-76963240 CTCTCTCTGGGGCTGGTGGAAGG + Intergenic
1099738209 12:86597787-86597809 CTTTTTAAAGGGATTGTGGATGG - Intronic
1101330949 12:103757558-103757580 CTGTCTGAAGTGATGGGGGAAGG + Intronic
1101614867 12:106326351-106326373 CTGTCAACAGGGAGGGTGGATGG - Intronic
1102235116 12:111289617-111289639 CGGTGTAAAGGGCTGGGAGAGGG + Intronic
1102760359 12:115379864-115379886 CTGTCTAAAGGGCAGGAAGGTGG - Intergenic
1104584041 12:130033326-130033348 CTGTCTAAGGGGCTCTTGGATGG + Intergenic
1104691905 12:130832874-130832896 CTGTGGACAGGGCTGGGGGAGGG - Intronic
1107104198 13:36626009-36626031 CTGTCTAATGGGCTGATGTGAGG + Intergenic
1107607168 13:42070729-42070751 TTGTCTAAAGTGCTGGAGCAGGG - Intronic
1108201946 13:48053001-48053023 GGGACTAAAGGGCTGGGGGATGG + Intergenic
1109741856 13:66563956-66563978 CTGTCGAAAGGGCTGTGGTAAGG - Intronic
1110560588 13:76907440-76907462 CTGTAGAAAGGGCTGGTAAATGG - Intergenic
1117011132 14:51471895-51471917 CCTTATAAAGGGCTGGAGGAGGG + Intergenic
1117445911 14:55803801-55803823 GTGTCTAGATGGGTGGTGGAAGG + Intergenic
1120580194 14:86237973-86237995 CTGTATAAATGGTTGGGGGAAGG + Intergenic
1121083099 14:91124534-91124556 CTGAAGAAAGTGCTGGTGGAAGG + Intronic
1122389202 14:101368775-101368797 CTGTCCTAAGGGCTGGTGTGGGG + Intergenic
1126687747 15:51263257-51263279 CTGTATAAAGGGCTGCTGAGTGG + Intronic
1128231821 15:66040569-66040591 CTGTCTACAGTGGTGGTGGGAGG + Intronic
1128542230 15:68544088-68544110 CTGTCTACAGAGCTTGGGGAAGG - Intergenic
1129681237 15:77659633-77659655 CTGCCTACAGGGGTAGTGGATGG + Intronic
1130770273 15:86917110-86917132 GTGTTTAAAGTGCTGTTGGAAGG + Intronic
1130832603 15:87616744-87616766 CTGTCTGGAGGGCTGATGGGTGG + Intergenic
1132236875 15:100228778-100228800 CTGTCCAATGGTCTGGGGGAAGG + Intronic
1135988625 16:27203421-27203443 CTGTTTAAAAGGCCGGGGGATGG - Intergenic
1137804266 16:51288629-51288651 CTGGCTGGAAGGCTGGTGGAAGG - Intergenic
1138415105 16:56867124-56867146 ATGACTGATGGGCTGGTGGAGGG + Exonic
1139116061 16:63954569-63954591 GTTTCTAAAGTGGTGGTGGATGG - Intergenic
1139207818 16:65046220-65046242 CTGTCTATATGGCTGGTTGTCGG + Intronic
1139827109 16:69766116-69766138 CTGTCTGAGGGGCAGGTGTAGGG - Intronic
1147341704 17:39756323-39756345 CTGGCCCAAGGGATGGTGGAGGG - Intergenic
1147363674 17:39946617-39946639 CCGACCAAAGGGGTGGTGGAGGG - Intergenic
1148336666 17:46846684-46846706 CTGGATAAAGGGCTGGAGAATGG + Intronic
1148450528 17:47774848-47774870 GAGTCTAAAGGGCTGAAGGAGGG - Intergenic
1148811078 17:50291740-50291762 CTGTGTAAAGGAATGGTGGTGGG - Intergenic
1151325971 17:73379945-73379967 CTGTGTAAAGAGTTGGTGGATGG - Intronic
1151451627 17:74201547-74201569 CCATATAAAGGGGTGGTGGATGG - Intergenic
1152656918 17:81524089-81524111 CTTTCTGAGGTGCTGGTGGACGG - Intergenic
1152927357 17:83093384-83093406 CTGTCCCCAGGGCTGGTGGAGGG - Intronic
1155555161 18:27010872-27010894 CTGTCTCAAGGGCAGATGGGTGG + Intronic
1155830420 18:30509908-30509930 CTATCTAATGGGTTGGTTGATGG - Intergenic
1156816522 18:41317801-41317823 CTGTCTAAATGCCAGGTGGAAGG - Intergenic
1157469673 18:47979587-47979609 CTGTCTCAAGGGCTGGCAGAGGG - Intergenic
1158308043 18:56128017-56128039 CTGACATAAGGGCTGGTGGGTGG - Intergenic
1159624411 18:70675384-70675406 GTGTGTAAAGGGATGGGGGAAGG + Intergenic
1160318415 18:77868689-77868711 CTGACTACAAGGCTGGGGGAAGG + Intergenic
1160789775 19:918047-918069 CTGAACAAAGGGCTGGGGGAGGG + Intronic
1161521246 19:4724529-4724551 ATGTCTAAAAGGCAGGAGGAAGG + Intronic
1161801909 19:6421076-6421098 TTGTCTGAAGGGCTGTGGGAGGG - Intronic
1162500834 19:11052734-11052756 CTGTCTGCAGGGCTGGGGGAGGG - Intronic
1163287562 19:16358002-16358024 CTGTCCTCAAGGCTGGTGGAGGG - Intronic
1163456997 19:17412814-17412836 CTGTCTCAGGGTCTGGTGGAGGG + Intronic
928428573 2:31199501-31199523 CTGGAGAATGGGCTGGTGGAAGG - Exonic
928571422 2:32613069-32613091 ATGTGTAAAGGCCTGGAGGAGGG - Intronic
932338551 2:70944588-70944610 AGGTCTGAAGGGCTGGAGGATGG - Intronic
932736895 2:74260599-74260621 CTGTCTAAAGGGCTGGTGGATGG - Intronic
934165213 2:89288183-89288205 CTTTCTGAAGGGCAGGTGAAGGG + Intergenic
934202060 2:89894279-89894301 CTTTCTGAAGGGCAGGTGAAGGG - Intergenic
935593638 2:104863401-104863423 CTTTCTGCAGGGCTTGTGGAAGG + Intergenic
936233800 2:110726129-110726151 CTCTCTAAGGAGCTGCTGGAAGG - Intergenic
937977513 2:127590651-127590673 CTGTCTGCAGGGCTGGTGAAAGG - Intronic
942060585 2:172225317-172225339 CTGTCATAAGGACTGGGGGATGG - Intergenic
942307798 2:174625573-174625595 CTGCCTCATAGGCTGGTGGAGGG + Intronic
943806010 2:192127093-192127115 CTGTCAGAAAGCCTGGTGGAGGG - Intronic
945769261 2:214019983-214020005 CTGTCTCAAGAGCTGATTGATGG + Intronic
946196167 2:218034030-218034052 CTGTCGCAAGGGCTGGGGGCGGG - Intergenic
946411734 2:219518587-219518609 CTGTCTACAAGGCTGGGGGTGGG - Intronic
948903469 2:240967293-240967315 CAGTCCAATGGGCGGGTGGAGGG - Intronic
1172965801 20:38833893-38833915 CTGTAGAAAGGGCTTTTGGAGGG + Intronic
1173182226 20:40814107-40814129 CAGGCTGAAGGGCTGGGGGAAGG - Intergenic
1173691394 20:44963971-44963993 TTGTCTAAGGCCCTGGTGGAAGG - Intergenic
1173976504 20:47190641-47190663 CAGTTTAATGGGCAGGTGGATGG + Intergenic
1175219544 20:57409032-57409054 CTGTCTTGGGGGTTGGTGGAGGG + Exonic
1178418806 21:32426773-32426795 TTGTCTGAAGGGGTGATGGAGGG - Intronic
1179519264 21:41931737-41931759 CTGACAAAAGGGCTGTTGGGGGG + Intronic
1180172447 21:46066867-46066889 GTTTCTAAAGGGCTCCTGGATGG - Intergenic
1180253083 21:46602599-46602621 CTGTCTAAGAGGCCGGTGGAAGG - Intronic
1181324926 22:22037328-22037350 CTCTCTAAAGGGGAGGTGTAGGG + Intergenic
1181770746 22:25123584-25123606 CTCTCTACAGGGCTGCTTGAGGG - Intronic
1181882717 22:25993680-25993702 CTCTCTTAAGGGCTGGAGGCAGG + Intronic
1184032341 22:41902525-41902547 CTGTCGATGGGGCTGGGGGAAGG - Intronic
1184186131 22:42866535-42866557 CTGTGAAAAGGGGTGGGGGAAGG + Intronic
1184599096 22:45532185-45532207 CTGTCCAGGGGCCTGGTGGAGGG + Intronic
1184777084 22:46628635-46628657 GTGTCTGAGGGGCAGGTGGAGGG + Intronic
1185181422 22:49365642-49365664 CAGCCTGGAGGGCTGGTGGACGG + Intergenic
949178091 3:1091301-1091323 CTATCTAAAGCACAGGTGGATGG + Intergenic
950121496 3:10485024-10485046 CTGTGAAAGGGGCTGGTTGAGGG + Intronic
952000285 3:28777370-28777392 GTGACTGGAGGGCTGGTGGAGGG + Intergenic
952242951 3:31552712-31552734 CTGTCCAAAGGACTCGTGGATGG - Intronic
954134125 3:48574356-48574378 CTGTCTAGGGGGATGGTGGGTGG - Intronic
955781958 3:62494315-62494337 CTGCCTAAAAGGCTGGTGTCTGG - Intronic
956268503 3:67425028-67425050 CTGGCTAAAGGTGTGGGGGAAGG - Intronic
961795149 3:129403761-129403783 CTCTCGAAAGGGCTGGAGGCAGG + Intronic
963004670 3:140715333-140715355 ATGTGGAAAAGGCTGGTGGACGG - Intergenic
963383599 3:144562061-144562083 CTGTCTCAAGGGCTCGAGCATGG - Intergenic
963734047 3:148999846-148999868 CTGACTATGGGGGTGGTGGAGGG - Intronic
966871210 3:184291522-184291544 GTGTCAAACGGGCTGGTGAATGG + Intronic
968412550 4:402557-402579 TTGTCTAGAGGGCTGGTGTCTGG + Intergenic
970929872 4:21496987-21497009 CTCTCTAAGGGGCATGTGGAGGG + Intronic
971582361 4:28358211-28358233 CTGTCAAGAGTGCTGGTGGTGGG - Intergenic
973035002 4:45395294-45395316 CTGTCTATATGGCTTGTAGATGG + Intergenic
974022212 4:56701808-56701830 CTTTCTAAACGGATGGGGGAGGG + Intergenic
976483646 4:85574374-85574396 CTGTCTAGAGGGCTTGGGAAGGG + Intronic
976841120 4:89433338-89433360 GTGGCTAAAGGTCTGGGGGAAGG + Intergenic
979994901 4:127420121-127420143 CTGTCTGATGGGGTGGTAGAGGG - Intergenic
984203197 4:176753130-176753152 CATTCTTAAGGGCTGGTGAATGG + Intronic
984856624 4:184201041-184201063 CTGTCGAAAGGGCTGATGATGGG + Intronic
986615932 5:9617499-9617521 CTGTCTAAAGTACTGATGGATGG + Intergenic
992009368 5:72511526-72511548 CTGTAAAAAGGGCAGGGGGATGG - Intergenic
993834593 5:92802262-92802284 CTATCTGAAGGGCTGGTGCAAGG + Intergenic
994028581 5:95114388-95114410 CTGTCCCAAGGGCAGGTCGAAGG - Intronic
995865298 5:116683942-116683964 CTGTCTAAAGTGTTAGGGGAGGG - Intergenic
999128488 5:149264659-149264681 CTGTCTCCATGGCTTGTGGATGG - Intergenic
999361337 5:150989024-150989046 CTGTCTAACCGGATGGAGGAGGG + Intergenic
1001480973 5:172089084-172089106 TTGTTTAAGGGACTGGTGGAGGG - Intronic
1003024541 6:2542533-2542555 CTCTCTCCTGGGCTGGTGGAGGG - Intergenic
1003426115 6:5999404-5999426 CTGTCTAAAGCGGGGGTGGGGGG + Intronic
1003561341 6:7183362-7183384 TTGTCCAATGGGCTGATGGATGG - Intronic
1006711494 6:36076345-36076367 CTGACTAAAGGGCTGTTCAAAGG - Intronic
1013298621 6:108781958-108781980 CTCTGTGAAGGGCTGGGGGAGGG + Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1015589124 6:134805463-134805485 GCGTGTAAAGGGCTGGAGGAGGG - Intergenic
1015595626 6:134863837-134863859 CTGTCTATATTGCTGGTGGGTGG - Intergenic
1016076233 6:139799371-139799393 GTGTCAAGTGGGCTGGTGGAAGG + Intergenic
1017751208 6:157492083-157492105 CTGCCTGGAGGGCTGCTGGATGG - Intronic
1020078631 7:5274821-5274843 TTGTCAAAAGGGCTGGGTGAAGG - Intronic
1025200260 7:56957363-56957385 CTGTCAAAAGGGCTGGGTGAAGG + Intergenic
1025671685 7:63619569-63619591 CTGTCAAAAGGGCTGGGTGAAGG - Intergenic
1033611829 7:142970620-142970642 CTGTCAGAGGTGCTGGTGGAGGG + Intergenic
1036498575 8:9293306-9293328 CTATCTAAAGGGATTGTTGAGGG + Intergenic
1037431011 8:18813193-18813215 CTGACTTAAAAGCTGGTGGAAGG + Intronic
1039743950 8:40406966-40406988 CTGTCTAAAGGGATGTTGGCAGG - Intergenic
1041035917 8:53790419-53790441 CTGTATAAAGGGCTGGTCGTGGG - Intronic
1041192996 8:55372335-55372357 CTGGCTAAAGGTCAGGTGAATGG - Intronic
1041200157 8:55446006-55446028 CTGTCTGAAGGGCTGATTGATGG + Intronic
1041748783 8:61236912-61236934 CTGCCTACAATGCTGGTGGATGG + Intronic
1043305933 8:78795118-78795140 CTTTCTCAAGGGCTGTTGTAAGG + Intronic
1043386062 8:79748912-79748934 CTTTCTCCAGAGCTGGTGGAAGG - Intergenic
1045018258 8:98018347-98018369 CTGTGGAAAGGGCTGATGGCTGG - Intronic
1047903987 8:129453417-129453439 TTGGCTAAAAGGCTGGTGGGAGG - Intergenic
1050286323 9:4106107-4106129 TTGTCTAAGGTGTTGGTGGAAGG - Intronic
1050318072 9:4423448-4423470 TTTTCTAAAGGTCTGGGGGAGGG - Intergenic
1052263602 9:26546352-26546374 ATTACTAAAGGGCTGGTGGCTGG + Intergenic
1057110306 9:92463579-92463601 CAGCCTACAGGGCTGGAGGAGGG - Intronic
1057367129 9:94433092-94433114 CCGTCTCAAGGGCTGCAGGAAGG - Intronic
1057656207 9:96954978-96955000 CCGTCTCAAGGGCTGCAGGAAGG + Intronic
1057821145 9:98332035-98332057 CTGTCAAATGAGCTGATGGATGG - Intronic
1057833003 9:98420799-98420821 CTGTGTAAAGGCCTGGAGGTGGG + Intronic
1058785221 9:108380475-108380497 AGGTCTAATGGGCTGGAGGAAGG - Intergenic
1061813619 9:133179383-133179405 CTGTTACAAGGGCTGGTGCACGG + Intergenic
1192436458 X:71146269-71146291 CTGGCTGAAGGGGTGGGGGAGGG - Intronic
1193667319 X:84337920-84337942 TTTTTTAAGGGGCTGGTGGAGGG - Intronic
1193859983 X:86653379-86653401 ATGTCTAAAAGCGTGGTGGAAGG + Intronic
1197108861 X:122748328-122748350 CTGTCCAATTGGCTGGTGGCTGG + Intergenic
1200394417 X:155975097-155975119 CTGGCTGAAGGGCTACTGGATGG - Intergenic