ID: 932736901

View in Genome Browser
Species Human (GRCh38)
Location 2:74260619-74260641
Sequence CAGAAATCTAGGAGCAGCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1502
Summary {0: 1, 1: 1, 2: 3, 3: 98, 4: 1399}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932736895_932736901 -3 Left 932736895 2:74260599-74260621 CCATCCACCAGCCCTTTAGACAG 0: 1
1: 0
2: 0
3: 20
4: 174
Right 932736901 2:74260619-74260641 CAGAAATCTAGGAGCAGCCTTGG 0: 1
1: 1
2: 3
3: 98
4: 1399
932736897_932736901 -10 Left 932736897 2:74260606-74260628 CCAGCCCTTTAGACAGAAATCTA 0: 1
1: 0
2: 2
3: 17
4: 137
Right 932736901 2:74260619-74260641 CAGAAATCTAGGAGCAGCCTTGG 0: 1
1: 1
2: 3
3: 98
4: 1399
932736888_932736901 17 Left 932736888 2:74260579-74260601 CCACTCAATGCCCCTCCCTCCCA 0: 1
1: 0
2: 4
3: 71
4: 905
Right 932736901 2:74260619-74260641 CAGAAATCTAGGAGCAGCCTTGG 0: 1
1: 1
2: 3
3: 98
4: 1399
932736891_932736901 5 Left 932736891 2:74260591-74260613 CCTCCCTCCCATCCACCAGCCCT 0: 1
1: 0
2: 19
3: 195
4: 2503
Right 932736901 2:74260619-74260641 CAGAAATCTAGGAGCAGCCTTGG 0: 1
1: 1
2: 3
3: 98
4: 1399
932736894_932736901 -2 Left 932736894 2:74260598-74260620 CCCATCCACCAGCCCTTTAGACA 0: 1
1: 0
2: 0
3: 9
4: 146
Right 932736901 2:74260619-74260641 CAGAAATCTAGGAGCAGCCTTGG 0: 1
1: 1
2: 3
3: 98
4: 1399
932736892_932736901 2 Left 932736892 2:74260594-74260616 CCCTCCCATCCACCAGCCCTTTA 0: 1
1: 0
2: 2
3: 28
4: 357
Right 932736901 2:74260619-74260641 CAGAAATCTAGGAGCAGCCTTGG 0: 1
1: 1
2: 3
3: 98
4: 1399
932736893_932736901 1 Left 932736893 2:74260595-74260617 CCTCCCATCCACCAGCCCTTTAG 0: 1
1: 0
2: 2
3: 22
4: 261
Right 932736901 2:74260619-74260641 CAGAAATCTAGGAGCAGCCTTGG 0: 1
1: 1
2: 3
3: 98
4: 1399
932736889_932736901 7 Left 932736889 2:74260589-74260611 CCCCTCCCTCCCATCCACCAGCC 0: 1
1: 0
2: 17
3: 160
4: 1567
Right 932736901 2:74260619-74260641 CAGAAATCTAGGAGCAGCCTTGG 0: 1
1: 1
2: 3
3: 98
4: 1399
932736896_932736901 -7 Left 932736896 2:74260603-74260625 CCACCAGCCCTTTAGACAGAAAT 0: 1
1: 0
2: 3
3: 6
4: 185
Right 932736901 2:74260619-74260641 CAGAAATCTAGGAGCAGCCTTGG 0: 1
1: 1
2: 3
3: 98
4: 1399
932736890_932736901 6 Left 932736890 2:74260590-74260612 CCCTCCCTCCCATCCACCAGCCC 0: 1
1: 1
2: 13
3: 245
4: 2374
Right 932736901 2:74260619-74260641 CAGAAATCTAGGAGCAGCCTTGG 0: 1
1: 1
2: 3
3: 98
4: 1399

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932736901 Original CRISPR CAGAAATCTAGGAGCAGCCT TGG Intronic
900194628 1:1369674-1369696 CAGGACTCCAAGAGCAGCCTGGG - Intergenic
900230724 1:1555787-1555809 CAGGAATCCAAGACCAGCCTGGG + Intronic
900343354 1:2199094-2199116 CAGAAAGCCAGGAGCAGCTGGGG + Intronic
900377577 1:2363546-2363568 CAGGAGTTTAAGAGCAGCCTGGG + Intronic
900982189 1:6052211-6052233 CAGAAGTCTGAGACCAGCCTAGG + Intronic
901057994 1:6457961-6457983 CAGAAGTCTGAGACCAGCCTGGG + Intronic
901375188 1:8833018-8833040 CAGCAGTCTAAGACCAGCCTGGG + Intergenic
901503843 1:9671652-9671674 CAGGAATTCAAGAGCAGCCTGGG - Intronic
901507700 1:9696178-9696200 CAGAAATTTGAGACCAGCCTGGG - Intronic
901547739 1:9971752-9971774 CAGTAGTCTGAGAGCAGCCTGGG + Intronic
901855197 1:12039876-12039898 CAGGAGTTTAAGAGCAGCCTGGG + Intergenic
901930268 1:12592625-12592647 CAGAAATGTGAGAGCAGCTTTGG + Intronic
902056274 1:13602968-13602990 CAGGAGTTTAAGAGCAGCCTGGG + Intronic
902325266 1:15696021-15696043 CAGAAGTTTCAGAGCAGCCTAGG - Intronic
902338386 1:15767099-15767121 CAGAAGTTCAAGAGCAGCCTGGG - Intronic
902342774 1:15795023-15795045 CAGAAGTTCAAGAGCAGCCTGGG - Intergenic
902384366 1:16068013-16068035 CAGAAACTGAGCAGCAGCCTGGG + Intronic
902762485 1:18591688-18591710 CAGAAATTTGAGACCAGCCTGGG - Intergenic
902909353 1:19583771-19583793 CAGGAATCCAAGACCAGCCTGGG - Intergenic
903411241 1:23145109-23145131 CAGAAATTTGAGACCAGCCTGGG - Intronic
903546551 1:24127519-24127541 CAGAAGTTTAAGACCAGCCTGGG - Intronic
903571189 1:24306816-24306838 CAGGAATCCAAGACCAGCCTGGG - Intergenic
903630765 1:24768183-24768205 CAGGAATTTGGGACCAGCCTGGG - Intronic
903785065 1:25855375-25855397 CAGGAATTTGGGACCAGCCTGGG - Intronic
903819205 1:26088311-26088333 CAAAAATTTAAGACCAGCCTGGG + Intergenic
903821668 1:26107831-26107853 CAGGAGTTTACGAGCAGCCTGGG + Intergenic
904069306 1:27780741-27780763 CAGAAATTTGAGACCAGCCTGGG + Intronic
904139213 1:28338769-28338791 CAGAAATTTTAGACCAGCCTGGG - Intergenic
904626050 1:31803522-31803544 CAGAAGTTTGAGAGCAGCCTGGG + Intronic
904633999 1:31865569-31865591 CAGAAGTTTAAGACCAGCCTGGG + Intergenic
904692563 1:32304769-32304791 CAGGAATTTAAGACCAGCCTGGG - Intronic
905077996 1:35291329-35291351 CAGAAATATGAGACCAGCCTAGG - Intronic
905126072 1:35717081-35717103 CAGAAAGCTGAGAGCATCCTGGG + Intronic
905158557 1:36010393-36010415 CAGGAATTTGGGACCAGCCTGGG + Intronic
905836277 1:41124802-41124824 CAGAAATTCAAGACCAGCCTGGG - Intronic
905930997 1:41787741-41787763 CAGAAGTCTGAGACCAGCCTAGG - Intronic
906016586 1:42587203-42587225 CAAAAGTTCAGGAGCAGCCTGGG - Intronic
906338991 1:44961467-44961489 CAGAAATTTGAGACCAGCCTGGG + Intronic
906387396 1:45382445-45382467 CAGAAATTTGAGACCAGCCTGGG - Intronic
906394792 1:45452841-45452863 CAGAAATTCAAGATCAGCCTGGG + Intronic
906456732 1:46003673-46003695 CAGAAATTTGGGACCAGCCTGGG - Intronic
907145679 1:52229070-52229092 CAGAAGTTCAAGAGCAGCCTGGG - Intronic
907254078 1:53165005-53165027 CAGAAGTTTAAGACCAGCCTAGG + Intergenic
907428058 1:54393579-54393601 CAGAAATTCAAGACCAGCCTAGG + Intronic
908285108 1:62588948-62588970 CAGGAATATAAGACCAGCCTGGG - Intronic
908378915 1:63575794-63575816 CAGGAATTTTAGAGCAGCCTGGG - Intronic
908394873 1:63716225-63716247 CAGGAATCTGAGACCAGCCTGGG + Intergenic
908545771 1:65160801-65160823 CAGAAATGCAAGACCAGCCTGGG - Intronic
908654675 1:66375634-66375656 CAGAAATCTGGGAGGAGGATGGG - Intergenic
908669111 1:66526182-66526204 GAGAAAGGTAGGAGGAGCCTTGG - Intergenic
908896449 1:68906232-68906254 CAGAAGTTTGAGAGCAGCCTGGG + Intergenic
909157202 1:72092858-72092880 CAGAAATTTGAGACCAGCCTGGG - Intronic
909426908 1:75535998-75536020 CAGGAATTTGTGAGCAGCCTGGG + Intronic
909663997 1:78113725-78113747 CAGAAGTTCAGGACCAGCCTGGG - Intronic
909669436 1:78171684-78171706 CAGAAATTCAAGACCAGCCTGGG - Intergenic
909851418 1:80469441-80469463 CAGAAGTTTGAGAGCAGCCTGGG + Intergenic
909982128 1:82115670-82115692 CAGAAAACTAGGAGTTGCCTGGG + Intergenic
910367430 1:86481345-86481367 CAGAAATTTGAGACCAGCCTGGG - Intronic
910970967 1:92855488-92855510 CAGAAGTTTAAGACCAGCCTAGG + Intronic
911008711 1:93255520-93255542 CAGAAATTCAAGACCAGCCTGGG + Intronic
911058297 1:93726279-93726301 CAGAAGTCTGAGACCAGCCTTGG - Intronic
911582162 1:99646249-99646271 CATAAATCAAGGAGCCTCCTGGG - Exonic
912305976 1:108567787-108567809 CAGAAATTCAAGAACAGCCTGGG + Intronic
912446197 1:109738910-109738932 CAGAAGTTCAGGATCAGCCTGGG + Intronic
912555300 1:110511774-110511796 CAGAAGTTTGAGAGCAGCCTGGG - Intergenic
912722400 1:112031097-112031119 CAGGAGTCTAAGACCAGCCTAGG + Intergenic
912792513 1:112666044-112666066 CAGAAGTTTAAGACCAGCCTGGG - Intronic
912907978 1:113727755-113727777 CAGAAATTCAAGACCAGCCTGGG + Intronic
913201167 1:116496162-116496184 CAGAAATTTGAGACCAGCCTGGG + Intergenic
913298981 1:117350676-117350698 CAGGAATTCAAGAGCAGCCTGGG - Intergenic
913523899 1:119672392-119672414 CACAAATTTGAGAGCAGCCTGGG - Intronic
913707641 1:121442770-121442792 CAGAAGTTTGAGAGCAGCCTGGG + Intergenic
913715706 1:121532089-121532111 CAGAAGTTCAAGAGCAGCCTGGG - Intergenic
913997504 1:143663514-143663536 CTGAAATTTAAGACCAGCCTGGG + Intergenic
914675037 1:149901753-149901775 CAGGAGTCTAAGACCAGCCTGGG - Intergenic
914890644 1:151619507-151619529 CAGGAATCTCAGACCAGCCTGGG - Intronic
915153625 1:153855976-153855998 AAGAAATGTAGGAGCTGACTGGG - Intronic
915244908 1:154549799-154549821 GAGAAATCTAGGGGCAGACCAGG + Exonic
915293661 1:154904149-154904171 CAGAAATTTGAGACCAGCCTGGG + Intergenic
915407221 1:155669817-155669839 CAGGAATTCAAGAGCAGCCTGGG + Intronic
915494998 1:156276022-156276044 CAGGAATTCAGGACCAGCCTGGG - Intronic
915501948 1:156325315-156325337 CAGAAATTCAAGATCAGCCTGGG + Intronic
915687896 1:157653724-157653746 CAGAATTTCAAGAGCAGCCTGGG - Intergenic
915867517 1:159519443-159519465 CAGGAATTTATGATCAGCCTGGG - Intergenic
916560943 1:165933767-165933789 AAGAAAGCGAGGAGCAGCCTAGG + Intergenic
917040822 1:170804245-170804267 CAGAAGTTTAAGACCAGCCTGGG + Intergenic
917358644 1:174153133-174153155 CAGAAGTTTAAGACCAGCCTGGG + Intergenic
917689566 1:177454268-177454290 CATAAATCTATGAAAAGCCTGGG - Intergenic
917783000 1:178419494-178419516 CAGGAATTTAAGACCAGCCTGGG - Intronic
918280345 1:182998198-182998220 CAGGAATTTAAGACCAGCCTGGG - Intergenic
918314556 1:183312302-183312324 CAGGAATTTGGGACCAGCCTGGG - Intronic
918320053 1:183355679-183355701 CAGAAATGTAGCCCCAGCCTGGG + Intronic
918498067 1:185161493-185161515 CAGGAGTCTAAGACCAGCCTAGG + Intronic
918540423 1:185626113-185626135 CAGGAATTTAAGACCAGCCTGGG + Intergenic
919491381 1:198210004-198210026 CAGAAGTTTAAGACCAGCCTGGG - Intronic
919883480 1:201916124-201916146 CAGAAGTTTAAGACCAGCCTGGG - Intronic
919890280 1:201967742-201967764 CAGGAGTTTAGGATCAGCCTGGG - Intronic
920507309 1:206525658-206525680 CAGAAATTTGGGACCAGCCTGGG - Intronic
920899360 1:210091478-210091500 CAGGAATTCAGGATCAGCCTGGG + Intronic
921230849 1:213068801-213068823 CAGGAATTTGAGAGCAGCCTGGG + Intronic
921891195 1:220355630-220355652 CAGGAATTTAAGACCAGCCTGGG + Intergenic
922159542 1:223068501-223068523 CAGAAATTTGAGACCAGCCTGGG + Intergenic
922166620 1:223120871-223120893 CAGAAGTTTAAGACCAGCCTGGG + Intronic
922204319 1:223433340-223433362 CAGAAGTTTGAGAGCAGCCTGGG - Intergenic
922281442 1:224128775-224128797 CAGGAATTTAAGACCAGCCTGGG + Intronic
922451228 1:225739044-225739066 CAGAAAGCCAGAAGCAGCTTGGG + Intergenic
922770612 1:228180865-228180887 CAGAAATTCAAGACCAGCCTGGG - Exonic
922802201 1:228369595-228369617 CAGGCATCTAGAATCAGCCTGGG - Intronic
922890898 1:229061409-229061431 CAGGAATCCAAGATCAGCCTGGG + Intergenic
923073605 1:230589310-230589332 CAGAAATCTTGGTGGAGCATAGG - Intergenic
923385986 1:233465725-233465747 CAGGAATTCAGGACCAGCCTGGG + Intergenic
923556308 1:235003352-235003374 CAGGAATCCAAGACCAGCCTTGG + Intergenic
923634792 1:235684835-235684857 CAGAAATTTGAGACCAGCCTGGG - Intronic
923716137 1:236426185-236426207 CAGGAGTTTAAGAGCAGCCTGGG - Intronic
923774021 1:236962122-236962144 CAGAAGTTTAAGAACAGCCTGGG + Intergenic
923988540 1:239408828-239408850 CAGGAGTTTAGGACCAGCCTGGG - Intronic
924213644 1:241796037-241796059 CAGAAATTTGAGACCAGCCTGGG + Intronic
924248575 1:242108482-242108504 CAGAAATCCAGGAGAAGCTGTGG - Intronic
924404193 1:243724992-243725014 CAGGAGTCCAGGACCAGCCTCGG + Intronic
924567630 1:245211604-245211626 CAGGAATTGAGGACCAGCCTGGG - Intronic
924599963 1:245480053-245480075 CAGGAGTTTAGGACCAGCCTGGG + Intronic
924717783 1:246593977-246593999 CAGAAATTCAAGATCAGCCTGGG - Intronic
1062816153 10:501934-501956 CAGGAGTCTAAGACCAGCCTGGG + Intronic
1062947656 10:1473588-1473610 CAGGAATTCAAGAGCAGCCTAGG - Intronic
1063118501 10:3087681-3087703 GAGGAAGATAGGAGCAGCCTGGG + Intronic
1063595053 10:7427495-7427517 CAGGAATTTAAGACCAGCCTAGG - Intergenic
1063801209 10:9580428-9580450 CAGGAATTTAAGACCAGCCTGGG + Intergenic
1063866730 10:10373395-10373417 CAGAAGTTTAAGACCAGCCTGGG - Intergenic
1064017040 10:11780845-11780867 CAGCAGTCTAAGACCAGCCTGGG + Intergenic
1064376914 10:14804852-14804874 CAGGAATTTAAGACCAGCCTAGG + Intergenic
1064433505 10:15291056-15291078 CAGAAGTCTGAGACCAGCCTGGG - Intronic
1064534539 10:16345225-16345247 CAGGAGTCTAGGAACAGCCTGGG - Intergenic
1064915820 10:20456917-20456939 CAGAAGTCCATGACCAGCCTGGG - Intergenic
1064994829 10:21287325-21287347 CAGGAGTCTGGGACCAGCCTGGG + Intergenic
1065084068 10:22156769-22156791 CAGAAATTTGAGACCAGCCTGGG - Intergenic
1065185327 10:23165289-23165311 CAGGACTTTAAGAGCAGCCTGGG - Intergenic
1065215415 10:23443707-23443729 CAGGAATTTAAGACCAGCCTAGG - Intergenic
1065220940 10:23495396-23495418 CAGGAATCTGAGACCAGCCTGGG - Intergenic
1065233431 10:23622148-23622170 CAGGAATCTGGGACCAACCTGGG - Intergenic
1065351461 10:24799309-24799331 CAGAATTCTGAGACCAGCCTGGG + Intergenic
1065485149 10:26229966-26229988 CAAAGATAAAGGAGCAGCCTGGG + Intronic
1065507941 10:26448249-26448271 CAGAAATGTGAGACCAGCCTGGG - Intronic
1065596329 10:27315880-27315902 CAGAAATTCAAGACCAGCCTGGG - Intergenic
1065701181 10:28426901-28426923 CAGAAGTTTGAGAGCAGCCTGGG + Intergenic
1065729600 10:28698963-28698985 CAGAAGTCCAAGACCAGCCTGGG - Intergenic
1065859437 10:29859218-29859240 CAGAAATTTGAGACCAGCCTGGG - Intergenic
1065925404 10:30430992-30431014 CAGAAATTTGAGACCAGCCTGGG + Intergenic
1065928638 10:30458864-30458886 CAGAAATTCAAGACCAGCCTGGG + Intronic
1065942348 10:30576270-30576292 CAGAAGTTTAAGACCAGCCTGGG - Intergenic
1066060991 10:31723417-31723439 CAGAAACGTAGAAGGAGCCTGGG + Intergenic
1066081586 10:31935842-31935864 CAGAAGTTCAAGAGCAGCCTGGG + Intergenic
1066144874 10:32547233-32547255 CAGGAATCCAAGACCAGCCTGGG - Intronic
1066356366 10:34688059-34688081 CAGAAGTTTGAGAGCAGCCTGGG - Intronic
1066384057 10:34927169-34927191 CAGGAATTTAAGACCAGCCTGGG - Intergenic
1066431854 10:35359547-35359569 CAGAAGTTTAAGATCAGCCTGGG - Intronic
1066559710 10:36656779-36656801 CAGGAATTTAAGACCAGCCTGGG + Intergenic
1067007992 10:42682710-42682732 CAGAAATTTGAGACCAGCCTGGG + Intergenic
1067126350 10:43519122-43519144 CAGGAGTCCAGGACCAGCCTGGG - Intergenic
1067987154 10:51162925-51162947 CAGAAATTTAAGAACAGCCTGGG - Intronic
1068490243 10:57714061-57714083 CAGAAATTTGAGACCAGCCTGGG + Intergenic
1068570395 10:58621602-58621624 CAGGAATCAAAGACCAGCCTGGG + Intronic
1068789159 10:61008640-61008662 CAGCAGTCTAGGATCAACCTGGG - Intergenic
1069475477 10:68728417-68728439 CAGAAATTTGAGACCAGCCTAGG - Intronic
1069524921 10:69161267-69161289 CAGGAGTCTAAGACCAGCCTAGG - Intronic
1069983788 10:72270353-72270375 CAGGAGTTTAGGACCAGCCTAGG - Intergenic
1070056943 10:72944763-72944785 CAGAAAGCTAGAAGCAGCCTGGG - Intronic
1070158366 10:73850519-73850541 CAGACATTTAGAAGCATCCTTGG - Intronic
1070194527 10:74144475-74144497 CAGGAGTCCAGGATCAGCCTGGG - Intronic
1071784856 10:88887728-88887750 CAGAAATTCAAGATCAGCCTGGG - Intronic
1072063616 10:91842563-91842585 CAGGAATTTGAGAGCAGCCTGGG + Intronic
1072073833 10:91948588-91948610 CAGGAATTTGGGACCAGCCTGGG - Intronic
1072148043 10:92660670-92660692 CAGGAATGTGAGAGCAGCCTGGG + Intergenic
1072166187 10:92815185-92815207 CAGAAAAGTAGAAGCAGTCTGGG + Intergenic
1072292999 10:93982806-93982828 CAGGAATTTGAGAGCAGCCTGGG - Intergenic
1072319834 10:94238210-94238232 CAGGAATTCAAGAGCAGCCTGGG + Intronic
1072428182 10:95347937-95347959 CAGGAATCTGAGACCAGCCTGGG - Intronic
1072432632 10:95386901-95386923 CAGAAACCCAAGACCAGCCTGGG + Intronic
1072448742 10:95521865-95521887 CAGCAATTCAGGACCAGCCTGGG - Intronic
1072490375 10:95899753-95899775 CAGAAGTTTAAGACCAGCCTGGG - Intronic
1072587115 10:96792415-96792437 CACAAATTTAAGACCAGCCTGGG - Intergenic
1072589094 10:96810930-96810952 CAGGAGTTTAAGAGCAGCCTAGG + Intergenic
1072953781 10:99871196-99871218 CAGGAATCTGAGACCAGCCTGGG - Intergenic
1073021262 10:100446153-100446175 CAGAAATTTGAGACCAGCCTGGG - Intergenic
1073231885 10:101978587-101978609 CAGAAATTTCAGACCAGCCTGGG + Intronic
1073270353 10:102257801-102257823 CAGGAATTTAAGACCAGCCTGGG - Intronic
1073507227 10:104007720-104007742 CAGAAGTTTAAGACCAGCCTAGG + Intronic
1073517434 10:104089191-104089213 CAGGAGTCTAAGAGTAGCCTGGG + Intergenic
1074016074 10:109535450-109535472 CAGGAATTCAGGACCAGCCTGGG + Intergenic
1074106068 10:110390545-110390567 CAGAAATTTGAGACCAGCCTGGG + Intergenic
1074456974 10:113603693-113603715 CTGAAGTGAAGGAGCAGCCTTGG - Intronic
1074774323 10:116755757-116755779 CAGGAATTCAGGACCAGCCTGGG + Intergenic
1074779765 10:116793360-116793382 CAGGAATTTAAGACCAGCCTAGG + Intergenic
1074908806 10:117888493-117888515 CAGGAATTCAAGAGCAGCCTGGG + Intergenic
1075171313 10:120118094-120118116 CAGGAATTTAAGACCAGCCTGGG - Intergenic
1075414356 10:122251131-122251153 CAGAAGTTTAAGACCAGCCTGGG - Intronic
1076708435 10:132316402-132316424 CAGAAGTCTACGACCAGCCTAGG + Intronic
1077571835 11:3346174-3346196 CAGGAATCTGAGACCAGCCTGGG - Intronic
1077605271 11:3606231-3606253 CAGAAATTCAGGACCAGCCTGGG + Intergenic
1077607747 11:3623408-3623430 CAGAAATTCAAGACCAGCCTGGG + Intergenic
1077974981 11:7238625-7238647 CAGAAATCCAGAAGCAGTTTAGG - Intergenic
1078171117 11:8929908-8929930 CAGAAATTCAAGACCAGCCTGGG + Intronic
1078227030 11:9401484-9401506 CAGCAGTTTAGGACCAGCCTGGG + Intronic
1078347708 11:10565706-10565728 CAGGAATTTACGACCAGCCTGGG - Intronic
1078357148 11:10641080-10641102 CAGAAATTTGAGACCAGCCTGGG - Intronic
1078381692 11:10848083-10848105 CAGAAATTCAAGACCAGCCTGGG - Intronic
1079067512 11:17309103-17309125 CAGAAATTCAAGACCAGCCTGGG + Intronic
1079161624 11:18000237-18000259 CAGAAATTCAAGACCAGCCTGGG + Intronic
1079185458 11:18232089-18232111 CAGGGATTTAAGAGCAGCCTAGG - Intronic
1079980420 11:27145605-27145627 CAGAAGTTTAAGACCAGCCTGGG - Intergenic
1080014473 11:27490108-27490130 CAGAAGTTGAGGACCAGCCTGGG - Intergenic
1080023358 11:27587663-27587685 CAGGAATTCAGGACCAGCCTGGG - Intergenic
1080366659 11:31581960-31581982 CAGAAATTTAAGACCAGCCTGGG - Intronic
1080389514 11:31831844-31831866 CAGAAATTCAAGATCAGCCTGGG - Intronic
1080467627 11:32512718-32512740 CAGAAATTTGAGAACAGCCTGGG - Intergenic
1080748982 11:35135473-35135495 CAGAATTCAATCAGCAGCCTTGG - Intergenic
1080973776 11:37309872-37309894 CAGGCATCTGAGAGCAGCCTGGG - Intergenic
1081154288 11:39669973-39669995 CAGGAGTTTAAGAGCAGCCTTGG - Intergenic
1081400888 11:42641450-42641472 CAGAAGTTTGAGAGCAGCCTGGG + Intergenic
1081881308 11:46455093-46455115 CAGAAGTTTAAGACCAGCCTGGG - Intronic
1082033463 11:47624590-47624612 TAGAAATTTAAGAACAGCCTGGG + Intronic
1082259792 11:50069960-50069982 CAAAAGTCTTGGAACAGCCTGGG + Intergenic
1082826896 11:57586609-57586631 CAGAAGTTTGAGAGCAGCCTGGG + Intergenic
1083169970 11:60917869-60917891 CAGGAGTTTGGGAGCAGCCTGGG - Intronic
1083368299 11:62156950-62156972 CAGAAGTCTGAGACCAGCCTGGG + Intergenic
1083595927 11:63918255-63918277 CCTAAATTTAGAAGCAGCCTAGG + Intergenic
1084280270 11:68085427-68085449 CAGGAATTCAAGAGCAGCCTGGG - Intronic
1084340005 11:68491556-68491578 CAGAAGTTCAGGACCAGCCTGGG - Intronic
1084539151 11:69775590-69775612 CAGAAGTGTAGGAGCCGCCAAGG - Intergenic
1084859900 11:72011499-72011521 CAGAATGCTTGGAGCAGCCAAGG - Intronic
1084896734 11:72277003-72277025 CAGAAATTCAAGATCAGCCTGGG - Intergenic
1084915444 11:72425749-72425771 CATAAGGCAAGGAGCAGCCTGGG - Intronic
1085006609 11:73097210-73097232 CAGAAGTTTAAGACCAGCCTGGG - Intronic
1085125145 11:73996259-73996281 CAGAAATTCAAGACCAGCCTAGG + Intergenic
1085132978 11:74057760-74057782 CAGAAATTCAAGACCAGCCTGGG + Intronic
1085290015 11:75391408-75391430 CAGGAGTTTGGGAGCAGCCTGGG + Intergenic
1085349466 11:75789357-75789379 CAGAAATTCAAGACCAGCCTGGG - Intronic
1085362975 11:75909137-75909159 CAGAAGTTAAAGAGCAGCCTTGG + Intronic
1085407572 11:76272518-76272540 CAGGAATTTAAGACCAGCCTGGG - Intergenic
1085581522 11:77655151-77655173 CAGGAATCTGAGACCAGCCTGGG - Intergenic
1085595438 11:77804626-77804648 CAGAAGTTTAAGACCAGCCTGGG + Intronic
1085912868 11:80849283-80849305 CAGAAATTTGAGACCAGCCTTGG + Intergenic
1086097136 11:83061757-83061779 CAGGAATTCAAGAGCAGCCTGGG - Intronic
1086128372 11:83373740-83373762 CAGGAATTTAAGACCAGCCTGGG + Intergenic
1086276047 11:85130400-85130422 CAGAGGTCTAGGAGGAGCCAAGG + Intronic
1086369376 11:86141233-86141255 CAGAAATCTAGGAGTTGCTTTGG + Intergenic
1087105601 11:94403806-94403828 CAGAAGTTCAGGAGCATCCTGGG - Intergenic
1087176486 11:95100703-95100725 CAGAAATTTGAGACCAGCCTGGG - Intronic
1087255765 11:95950720-95950742 CAGAAGTTTAAGACCAGCCTGGG + Intergenic
1087493303 11:98856145-98856167 CAGAAGTTAACGAGCAGCCTGGG - Intergenic
1087497233 11:98907248-98907270 CAGAAATGTAGAAGCAACTTTGG + Intergenic
1087796355 11:102458497-102458519 CAGGAGTTTAAGAGCAGCCTGGG + Intronic
1087817238 11:102673158-102673180 CAGAAATTTTGGACTAGCCTGGG - Intergenic
1088233435 11:107697498-107697520 CAGGAATTTAAGATCAGCCTGGG + Intergenic
1088412599 11:109551799-109551821 CAGAAATTCAAGACCAGCCTGGG + Intergenic
1089269206 11:117289930-117289952 GAGATATTTAGGAGCAGGCTGGG + Intronic
1089756902 11:120693998-120694020 TAGAAATCCAGGAGCTGCCTTGG + Intronic
1089834330 11:121356927-121356949 CAGGAGTCTGGGACCAGCCTGGG - Intergenic
1090011803 11:123051814-123051836 CAGGAATTCAAGAGCAGCCTGGG - Intergenic
1090255032 11:125278006-125278028 CAGAAATTTGAGACCAGCCTGGG + Intronic
1090274141 11:125407985-125408007 CAGAAGTCCAGAAGCAGCGTGGG - Intronic
1090283808 11:125481356-125481378 CAGTAATTTAAGACCAGCCTGGG - Intronic
1090775356 11:129959967-129959989 CAGGAGTTTAGGACCAGCCTGGG - Intronic
1091606335 12:1955063-1955085 CAGAAGTTTGAGAGCAGCCTGGG - Intronic
1092307570 12:7317234-7317256 CAGCACTCTCAGAGCAGCCTCGG + Exonic
1092338563 12:7655778-7655800 CAGAAATTTGAGACCAGCCTGGG + Intronic
1092451472 12:8606316-8606338 CAGAAAACTCAGAGAAGCCTCGG - Intronic
1092660716 12:10735081-10735103 AAGAAATTTGAGAGCAGCCTGGG + Intergenic
1092823882 12:12378961-12378983 CAGAAATTCAAGACCAGCCTGGG - Intronic
1093055554 12:14552690-14552712 CAGGAGTTTAGGACCAGCCTGGG + Intronic
1093452557 12:19332862-19332884 CAGGAATCTGAGACCAGCCTGGG - Intronic
1093732298 12:22579350-22579372 CAGAAATCTGACACCAGCCTGGG - Intergenic
1093853895 12:24075051-24075073 CAGAAATTCAAGACCAGCCTGGG + Intergenic
1094019593 12:25900111-25900133 CAAAAACCTAGATGCAGCCTGGG + Intergenic
1094086166 12:26594346-26594368 CAGACATGTAAGAGCACCCTTGG - Intronic
1094223468 12:28020145-28020167 CAGAAATTTAAAACCAGCCTTGG - Intergenic
1094708193 12:32935316-32935338 AAGAAACCCAGGAGAAGCCTGGG - Intergenic
1094767742 12:33617609-33617631 CAAAAATGTGGAAGCAGCCTTGG + Intergenic
1095540604 12:43304797-43304819 CAGGAATTTGAGAGCAGCCTGGG + Intergenic
1095707230 12:45250609-45250631 CAGAAATTTGAGACCAGCCTAGG - Intronic
1095724602 12:45437776-45437798 CAGAAATTTGAGACCAGCCTGGG - Intronic
1095744627 12:45643840-45643862 CAGGAATTTAAGACCAGCCTGGG + Intergenic
1096083104 12:48846171-48846193 CAGGAATTTAAGACCAGCCTGGG - Intronic
1096172421 12:49482995-49483017 CAGAAGTTCAAGAGCAGCCTGGG - Intronic
1096364917 12:51020879-51020901 CAGAAATTTGAGACCAGCCTGGG + Intronic
1096398632 12:51287028-51287050 CAGGAGTCTAAGATCAGCCTGGG - Intronic
1096556420 12:52406741-52406763 AAAAAGCCTAGGAGCAGCCTTGG - Intergenic
1096632819 12:52939888-52939910 CAGGAATTTAAGACCAGCCTGGG + Intronic
1096722895 12:53537275-53537297 CAGAAATTCAAGACCAGCCTGGG - Intronic
1096857197 12:54492518-54492540 CAGAATTTTAAGACCAGCCTGGG + Intergenic
1096942904 12:55367965-55367987 CAGAAGTTTAAGACCAGCCTTGG + Intergenic
1096996065 12:55839029-55839051 CAGGAATTTAAGACCAGCCTGGG + Intronic
1097932845 12:65208886-65208908 CAGAAATCTAGAAGGATACTAGG + Intronic
1098122908 12:67260965-67260987 CAGGAATTTAAGACCAGCCTGGG - Intergenic
1098285603 12:68904086-68904108 CAGGAGTTTAGGACCAGCCTGGG - Intronic
1098321321 12:69246870-69246892 CAGGAGTCTAAGACCAGCCTGGG - Intronic
1098823936 12:75269715-75269737 CAGGAGTCTGAGAGCAGCCTGGG - Intergenic
1098895620 12:76057090-76057112 CAGGAGTCTAAGACCAGCCTAGG + Intronic
1099124012 12:78729814-78729836 CAGAATTTTAAGACCAGCCTGGG - Intergenic
1099194376 12:79597847-79597869 CAGGAATTTAGAAGCAGCTTAGG + Intronic
1099374201 12:81877075-81877097 CAGGAATCTGAGACCAGCCTGGG - Intergenic
1099745736 12:86702251-86702273 CAGAAATTCAAGACCAGCCTGGG - Intronic
1099909218 12:88809318-88809340 CAGAAATTTGAGACCAGCCTGGG - Intergenic
1100300977 12:93307610-93307632 CAGGAATTTAAGACCAGCCTGGG + Intergenic
1100527898 12:95437256-95437278 CAGAAATTTGAGATCAGCCTGGG - Intergenic
1100800788 12:98228248-98228270 CAGAAATTTGAGATCAGCCTGGG - Intergenic
1101103558 12:101418789-101418811 CAGAAGTTTAAGACCAGCCTTGG - Intergenic
1101120029 12:101569726-101569748 CAGGAATTTAAGACCAGCCTGGG - Intronic
1101638248 12:106565596-106565618 CAGGAATTCAAGAGCAGCCTGGG + Intronic
1101724106 12:107375206-107375228 CAGAAATTTGAGACCAGCCTGGG + Intronic
1101861294 12:108484492-108484514 CAGGAATTTAAGACCAGCCTGGG + Intergenic
1101936962 12:109066041-109066063 CAGAAATTCAAGACCAGCCTGGG + Intronic
1101946861 12:109143956-109143978 CAGAAGTTTGAGAGCAGCCTGGG + Intronic
1101956387 12:109216005-109216027 CAGAAGTTCAAGAGCAGCCTGGG - Intronic
1102004166 12:109578304-109578326 CAGGAATTTGGGACCAGCCTGGG - Intronic
1102154126 12:110710821-110710843 CAGAAATTCAAGACCAGCCTCGG + Intergenic
1102356626 12:112242402-112242424 CAGAAATTTGAGACCAGCCTGGG + Intronic
1102592996 12:113971351-113971373 CAGAAATTTGAGACCAGCCTGGG - Intergenic
1102659896 12:114517015-114517037 CACACAGCTGGGAGCAGCCTTGG - Intergenic
1102666958 12:114582444-114582466 CAGAAGTTTAAGACCAGCCTGGG + Intergenic
1102684517 12:114714305-114714327 CAGGAATTTGGGACCAGCCTGGG - Intergenic
1102685779 12:114723482-114723504 CAGGAATTTAAGACCAGCCTGGG - Intergenic
1102958155 12:117072984-117073006 CAGAAGTTAATGAGCAGCCTGGG - Intronic
1103266433 12:119634397-119634419 CAGGAGTTTAGGACCAGCCTGGG + Intronic
1103464031 12:121127826-121127848 CAGAAGTTTGGGACCAGCCTGGG - Intergenic
1103815987 12:123656875-123656897 CAGAAGTTTAAGACCAGCCTGGG + Intronic
1104002332 12:124868104-124868126 CAGAATTTTGAGAGCAGCCTGGG - Intronic
1104206965 12:126648406-126648428 GAGAAATATAGCAGCAGCCTGGG - Intergenic
1104693764 12:130847806-130847828 CAGGAATTCAGGACCAGCCTAGG - Intergenic
1104696647 12:130869238-130869260 CAGGAGTTTAGGACCAGCCTGGG - Intergenic
1104825372 12:131704261-131704283 CAGAAGTCCAAGACCAGCCTGGG + Intergenic
1104867411 12:131966179-131966201 CAGAAATTTAAGACCAACCTGGG + Intronic
1105321313 13:19324789-19324811 CAGAAAACCAGAAGCAGCTTTGG - Intergenic
1105321319 13:19324836-19324858 CAGAAAACCAGAAGCAGCTTTGG - Intergenic
1105365504 13:19760643-19760665 CAGAAATTCAAGATCAGCCTGGG + Intronic
1105421816 13:20259201-20259223 CAGGAATTTGAGAGCAGCCTGGG - Intergenic
1105758546 13:23492254-23492276 CAGGAGTCTGGGATCAGCCTGGG + Intergenic
1105862005 13:24424016-24424038 CAGAAGTTTAAGACCAGCCTAGG - Intronic
1106047857 13:26161924-26161946 TAGAAATCTAGGAGTTGACTTGG - Intronic
1106151891 13:27112493-27112515 CAGAAATCTGAGACCAGCCTGGG - Intronic
1106181446 13:27372900-27372922 CAGAAATAGAGGAGCAGTCCAGG - Intergenic
1106304929 13:28501010-28501032 CAGGAATCCAAGACCAGCCTGGG + Intergenic
1106323892 13:28669586-28669608 CAGGAGTTTAGGACCAGCCTAGG - Intronic
1106387160 13:29298949-29298971 CAGCAATCTAGACTCAGCCTTGG - Intronic
1106726087 13:32487263-32487285 CAGAAGTTTAAGACCAGCCTGGG + Intronic
1106936703 13:34730239-34730261 CAGAAGTTTAAGACCAGCCTGGG + Intergenic
1106969512 13:35121313-35121335 CAGAAGTTCAAGAGCAGCCTGGG - Intronic
1107065540 13:36210917-36210939 CAGCACTTTAGGAGCAGCATGGG + Intronic
1107505644 13:41030532-41030554 CAGAAGTTTAAGACCAGCCTGGG + Intronic
1107537057 13:41345780-41345802 CAGGAATTTAAGACCAGCCTGGG - Intronic
1107850731 13:44570398-44570420 CAGAAATTTGAGACCAGCCTGGG - Intronic
1108021598 13:46133415-46133437 CAGGAATTTAAGACCAGCCTGGG + Intronic
1108261486 13:48661158-48661180 CAGGAATTCAAGAGCAGCCTGGG - Intronic
1108297840 13:49042565-49042587 CAGAAATTTAAGACCAGCCTAGG + Intronic
1108364636 13:49697611-49697633 CAGGAGTTTGGGAGCAGCCTGGG - Intergenic
1108399376 13:50023859-50023881 CAGAAGTTTAAGACCAGCCTGGG - Intergenic
1108704982 13:52977071-52977093 CAGCAATCAAGGAGCAGCTAGGG + Intergenic
1109072696 13:57788763-57788785 CAGAAGTCTGAGACCAGCCTGGG - Intergenic
1109548826 13:63865208-63865230 CAGAAATCTAAGACCAGCGTAGG - Intergenic
1110659599 13:78044469-78044491 CAGAAATTGTGGAGCAGCCATGG - Intergenic
1110956412 13:81558499-81558521 CAGAAATTTGGGTTCAGCCTCGG + Intergenic
1111001653 13:82192340-82192362 CAGGAATTTGAGAGCAGCCTGGG + Intergenic
1111209187 13:85053833-85053855 CAGAAATTCAAGAACAGCCTGGG - Intergenic
1111975323 13:94961448-94961470 CAGAAATCTAGGAGCAGCTTGGG + Intergenic
1112115765 13:96351518-96351540 CAGGAATTCAAGAGCAGCCTGGG - Intronic
1112125002 13:96455434-96455456 CAGGAATTTAAGACCAGCCTGGG - Intronic
1112811501 13:103223938-103223960 CAGAATTCTCGGAACAGACTGGG - Intergenic
1113193379 13:107776880-107776902 CAGGAATTTAAGACCAGCCTGGG + Intronic
1113465833 13:110512398-110512420 CAGAAAGCCAGGAGCAGCCCTGG + Exonic
1114327007 14:21599705-21599727 CAGGAATTCAGGACCAGCCTAGG - Intergenic
1114472009 14:22969691-22969713 CAGAAATTCAAGACCAGCCTGGG + Intronic
1114552363 14:23540197-23540219 CAGGAATCTGAGACCAGCCTGGG - Intronic
1115106604 14:29769358-29769380 CAGGAATTTAAGACCAGCCTGGG + Intronic
1115220505 14:31053642-31053664 CAGAAGTTTAAGACCAGCCTGGG - Intronic
1115225109 14:31094389-31094411 CAGAAATTCAAGACCAGCCTGGG + Intronic
1115226666 14:31110209-31110231 CAGAAATTCAAGACCAGCCTGGG - Intronic
1115254226 14:31381472-31381494 CAGAAATTCAAGACCAGCCTAGG + Intronic
1115256190 14:31405013-31405035 CAGGAATTTGAGAGCAGCCTAGG + Intronic
1115599031 14:34937934-34937956 CAGAAATTTGAGACCAGCCTTGG + Intergenic
1115644735 14:35361037-35361059 CAGGAATTTAAGACCAGCCTGGG + Intergenic
1115653254 14:35418914-35418936 CAGGAATCTGAGACCAGCCTGGG + Intergenic
1115658996 14:35472784-35472806 CAGGAATTCAAGAGCAGCCTGGG + Intergenic
1116203799 14:41834869-41834891 CAGAAGTGCAAGAGCAGCCTGGG - Intronic
1116468848 14:45264383-45264405 CAGAAGTCTGAGACCAGCCTGGG - Intergenic
1116787513 14:49303843-49303865 ATGAAATCTGGGAGCAGCTTTGG - Intergenic
1116813877 14:49566050-49566072 CAGAAATTTAAGACCAGCCTGGG + Intergenic
1116876500 14:50116963-50116985 CAAAAAACTAGGAGCATACTAGG - Intergenic
1117357270 14:54936397-54936419 CAGAAATTCGAGAGCAGCCTAGG - Intergenic
1117404289 14:55386858-55386880 CAGATATCTAGGAGTTGCTTAGG + Intronic
1117949825 14:61071471-61071493 CAGAAATTCAAGACCAGCCTGGG + Intronic
1117990895 14:61432541-61432563 CAGAAGTTTAAGACCAGCCTGGG - Intronic
1118052046 14:62039998-62040020 CAGTAATCTAGCAGCAATCTTGG + Intronic
1118300530 14:64611604-64611626 CAGCAGCCTAGGAGCAGACTTGG + Intergenic
1118358988 14:65039978-65040000 CAGAAATTTAAGACCAGCCTGGG + Intronic
1118577686 14:67259699-67259721 CAGGAATTTAAGACCAGCCTGGG + Intronic
1118613790 14:67561657-67561679 CAGGAATTTGGGACCAGCCTGGG + Intronic
1118806170 14:69238841-69238863 CAGGAATCTGAGACCAGCCTGGG - Intronic
1118860000 14:69655586-69655608 CAGAAGTTTGAGAGCAGCCTGGG + Intronic
1119058235 14:71446055-71446077 CAGAAGTCCAAGATCAGCCTGGG - Intronic
1119067613 14:71545890-71545912 CAGAAATTTAAGACCAGCCTGGG + Intronic
1119216170 14:72870864-72870886 CAGGAGTCCAGGACCAGCCTGGG + Intronic
1119346630 14:73930369-73930391 CAGAAATTTGAGATCAGCCTGGG - Intronic
1119490693 14:75029936-75029958 CAGAAGTTCAGGACCAGCCTGGG + Intronic
1119901853 14:78267481-78267503 CAGGAATTTAAGAACAGCCTGGG + Intronic
1120123726 14:80715012-80715034 CAGCAGTCTGGGACCAGCCTGGG + Intronic
1120393303 14:83935855-83935877 CAGGAGTCTGGGACCAGCCTGGG + Intergenic
1120814795 14:88844758-88844780 CAGAAATTCAAGACCAGCCTGGG - Intronic
1120825398 14:88950341-88950363 CAGAAATTTAAGACCAGCCTGGG + Intergenic
1120928431 14:89821661-89821683 CAGAAAGCTAGGACCATCCCAGG - Intronic
1121550739 14:94797777-94797799 CAGAAATTCAAGACCAGCCTGGG + Intergenic
1121757461 14:96414961-96414983 CAGAAATTTGAGACCAGCCTGGG - Intronic
1121910030 14:97781790-97781812 CAGAAAGCTAGCAGCACCCCAGG + Intergenic
1122444174 14:101757254-101757276 CAGAAGTTCAAGAGCAGCCTGGG - Intergenic
1122515597 14:102306197-102306219 CAGAAATTCAAGACCAGCCTGGG + Intergenic
1122524611 14:102372157-102372179 CAGAAATTTGAGACCAGCCTGGG - Intronic
1122563367 14:102633015-102633037 CAGGAGTCTAAGATCAGCCTGGG - Intronic
1122588743 14:102829919-102829941 CAGGAATCTAAGACCAGCCTGGG + Intronic
1122996061 14:105265251-105265273 CAGGAGTTTAGGACCAGCCTAGG - Intronic
1123392006 15:19885768-19885790 CAGAAGTTCAGGACCAGCCTGGG - Intergenic
1123483494 15:20659410-20659432 CAGAAGTTCAAGAGCAGCCTGGG + Intergenic
1123974963 15:25544440-25544462 CAGGAATTTGAGAGCAGCCTGGG + Intergenic
1124351607 15:28959933-28959955 CAGGAATTTGAGAGCAGCCTGGG + Intronic
1124601784 15:31138647-31138669 CAGAAGTTCAAGAGCAGCCTGGG + Intronic
1124876848 15:33602943-33602965 CAGGAGTCTGGGATCAGCCTGGG - Intronic
1125120455 15:36152327-36152349 CAGGAATTTAAGACCAGCCTGGG + Intergenic
1125218830 15:37309528-37309550 CAGGAATTTAAGATCAGCCTGGG + Intergenic
1125650622 15:41314591-41314613 CAGAAATTTGAGACCAGCCTGGG + Intronic
1125873647 15:43124920-43124942 CAGGAATTTAAGACCAGCCTGGG - Intronic
1126056534 15:44735170-44735192 CAGAAATTTGAGATCAGCCTAGG + Intronic
1126253384 15:46595290-46595312 CAGGAATTTAAGATCAGCCTTGG + Intergenic
1126352069 15:47754181-47754203 CAGAAATTTGAGACCAGCCTAGG + Intronic
1126749461 15:51861849-51861871 CAGGAGTTTAAGAGCAGCCTGGG - Intronic
1126842025 15:52726757-52726779 CAGGAATTTAGGACCAGCCTGGG - Intergenic
1126937407 15:53726631-53726653 CAGAAATTCAAGACCAGCCTGGG + Intronic
1126968942 15:54088167-54088189 CAAAAATGTAGAAGCAGCCATGG + Intronic
1127108100 15:55639181-55639203 CAGAAGTTTAAGATCAGCCTGGG - Intronic
1127421324 15:58809000-58809022 CAGAAATTCAGGACCAGCCTGGG + Intronic
1127494496 15:59497150-59497172 AAGAAATTTAGGATCAGGCTAGG + Intronic
1127517543 15:59710731-59710753 CAGGAGTCTAAGACCAGCCTGGG + Intergenic
1127785156 15:62349252-62349274 CAGAAATCTGAGACCAGCCTGGG - Intergenic
1128006989 15:64252416-64252438 CAGGAATTTGGGACCAGCCTAGG - Intronic
1128242003 15:66107617-66107639 CAGAATTCTGGGAGAAGCTTTGG + Intronic
1128303976 15:66586146-66586168 CAGAAGTTTAAGACCAGCCTGGG - Intronic
1128489208 15:68129274-68129296 CAGGAATTTGAGAGCAGCCTGGG - Intronic
1128625505 15:69198381-69198403 CAGGAATCCAGGAACAGCATAGG + Intronic
1129044799 15:72725275-72725297 CAGAAGTTTAAGACCAGCCTGGG - Intronic
1129098080 15:73230798-73230820 CAGAAATTTAAGACCAGCCTGGG - Intronic
1129231251 15:74198317-74198339 CAGAAATCCAAGACCAGCCTGGG - Intronic
1129293011 15:74582983-74583005 CAGAAGTTCAAGAGCAGCCTGGG + Intronic
1129561530 15:76576151-76576173 CAGGAATCTGAGATCAGCCTGGG + Intronic
1129774663 15:78228619-78228641 CAGAAGTCTAGGACCAGGGTTGG + Intronic
1129786781 15:78314923-78314945 CAGAAGTCCAAGACCAGCCTGGG - Intergenic
1129794616 15:78366685-78366707 CAGGAATATGGGACCAGCCTGGG - Intergenic
1129853341 15:78808062-78808084 CAGAAATTCAAGACCAGCCTGGG - Intronic
1129909648 15:79215465-79215487 CAGAAGTTGAAGAGCAGCCTGGG - Intergenic
1130110110 15:80957031-80957053 CAGGAATTTGAGAGCAGCCTGGG - Intronic
1130396281 15:83504758-83504780 CAGGAATCCAGGAGCAGCTTAGG - Intronic
1130437370 15:83914529-83914551 CAGTAGTTTAGGGGCAGCCTGGG - Intronic
1130936333 15:88473966-88473988 CAGGAATTTAAGACCAGCCTGGG + Intronic
1130976641 15:88781577-88781599 CAGAAATTCAAGATCAGCCTGGG + Intergenic
1130982074 15:88819552-88819574 CAGAAGTCTGAGAGCAGCCTGGG + Intronic
1131068486 15:89449220-89449242 CAAAAGTGTAGGAGCCGCCTGGG + Intergenic
1131466511 15:92659708-92659730 CAGGAATCCAAGACCAGCCTGGG - Intronic
1131548702 15:93338054-93338076 CAGGAATTTAAGATCAGCCTAGG - Intergenic
1132140914 15:99394175-99394197 CAGAAGTTTAAGACCAGCCTGGG + Intergenic
1132227780 15:100156243-100156265 CAGATATCTATGAGCAAACTAGG - Intronic
1132256134 15:100378039-100378061 CAGAAATTCAAGACCAGCCTGGG + Intergenic
1132301235 15:100777051-100777073 CAGGAGTTTGGGAGCAGCCTGGG + Intergenic
1132885964 16:2182073-2182095 CAGAAATGTAGGCAGAGCCTCGG + Intronic
1133476100 16:6123694-6123716 CAGAAGTCCAAGACCAGCCTGGG + Intronic
1133679868 16:8110819-8110841 CAGGAATTTAAGACCAGCCTGGG + Intergenic
1133689359 16:8198464-8198486 CAGAGATTTGGGTGCAGCCTGGG - Intergenic
1133787473 16:8984562-8984584 CAGGAATTTGGGACCAGCCTGGG + Intergenic
1134140061 16:11710639-11710661 CAGGAATTCAAGAGCAGCCTAGG + Intronic
1134240836 16:12505059-12505081 CAGGAATTTAAGACCAGCCTGGG + Intronic
1134272689 16:12747219-12747241 CAGGAATATAAGACCAGCCTGGG + Intronic
1134342974 16:13362153-13362175 CAGGAATTTAAGATCAGCCTGGG + Intergenic
1134461594 16:14434338-14434360 CAGAAGTTCAAGAGCAGCCTGGG - Intergenic
1134484307 16:14645103-14645125 CAGGAATTTAGAAGCATCCTGGG + Intronic
1134488855 16:14680568-14680590 CAGAAATTTGAGACCAGCCTGGG - Intronic
1134586617 16:15417042-15417064 CAGGAATGTAAGACCAGCCTGGG - Intronic
1134651066 16:15909189-15909211 CAGAAGTTTGGGACCAGCCTGGG - Intergenic
1135119021 16:19749549-19749571 CAGGAATTTAAGACCAGCCTTGG + Intronic
1135409462 16:22222415-22222437 CAGAAGTTTAAGACCAGCCTGGG - Intronic
1135459920 16:22633302-22633324 CAGGAGTTTAGGACCAGCCTGGG - Intergenic
1135518529 16:23155835-23155857 CAGAGATTTAAGACCAGCCTGGG + Intergenic
1135592614 16:23715055-23715077 CAGAAGTTCAAGAGCAGCCTGGG + Intergenic
1135734291 16:24918443-24918465 CAGAATTGTAAGACCAGCCTGGG + Intergenic
1135750327 16:25053502-25053524 CAGGAATGTAGGTCCAGCCTGGG - Intergenic
1136157401 16:28392388-28392410 CAGGAATCCAAGACCAGCCTGGG + Intronic
1136179054 16:28538479-28538501 CAGGAATTTGGGATCAGCCTGGG + Intronic
1136205686 16:28722896-28722918 CAGGAATCCAAGACCAGCCTGGG - Intronic
1136469595 16:30470787-30470809 CAGAAATTCAAGACCAGCCTGGG + Intergenic
1137435512 16:48451476-48451498 CAGAAGTCTGAGACCAGCCTGGG + Intergenic
1137456573 16:48622506-48622528 CAGAAATTTGAGAGCAACCTGGG - Intergenic
1137625105 16:49902758-49902780 CAGAAATTTGTGATCAGCCTGGG + Intergenic
1137763884 16:50962811-50962833 CCAGAATCTAGGAGGAGCCTTGG + Intergenic
1138003672 16:53309674-53309696 CAGGAGTTTAGGACCAGCCTAGG - Intronic
1138159512 16:54740282-54740304 CAGGAATCCAAGACCAGCCTGGG + Intergenic
1138198801 16:55073899-55073921 CAGAAATTTCAGACCAGCCTGGG + Intergenic
1138374461 16:56553276-56553298 CAGGAGTCTAAGACCAGCCTGGG - Intergenic
1138443858 16:57051065-57051087 CAGGAGTCTGGGACCAGCCTGGG - Intronic
1138448703 16:57080124-57080146 TAGAATTCTAGGACTAGCCTGGG + Intronic
1138464714 16:57180844-57180866 CAGGAATTTAAGACCAGCCTGGG + Intronic
1138676991 16:58658630-58658652 CAGGAATCCAAGATCAGCCTGGG + Intergenic
1139443070 16:66978732-66978754 CAGGAATTTAAGACCAGCCTGGG + Intergenic
1139443508 16:66981536-66981558 CAGAAGTTTAAGACCAGCCTGGG - Intergenic
1139460589 16:67118982-67119004 CAGGAATTTAAGACCAGCCTGGG - Intronic
1139553992 16:67694506-67694528 CAGGAATTTAAGACCAGCCTGGG - Intronic
1139705134 16:68736228-68736250 CAGAAATTTGAGATCAGCCTCGG + Intergenic
1139764540 16:69216022-69216044 CAGAAGTTCAGGACCAGCCTGGG - Intronic
1139778884 16:69334636-69334658 GGGAAATCTAGGAGCACCATGGG + Exonic
1139822486 16:69731487-69731509 CAGAAATTTGAGACCAGCCTGGG + Intergenic
1139826966 16:69764993-69765015 CAGGAATTTGGGACCAGCCTGGG + Intronic
1139936583 16:70576007-70576029 CAGAAGTTTAAGACCAGCCTAGG + Exonic
1140077765 16:71718099-71718121 CAGAAATTCAAGACCAGCCTGGG - Intronic
1140091633 16:71844256-71844278 CAGGAGTCTAAGACCAGCCTGGG + Intergenic
1140138043 16:72225479-72225501 CAGAAATTCAAGACCAGCCTGGG + Intergenic
1140337163 16:74118498-74118520 CAGGAGTCTAAGACCAGCCTGGG + Intergenic
1140576668 16:76178564-76178586 CAGGAATTTGGGACCAGCCTGGG + Intergenic
1140681448 16:77389089-77389111 CAGGAGTCTGAGAGCAGCCTGGG + Intronic
1140749777 16:78012653-78012675 CAGAAATTCAAGACCAGCCTGGG - Intergenic
1141106037 16:81234598-81234620 CAGAAGTCTGAGACCAGCCTGGG - Intergenic
1141581369 16:85001782-85001804 CAGGAATTCAAGAGCAGCCTGGG - Intronic
1142379922 16:89725853-89725875 CAGAAATTCAAGACCAGCCTGGG - Intronic
1142517824 17:444298-444320 CAGGAGTTTAGGACCAGCCTGGG - Intronic
1142706371 17:1697525-1697547 CAGAAATTTGAGACCAGCCTGGG - Intergenic
1142727568 17:1827725-1827747 CAGAAATTTGAGACCAGCCTGGG + Intronic
1142796326 17:2310422-2310444 CAGGAATTTAAGACCAGCCTGGG - Intronic
1142841608 17:2635890-2635912 CAGAAATTTGAGACCAGCCTGGG + Intronic
1143151317 17:4808900-4808922 CAGGAATTTAAGACCAGCCTGGG - Intronic
1143384254 17:6517766-6517788 CAGGAATTTGGGACCAGCCTGGG - Intronic
1143411793 17:6713574-6713596 CAGCCCTCTAGGGGCAGCCTGGG + Intergenic
1143501365 17:7341448-7341470 CAGGAATTCAAGAGCAGCCTGGG - Intronic
1143713395 17:8749605-8749627 CAGAAGTTCAAGAGCAGCCTGGG - Intergenic
1144343301 17:14328789-14328811 CAGAAGTTTAAGACCAGCCTGGG + Intronic
1144508175 17:15851402-15851424 CCAAGATCTAGGATCAGCCTTGG + Intergenic
1144595324 17:16565145-16565167 CAGAAGTTTAAGACCAGCCTGGG + Intronic
1144694903 17:17296325-17296347 CAGGAGTTTAAGAGCAGCCTGGG - Intergenic
1144822614 17:18086054-18086076 CAGGAGTTCAGGAGCAGCCTGGG + Intergenic
1145172296 17:20669036-20669058 CCAAGATCTAGGATCAGCCTTGG + Intergenic
1145184302 17:20780808-20780830 CAGGAATTTAGGACCAGCCAGGG - Intergenic
1145848282 17:28064355-28064377 CAGAAGTCTGAGAGCAGCCTGGG - Intronic
1146035655 17:29404368-29404390 CAGCAATCCAAGACCAGCCTGGG - Intronic
1146089834 17:29865803-29865825 CAGAAATGAGGGAGCAGGCTGGG + Intronic
1146171570 17:30638340-30638362 CAGGAATTTAAGACCAGCCTGGG - Intergenic
1146208537 17:30924162-30924184 CAGAAGTTCAAGAGCAGCCTGGG + Intronic
1146345031 17:32054355-32054377 CAGGAATTTAAGACCAGCCTGGG - Intergenic
1146410181 17:32576886-32576908 CAGAAGTTCAAGAGCAGCCTGGG - Intronic
1146466071 17:33087765-33087787 CAGAAATTCAAGACCAGCCTGGG - Intronic
1146645088 17:34571934-34571956 CAGTAAGCTAGGACCACCCTGGG - Intergenic
1146746942 17:35339594-35339616 CAGGAATCTGAGACCAGCCTGGG - Intergenic
1146911681 17:36652384-36652406 CAGAAATTCAAGAGCAGCCTGGG - Intergenic
1147150895 17:38513021-38513043 CAGGAATTTAAGACCAGCCTGGG + Intergenic
1147200387 17:38797868-38797890 CAGACCTCTAGGAGCTGCTTCGG - Intronic
1147223064 17:38951400-38951422 CAGAAGTTCAAGAGCAGCCTAGG - Intronic
1147270355 17:39265729-39265751 CAGGAATTCAAGAGCAGCCTGGG - Intronic
1147298986 17:39508784-39508806 CAGGAATTTAAGACCAGCCTAGG + Intronic
1147356594 17:39903187-39903209 CAGAAATTCAAGACCAGCCTGGG + Intergenic
1147568905 17:41555051-41555073 CAGAAATTTGAGATCAGCCTGGG - Intergenic
1147651638 17:42065735-42065757 CAGAAGTTTAAGACCAGCCTGGG - Intergenic
1147777460 17:42912676-42912698 CAGGAATTCAAGAGCAGCCTGGG - Exonic
1147814507 17:43199281-43199303 CAGAAGTTTGGGACCAGCCTGGG - Intronic
1148132772 17:45272111-45272133 CAGGAATTTAAGACCAGCCTGGG + Intronic
1148155308 17:45421268-45421290 CAGAAATTTAAGACCAGCCTGGG + Intronic
1148371662 17:47104246-47104268 CACAAATGTGGGAGCAGCATGGG + Intergenic
1148940109 17:51200937-51200959 CAGGAATCTGAGACCAGCCTGGG + Intronic
1148984410 17:51609342-51609364 CAGAAGTTTAAGACCAGCCTGGG + Intergenic
1149063208 17:52448671-52448693 CCGAGATCTAGGGGCAGCCAAGG - Intergenic
1149936477 17:60811837-60811859 CAGAAGTTCAAGAGCAGCCTGGG + Intronic
1150206131 17:63409392-63409414 CAGAAATCTGAGACCAGCCTGGG - Intronic
1150386995 17:64769921-64769943 CAGAAATTTAAGATCAGCCTAGG + Intergenic
1150423699 17:65059643-65059665 CAGGAGTTTAAGAGCAGCCTGGG + Intergenic
1150426263 17:65079403-65079425 CAGGAATTTAAGACCAGCCTGGG + Intergenic
1150699688 17:67436207-67436229 CAGGAATTTAAGACCAGCCTGGG - Intronic
1150828237 17:68495332-68495354 CAGGAACCTAGAAGAAGCCTGGG - Intergenic
1151285051 17:73104751-73104773 CAGGAATTTGGGACCAGCCTGGG + Intergenic
1151463398 17:74269064-74269086 CAGGAATTTGGGACCAGCCTGGG + Intergenic
1151467788 17:74298830-74298852 CAGGAATCCAAGAGCAGCTTGGG - Intronic
1151482337 17:74377734-74377756 CAGAAATTCAGGAGCAGCCTGGG - Intergenic
1151618577 17:75231135-75231157 CAGGAATTTAAGACCAGCCTGGG - Intronic
1151634382 17:75334729-75334751 CAGGAGTTTAGGACCAGCCTGGG + Intronic
1151991577 17:77578428-77578450 CAGAAATTTGAGACCAGCCTGGG - Intergenic
1152153363 17:78616754-78616776 CAGGAGTCTAAGACCAGCCTGGG - Intergenic
1152156963 17:78640713-78640735 CAGGAATTTAAGACCAGCCTGGG + Intergenic
1152182086 17:78828794-78828816 CAGGAATTTAAGACCAGCCTGGG + Intronic
1152428481 17:80233037-80233059 CAGGAGTCTAAGACCAGCCTGGG + Intronic
1152691784 17:81721416-81721438 CAGAAGTTTGGGACCAGCCTGGG - Intergenic
1152973250 18:186246-186268 CAGAAGTTTAAGACCAGCCTGGG + Intronic
1153002734 18:470536-470558 CAGGAATTTAAGACCAGCCTGGG + Intronic
1153012301 18:549960-549982 CAGGAGTTTAAGAGCAGCCTGGG - Intergenic
1153036035 18:763484-763506 TAGAAATTTGAGAGCAGCCTGGG + Intronic
1153042628 18:828309-828331 CAGGAGTCTAAGACCAGCCTGGG - Intergenic
1153630038 18:7060945-7060967 CAGAAATTTGAGACCAGCCTGGG + Intronic
1153843468 18:9027721-9027743 CAGGAATTCAGGATCAGCCTGGG + Intergenic
1153868607 18:9296531-9296553 CAGAAATTTGAGACCAGCCTGGG + Intergenic
1154349827 18:13573600-13573622 TAGAAATCTAGGAGCATGCTGGG + Intronic
1154369893 18:13750589-13750611 CAGAAATTTAAGACCAGCCTGGG + Intronic
1154468082 18:14669232-14669254 CAGAAATTTGAGACCAGCCTGGG - Intergenic
1154528654 18:15318704-15318726 CAGAAATTCAAGACCAGCCTGGG + Intergenic
1154992045 18:21606679-21606701 CAGAAGTCCAAGACCAGCCTGGG - Intergenic
1155000560 18:21681913-21681935 CAGGAGTTTAAGAGCAGCCTGGG + Intronic
1155172203 18:23275348-23275370 AATAATTCTAGGTGCAGCCTTGG + Intronic
1155352476 18:24919983-24920005 CAGGAATTCAGGACCAGCCTGGG + Intergenic
1157233848 18:45944544-45944566 CAGGAGTCCAAGAGCAGCCTGGG + Intronic
1157237252 18:45976318-45976340 CAGAAGTCCAAGACCAGCCTGGG + Intergenic
1157295699 18:46441199-46441221 CAGAAGTAGAGGATCAGCCTAGG - Intronic
1157300972 18:46478904-46478926 CAGAAATTTAAGATTAGCCTGGG - Intronic
1157415100 18:47495811-47495833 CAGGAGTCTAAGACCAGCCTGGG + Intergenic
1157467251 18:47957918-47957940 CAGAAAGATAGAAGCTGCCTGGG - Intergenic
1157646256 18:49275666-49275688 CAGAAGTTTAAGACCAGCCTGGG + Intronic
1157657725 18:49408019-49408041 CAGGAATTTAAGAACAGCCTGGG + Intronic
1157690416 18:49677379-49677401 CAGGAATTTGGGACCAGCCTGGG + Intergenic
1157842344 18:50970161-50970183 CAGGAATTCAAGAGCAGCCTGGG - Intronic
1158107621 18:53903847-53903869 CAGAAGTTTAAGACCAGCCTGGG - Intergenic
1158452882 18:57582552-57582574 CAGACATTTGGGGGCAGCCTGGG + Intronic
1158762567 18:60407767-60407789 CAAAAATCTAGAAGAAACCTAGG + Intergenic
1158779075 18:60624808-60624830 CAGAAATTCAAGACCAGCCTAGG + Intergenic
1158879968 18:61768652-61768674 CAGAACTCGAGGAGGACCCTTGG - Intergenic
1159441538 18:68486421-68486443 CAGGAATTCAGGACCAGCCTGGG + Intergenic
1159818823 18:73113875-73113897 CAGAAATTCAAGACCAGCCTGGG - Intergenic
1160211438 18:76883634-76883656 CAGGAATTTAAGACCAGCCTGGG - Intronic
1160406017 18:78646856-78646878 CTGGCGTCTAGGAGCAGCCTCGG + Intergenic
1160464189 18:79062381-79062403 CAGGAATCTGAGACCAGCCTGGG - Intergenic
1160570155 18:79810557-79810579 CAGAAATTTAAGACCAGCTTGGG + Intergenic
1160632480 18:80256244-80256266 CAGAAGTTTCGGACCAGCCTTGG + Intergenic
1161350504 19:3788667-3788689 CAGAAATTTGAGACCAGCCTGGG - Intronic
1161688752 19:5718491-5718513 AAAAAATCTTGGAGCAGCGTTGG + Intronic
1161754213 19:6119688-6119710 CAGAAATTTGAGACCAGCCTGGG - Intronic
1161844608 19:6705553-6705575 CAGAAATTTGAGACCAGCCTGGG - Intronic
1161865412 19:6829123-6829145 CACAGATCTGGGAGGAGCCTGGG + Intronic
1161947590 19:7447918-7447940 CAGGAGTTTAAGAGCAGCCTGGG + Intronic
1162023877 19:7882486-7882508 CAGAAGTTCAGGACCAGCCTGGG + Intergenic
1162044242 19:7988140-7988162 CAGAAATCTAGGCGTGTCCTTGG - Intronic
1162051763 19:8038435-8038457 CAGAAGTCTGAGAGCAGCCTGGG + Intronic
1162204694 19:9047002-9047024 CAGAAGTTCAAGAGCAGCCTGGG - Intergenic
1162486882 19:10966380-10966402 CAGGAATCCAAGACCAGCCTGGG + Intronic
1162489044 19:10980958-10980980 CAGAAATTCAAGATCAGCCTGGG - Intronic
1162582152 19:11538039-11538061 CAGAAATTTGAGACCAGCCTGGG + Intergenic
1162841218 19:13357793-13357815 CAGGAGTCTGAGAGCAGCCTGGG + Intronic
1162965612 19:14154496-14154518 CAGAAATTCAAGACCAGCCTGGG - Intronic
1163308537 19:16497904-16497926 CAGGAATCTGAGAACAGCCTGGG + Intronic
1163550049 19:17961366-17961388 CAGGAATATGAGAGCAGCCTGGG + Intronic
1163608556 19:18289194-18289216 CAGAAGTTCAAGAGCAGCCTGGG + Intergenic
1163658317 19:18561192-18561214 TAGGAATTTAAGAGCAGCCTAGG + Intronic
1163839812 19:19600316-19600338 CAGAAATTTAAGATCGGCCTGGG + Intronic
1163990569 19:20995535-20995557 CACAAATTTAGGAGCAGCTATGG - Intergenic
1164141457 19:22470004-22470026 CAGAAATTTGAGACCAGCCTGGG - Intronic
1164322373 19:24161044-24161066 CAGAAATTTCAGACCAGCCTGGG - Intergenic
1164428658 19:28167632-28167654 CAGGAATTTAAGACCAGCCTGGG - Intergenic
1164883544 19:31758361-31758383 CAGAAGTTCAGGACCAGCCTGGG + Intergenic
1164893749 19:31849892-31849914 CAGGAATCCAAGATCAGCCTAGG + Intergenic
1164902144 19:31937572-31937594 CAGAGAGCGAGGAGAAGCCTGGG - Intergenic
1164948504 19:32316322-32316344 CAGGAGTTTAAGAGCAGCCTGGG + Intergenic
1164948963 19:32320098-32320120 CAGAAGTTTAAGACCAGCCTGGG - Intergenic
1164955999 19:32385604-32385626 CAGAAGTTTAAGACCAGCCTGGG + Exonic
1164982478 19:32624730-32624752 CAGGAATGTAAGACCAGCCTGGG + Intronic
1165196811 19:34110605-34110627 CAGGAATTCAGGATCAGCCTAGG + Intergenic
1165218711 19:34296850-34296872 CAGGAGTCTAAGAGCAGCCTGGG - Intronic
1165223608 19:34338325-34338347 CAGGAGTTTAGGACCAGCCTGGG + Intronic
1165344138 19:35233062-35233084 CAAAACTCGAGGATCAGCCTAGG + Intergenic
1165444033 19:35846897-35846919 TAGAATTCTAGGAGAATCCTGGG - Intronic
1165613491 19:37177817-37177839 CAGAAGTTTAAGACCAGCCTGGG + Intronic
1165661181 19:37581669-37581691 CAGGAATTCAGGACCAGCCTGGG - Intronic
1165672877 19:37694473-37694495 CAAAAGTTTAAGAGCAGCCTGGG + Intronic
1165814327 19:38632315-38632337 CAGAAATTCAAGACCAGCCTGGG + Intronic
1165916196 19:39262293-39262315 CAGGAATTTAAGACCAGCCTGGG + Intergenic
1165971897 19:39638717-39638739 CAGGAGTATAAGAGCAGCCTGGG + Intergenic
1166008130 19:39921200-39921222 CAGAAATTTGAGACCAGCCTGGG - Intronic
1166035286 19:40163806-40163828 CAGGAGTCTAAGAGTAGCCTGGG - Intergenic
1166056937 19:40295952-40295974 CAGGAGTTTAAGAGCAGCCTGGG - Intergenic
1166089646 19:40500032-40500054 CAGAAGTTCAGGACCAGCCTGGG + Intronic
1166199446 19:41226883-41226905 CAGAAGTTTGAGAGCAGCCTGGG + Intronic
1166400671 19:42477271-42477293 CAGGAGTCCAAGAGCAGCCTGGG + Intergenic
1166405059 19:42514485-42514507 CAGGAATCCAAGACCAGCCTAGG - Intronic
1166671437 19:44711770-44711792 CAGAAATTTGAGACCAGCCTGGG + Intergenic
1166687599 19:44805174-44805196 CAGGAATTTGGGACCAGCCTGGG - Intergenic
1166771323 19:45284621-45284643 AAGAAATCTAGGAGCGGGCCAGG - Intronic
1166839235 19:45686491-45686513 CAGAAGTTTAGGACTAGCCTGGG - Intergenic
1166877513 19:45906533-45906555 CAGGAATTTGGGACCAGCCTAGG - Intergenic
1167041553 19:47025781-47025803 CAGGAATGTGAGAGCAGCCTGGG - Intronic
1167294535 19:48641871-48641893 CAGGAATTTAAGACCAGCCTGGG - Intronic
1167310215 19:48733231-48733253 CAGAAGTTTGGGACCAGCCTGGG - Intronic
1167409058 19:49334273-49334295 CAGAAATTTGAGACCAGCCTAGG + Intergenic
1167431827 19:49459592-49459614 CAGGTATATAGGAGCAGCCCAGG + Intronic
1167488168 19:49775609-49775631 CAGGAATCTGAGACCAGCCTGGG - Intronic
1167559400 19:50216392-50216414 CAGGAATTCAAGAGCAGCCTGGG + Intronic
1167664481 19:50815967-50815989 CAGTAATCTGAGACCAGCCTGGG + Intergenic
1167828462 19:51997108-51997130 CAGAAATTTGAGACCAGCCTGGG + Intronic
1167953065 19:53043376-53043398 CAGAAGTTTGGGACCAGCCTGGG - Intergenic
1167965972 19:53147025-53147047 CAGAAGTTTGAGAGCAGCCTGGG + Intronic
1168017898 19:53588104-53588126 CAGGAGTCCAAGAGCAGCCTGGG - Intergenic
1168537714 19:57185179-57185201 CAGAAATTTGAGACCAGCCTGGG + Intergenic
1168612123 19:57809771-57809793 CAGAAATCCAAGACCAGCCTGGG + Intronic
1202646522 1_KI270706v1_random:146998-147020 CAGAAATTTGAGACCAGCCTGGG + Intergenic
925274350 2:2638272-2638294 CAGAGATCAAGCAGGAGCCTGGG + Intergenic
925583042 2:5433432-5433454 CAGAAGTTTAAGACCAGCCTGGG - Intergenic
925797658 2:7564365-7564387 CAGAAGTTTAAGATCAGCCTAGG + Intergenic
926014522 2:9437790-9437812 CAGGAATTTAAGATCAGCCTGGG + Intronic
926263101 2:11285616-11285638 CAGAAATTCAAGATCAGCCTCGG + Intronic
926398242 2:12467948-12467970 CAGGAATTTAAGACCAGCCTGGG - Intergenic
926646626 2:15296620-15296642 CAGAAGTTTAAGACCAGCCTGGG + Intronic
926824792 2:16894143-16894165 CAGGAATTTGGGACCAGCCTGGG - Intergenic
927513954 2:23661130-23661152 CAGGAGTTTAAGAGCAGCCTGGG + Intronic
927738713 2:25547055-25547077 CAGAAGTTTAAGACCAGCCTGGG - Intronic
927914779 2:26928484-26928506 CAGGAATTTAAGACCAGCCTGGG + Intronic
927950844 2:27167934-27167956 CAGGAGTCTAAGACCAGCCTGGG + Intergenic
927968264 2:27286018-27286040 CAGGAATTTAAGACCAGCCTGGG + Intronic
928015859 2:27656483-27656505 CAGAAGTTTAAGACCAGCCTGGG - Intronic
928074972 2:28255872-28255894 CAGAAATTTAAGACCAGCCTGGG - Intronic
928297743 2:30099480-30099502 CAGAAGTTTGAGAGCAGCCTGGG - Intergenic
929010746 2:37441661-37441683 CAGGAATTTAAGAGCAGCCTGGG - Intergenic
929201500 2:39242252-39242274 CAGGAATTCAGGATCAGCCTAGG - Intergenic
929877379 2:45808019-45808041 CTGAAATCTGTGGGCAGCCTTGG - Intronic
930055829 2:47251288-47251310 CAGGAATTTGGGATCAGCCTGGG - Intergenic
930122782 2:47773380-47773402 CAGAAATTTGAGACCAGCCTGGG + Intronic
930205465 2:48583295-48583317 CAGGAATTCAAGAGCAGCCTGGG - Intronic
930438239 2:51374409-51374431 CAGAAGTTTGAGAGCAGCCTGGG + Intergenic
930442901 2:51431577-51431599 CAGAAATGTGGAAGCAACCTTGG + Intergenic
930616948 2:53603475-53603497 CAGAAATTCAAGATCAGCCTGGG + Intronic
931182452 2:59916312-59916334 CAGAAGTCTGGGACCAGCCTGGG - Intergenic
931218467 2:60267491-60267513 CAGAAATCGTTGGGCAGCCTTGG - Intergenic
931388062 2:61815095-61815117 CAGATGACTAGGAGCAACCTTGG + Intergenic
931443464 2:62307533-62307555 CAGAAAGTCAGGACCAGCCTGGG + Intergenic
931522187 2:63111086-63111108 CAGAAGTTTAAGACCAGCCTGGG + Intergenic
931713137 2:65006728-65006750 CAGAAATTTGAGACCAGCCTGGG + Intronic
931717697 2:65042262-65042284 CAGAAGTCTAAGATCAACCTGGG + Intergenic
931735346 2:65188638-65188660 CAGAAGTTTAAGACCAGCCTGGG - Intergenic
932185228 2:69689294-69689316 CAGAAATTTGAGACCAGCCTGGG - Intronic
932256278 2:70290047-70290069 CAGGAATTCAGGACCAGCCTGGG - Intronic
932371183 2:71189306-71189328 CAGAAGTCTGTGAGCAGGCTGGG - Intronic
932375520 2:71232200-71232222 CAGGAGTTTAGGACCAGCCTGGG - Intergenic
932631905 2:73351917-73351939 CAGAAATATGAGACCAGCCTGGG - Intergenic
932736901 2:74260619-74260641 CAGAAATCTAGGAGCAGCCTTGG + Intronic
933047273 2:77555151-77555173 CAGGAATTTGAGAGCAGCCTGGG - Intronic
933200836 2:79446564-79446586 CAGAAGGCTTTGAGCAGCCTTGG - Intronic
933243142 2:79945247-79945269 CAGGAATGTAAGACCAGCCTGGG - Intronic
933821617 2:86117668-86117690 CAGAAATTTGAGACCAGCCTGGG - Intronic
934509671 2:94927418-94927440 CAGAAATTTGAGACCAGCCTGGG + Intergenic
934684871 2:96313587-96313609 CAGAAATTTGAGACCAGCCTGGG + Intergenic
934723195 2:96596346-96596368 CAGAAGTTTAAGACCAGCCTGGG + Intronic
934917661 2:98313218-98313240 CTGAAAGCTAGGAGTAGCCAGGG + Intronic
935244255 2:101204643-101204665 CAGAAATTTGAGACCAGCCTGGG - Intronic
935252968 2:101281707-101281729 CAGAAATTTGAGAACAGCCTGGG - Intronic
935300380 2:101688582-101688604 CAGAAGTCTGAGACCAGCCTGGG + Intergenic
935401598 2:102666034-102666056 CAGAACTCCAAGAGCAGCTTGGG - Intronic
935583644 2:104781893-104781915 CAGAAATTTGAGACCAGCCTGGG + Intergenic
935660120 2:105459337-105459359 CAGGATTTTAGGACCAGCCTAGG + Intergenic
936479833 2:112876126-112876148 CAGAAATTCAAGACCAGCCTGGG + Intergenic
937367808 2:121277289-121277311 CAGAAATTTGGGTCCAGCCTGGG + Intronic
937653256 2:124344559-124344581 CAGGAATTTAAGACCAGCCTGGG + Intronic
937935909 2:127244566-127244588 CAGAAGTTTAAGAGTAGCCTGGG - Intergenic
938033262 2:128013855-128013877 CAGAAATCTGAAACCAGCCTGGG + Intronic
939488900 2:142852964-142852986 CAGGAATTTGGGACCAGCCTGGG + Intergenic
939545807 2:143551361-143551383 CAGGAATCCAAGAACAGCCTGGG - Intronic
939643068 2:144663954-144663976 CAGAAGTTTGAGAGCAGCCTGGG + Intergenic
940078313 2:149769369-149769391 CAGGAATCTGAGATCAGCCTGGG + Intergenic
940331440 2:152479351-152479373 CAGGAATTCAGGACCAGCCTAGG - Intronic
940881712 2:158953403-158953425 CAGAAAGCTAGAAGGAACCTGGG - Intergenic
940914999 2:159244714-159244736 CAGAAGTTCAGGACCAGCCTGGG + Intronic
940929564 2:159411230-159411252 CAGGAATTTAAGACCAGCCTGGG - Intronic
941279285 2:163530369-163530391 CAGGAATTTAAGACCAGCCTGGG + Intergenic
941812184 2:169766227-169766249 CAGAAATTCAAGACCAGCCTGGG + Intronic
942124490 2:172809739-172809761 CAGGAATTTAAGACCAGCCTGGG - Intronic
942180775 2:173378468-173378490 CAGGAGTTCAGGAGCAGCCTGGG + Intergenic
942293422 2:174494954-174494976 CAGGAATTTAAGACCAGCCTGGG + Intergenic
942320529 2:174732080-174732102 CAGAGATCTAAGAGCTGACTGGG + Intergenic
942559058 2:177201083-177201105 CAGGAATCCAAGATCAGCCTGGG + Intergenic
942872704 2:180754468-180754490 CAGAAATTCAAGACCAGCCTGGG + Intergenic
943127370 2:183811437-183811459 CAGGAATTTGAGAGCAGCCTGGG + Intergenic
943329991 2:186547452-186547474 CAGCAGTCTAAGACCAGCCTGGG + Intergenic
943975050 2:194465245-194465267 CAGGAATTTAAGACCAGCCTGGG + Intergenic
944084370 2:195827488-195827510 CAGGAGTTTAAGAGCAGCCTGGG - Intronic
944324574 2:198388910-198388932 CAGGAGTTTAAGAGCAGCCTGGG + Intronic
944476490 2:200111984-200112006 CAGTAATTCAGGACCAGCCTGGG - Intergenic
944705018 2:202280275-202280297 CAGGAATTTAAGATCAGCCTGGG + Intronic
944773685 2:202939896-202939918 CAGGAATCTGAGACCAGCCTGGG - Intronic
944805937 2:203281296-203281318 CAGAAATTTGGGACCAGCCTGGG + Intronic
945073982 2:206018711-206018733 CAGAAGTTCAGGATCAGCCTGGG + Intronic
945284528 2:208069116-208069138 CAGAAATTTGAGACCAGCCTGGG - Intergenic
945299063 2:208199257-208199279 CAGAAATTCAAGACCAGCCTGGG - Intergenic
945728403 2:213502329-213502351 CAGGAATTTAAGATCAGCCTGGG - Intronic
946222011 2:218235878-218235900 CAGAAGTTCAGGACCAGCCTGGG + Intronic
946661655 2:222007393-222007415 CAGGAGTTTGGGAGCAGCCTGGG + Intergenic
946723727 2:222640280-222640302 CAGGAATTTGAGAGCAGCCTGGG + Intronic
946727702 2:222677456-222677478 CAGAAATTTTGAAGCAGCCTTGG + Intronic
946821687 2:223636200-223636222 CAGGAATCCAAGATCAGCCTGGG + Intergenic
947103390 2:226645420-226645442 CAGGAATTTAAGACCAGCCTGGG - Intergenic
947595483 2:231409039-231409061 CAGGAATTTGGGACCAGCCTGGG + Intergenic
947648621 2:231765050-231765072 CAGGAATCCAAGACCAGCCTGGG + Intronic
947679723 2:232019341-232019363 CAGAAGTTTAAGACCAGCCTGGG + Intronic
947806070 2:232968951-232968973 TAGAAAGCTAGAAGGAGCCTGGG + Intronic
947824448 2:233095310-233095332 CAGAAGTTTAAGAACAGCCTGGG - Intronic
947900231 2:233715561-233715583 CAGGAGTCTGAGAGCAGCCTGGG + Intronic
947901630 2:233725955-233725977 CAGGAGTCTGAGAGCAGCCTGGG + Intronic
948089796 2:235283243-235283265 CAGGAGTCTGAGAGCAGCCTGGG - Intergenic
948836377 2:240628044-240628066 CAGAAGTCCAGGGCCAGCCTTGG - Intronic
948865870 2:240774446-240774468 CAGAGATGAAGGAGCAGCCAAGG - Intronic
1168783927 20:520706-520728 CAGAAATTTGAGACCAGCCTAGG - Intronic
1169126343 20:3130019-3130041 CAGAAATTTGAGACCAGCCTGGG + Intronic
1169167476 20:3436597-3436619 CAGAAGTTTAAGACCAGCCTGGG + Intergenic
1169176633 20:3521996-3522018 CAGGAATTTAAGACCAGCCTAGG - Intronic
1169187511 20:3631156-3631178 CAGAAGTTTAAGACCAGCCTGGG - Intronic
1169229025 20:3874740-3874762 CAGAAACCCATGACCAGCCTGGG - Exonic
1169434985 20:5578977-5578999 CAGAAGTCTGAGACCAGCCTAGG + Intronic
1169493417 20:6090544-6090566 CAGGAGTTTAGGACCAGCCTGGG + Intronic
1169829205 20:9804838-9804860 CAGGAGTTTAGGACCAGCCTGGG + Intronic
1169887566 20:10417400-10417422 CAGAAATTTGAGACCAGCCTGGG + Intronic
1170558783 20:17537907-17537929 CAGGAATCCAAGACCAGCCTGGG + Intronic
1170684546 20:18557346-18557368 CAGGAGTTTAGGACCAGCCTAGG - Intronic
1170817597 20:19727932-19727954 CAGGAATTTAAGACCAGCCTGGG + Intergenic
1170956062 20:20980438-20980460 CAGAAATACTGGAGTAGCCTAGG + Intergenic
1171331466 20:24342630-24342652 CAGAAATCTGTGAGTTGCCTGGG - Intergenic
1171471318 20:25374132-25374154 CAGGAATCTGAGACCAGCCTGGG - Intronic
1171472037 20:25379896-25379918 CAGGAATCTGAGACCAGCCTGGG - Intronic
1171473049 20:25387540-25387562 CAGAAATTCAAGACCAGCCTGGG + Intronic
1171478541 20:25434073-25434095 CAGAAATTTGAGACCAGCCTGGG + Intronic
1171974335 20:31584662-31584684 CAGAAGTCCAAGACCAGCCTGGG + Intergenic
1172052502 20:32129282-32129304 CAGAAGTTTGGGACCAGCCTGGG + Intronic
1172068475 20:32238804-32238826 CCTAAATCTTGGAGCACCCTGGG - Intergenic
1172503218 20:35442047-35442069 CAGAAATTTGAGACCAGCCTGGG - Intronic
1172516811 20:35540666-35540688 CAGGAGTCTAAGACCAGCCTGGG - Intergenic
1172553266 20:35818466-35818488 CAGAAGTTTAAGACCAGCCTGGG - Intronic
1172673986 20:36654478-36654500 CAGGAATCCAAGGGCAGCCTTGG - Intronic
1172681943 20:36723138-36723160 CAGAAACTTGGGAGCAGGCTTGG - Intronic
1172691107 20:36790643-36790665 CAGGAATTTAAGACCAGCCTGGG - Intronic
1172910220 20:38403278-38403300 CAGAAGTCCAGGAACAGCCTGGG + Intergenic
1172927248 20:38549435-38549457 CAGAAGTTTGGGATCAGCCTGGG - Intronic
1172982485 20:38954782-38954804 CAGGAGTTTAAGAGCAGCCTAGG - Intergenic
1173285205 20:41664599-41664621 CAGAAAGCTGGAAGGAGCCTGGG - Intergenic
1173509477 20:43615248-43615270 CAGAAGTTTAAGACCAGCCTGGG - Intronic
1173523266 20:43714337-43714359 AGGAAAACTAGGAACAGCCTTGG + Intronic
1173552210 20:43940430-43940452 CAGGAATTCAAGAGCAGCCTGGG - Intronic
1173633394 20:44533236-44533258 CAGGAATCTGAGACCAGCCTGGG - Intronic
1173896423 20:46554517-46554539 CAGGAGTCTAAGATCAGCCTGGG + Intergenic
1173972882 20:47165979-47166001 CAGAAATTCAAGACCAGCCTGGG + Intronic
1174015087 20:47481359-47481381 CAGAAATTCAAGACCAGCCTGGG - Intergenic
1174216007 20:48916882-48916904 CAGGAATTTGGGAGCAGCATGGG - Intergenic
1174219520 20:48942356-48942378 CAGAAGTGTAAGACCAGCCTGGG - Intronic
1174256584 20:49260731-49260753 CAGAAATTCAAGACCAGCCTGGG + Intronic
1174321002 20:49741613-49741635 CAGGAGTTTAGGACCAGCCTGGG - Intergenic
1174347750 20:49943427-49943449 CAGAAGTTTGAGAGCAGCCTGGG + Intronic
1174416528 20:50371035-50371057 CAGGAGTTTGGGAGCAGCCTGGG + Intergenic
1174482310 20:50840081-50840103 CAGGAATTTAAGACCAGCCTGGG - Intronic
1174690481 20:52499374-52499396 CAGAAATTTGAGACCAGCCTGGG - Intergenic
1174701284 20:52611558-52611580 CAGGAATTCAAGAGCAGCCTGGG - Intergenic
1175089745 20:56492509-56492531 CAGAAGTCTGAGACCAGCCTGGG + Intronic
1175175799 20:57111245-57111267 CAGAAATGTGGGAGCAACCCAGG - Intergenic
1175543949 20:59766087-59766109 CAGAAATCCAAGAGGAGCCCCGG + Intronic
1176084275 20:63288983-63289005 CAGCACTCCTGGAGCAGCCTGGG + Exonic
1176203374 20:63874580-63874602 CAGAAATTTGAGACCAGCCTAGG - Intronic
1176302512 21:5105293-5105315 CACAAAGCCAGGAGCGGCCTGGG + Intergenic
1176410357 21:6446368-6446390 CGGAAGTCTGGGACCAGCCTGGG + Intergenic
1176605348 21:8825763-8825785 CAGAAATTTGAGACCAGCCTGGG - Intergenic
1176806433 21:13488418-13488440 CAGAAATTTGAGACCAGCCTGGG + Intergenic
1177356178 21:20010980-20011002 CAGGAATTTGAGAGCAGCCTGGG - Intergenic
1177886450 21:26751703-26751725 CAGAAATTTGAGACCAGCCTGGG - Intergenic
1177901791 21:26926059-26926081 CAGGAGTTTAAGAGCAGCCTGGG + Intronic
1178057581 21:28816459-28816481 CAGAAATTCAAGAGCAGCCTGGG + Intergenic
1178519652 21:33277980-33278002 CAGGAATTTAAGACCAGCCTGGG + Intronic
1178588186 21:33887107-33887129 CAGGAGTCTAAGACCAGCCTGGG + Intronic
1178601988 21:34002425-34002447 CAGAAATTCAAGACCAGCCTGGG - Intergenic
1178677481 21:34643429-34643451 CAGGGATCCAGGAACAGCCTAGG + Intergenic
1178838162 21:36115740-36115762 CAGAAGTTTAAGACCAGCCTTGG - Intergenic
1178856942 21:36258199-36258221 CAGAAGTTTAAGACCAGCCTGGG + Intronic
1179010712 21:37553965-37553987 CAGAAGTTCAAGAGCAGCCTGGG - Intergenic
1179223373 21:39429807-39429829 CAGAAGTTTAGGACCAGCCTGGG + Intronic
1179257895 21:39732815-39732837 CAGGAGTCTAAGACCAGCCTGGG + Intergenic
1179532712 21:42031049-42031071 CACAAAACCAGGAGCAGCCTGGG + Intergenic
1179685850 21:43054690-43054712 CGGAAGTCTGGGACCAGCCTGGG + Intronic
1179782820 21:43713294-43713316 CAGGAATTTAAGACCAGCCTGGG - Intergenic
1179854515 21:44156630-44156652 CACAAAGCCAGGAGCGGCCTGGG - Intergenic
1180208896 21:46281611-46281633 CAGGAATTTAGGACCAGCCTGGG + Intronic
1180223217 21:46373223-46373245 CAGGAATTTAAGACCAGCCTGGG - Intronic
1180347642 22:11717368-11717390 CAGAAATTTGAGACCAGCCTGGG - Intergenic
1180355413 22:11835478-11835500 CAGAAATTTGAGACCAGCCTGGG - Intergenic
1180382838 22:12156849-12156871 CAGAAATTTGAGACCAGCCTGGG + Intergenic
1180670645 22:17549832-17549854 CAGGAGACTAGGACCAGCCTGGG - Intronic
1180690930 22:17714930-17714952 CAGAAATTTGAGACCAGCCTGGG + Intronic
1180781642 22:18523496-18523518 CAGGAATCTAGGCTCACCCTTGG - Intergenic
1181146625 22:20853026-20853048 CAGAAATCTGAGACCAGCCTGGG + Intronic
1181238526 22:21462839-21462861 CAGGAATCTAGGCTCACCCTTGG - Intergenic
1181371852 22:22425140-22425162 CAGAAATTCAAGACCAGCCTGGG - Intergenic
1181482603 22:23210205-23210227 CAGGAATTTGAGAGCAGCCTGGG + Intronic
1181596379 22:23917559-23917581 CAGGAATTTAAGACCAGCCTGGG + Intergenic
1181840623 22:25656533-25656555 CAGAAATTCAAGACCAGCCTGGG - Intronic
1181846640 22:25715303-25715325 CAGAAGTCCAAGACCAGCCTGGG + Intronic
1182088848 22:27580426-27580448 CAGAAGTCAAGGGGCAGCCTTGG - Intergenic
1182181837 22:28357517-28357539 CAGGAATTCAGGACCAGCCTGGG - Intronic
1182207148 22:28640096-28640118 CAGGAATTCAGGACCAGCCTGGG + Intronic
1182361151 22:29747323-29747345 CAGAAGTTCAAGAGCAGCCTGGG - Intronic
1182574497 22:31263787-31263809 CAGGAGTTCAGGAGCAGCCTGGG + Intronic
1182637219 22:31737577-31737599 CAGGAATTTGAGAGCAGCCTAGG + Intronic
1182691260 22:32165130-32165152 CAGAAATCCAAGACCAACCTGGG - Intergenic
1183092077 22:35529243-35529265 CACAAAGCTAGAAGCAGCCTGGG + Intergenic
1183260243 22:36790150-36790172 TAGAAATCCAGGAGAAGCCTGGG - Intergenic
1183651520 22:39157155-39157177 CAGAAGTTTAAGACCAGCCTGGG + Intergenic
1183825165 22:40380725-40380747 CAGGAATTTAAGACCAGCCTGGG + Intronic
1184173035 22:42770553-42770575 CAGAAGTCTAAGACCAGCCTGGG - Intergenic
1184343350 22:43898213-43898235 CACAAAGCCAGGAGCAGCCACGG + Intergenic
1184462562 22:44647604-44647626 CAGGAATTTAAGACCAGCCTGGG - Intergenic
1184672260 22:46020582-46020604 CAGAAATTCAAGACCAGCCTTGG + Intergenic
1184805254 22:46791228-46791250 CAGGAGTTTAGGACCAGCCTGGG - Intronic
1184961803 22:47934893-47934915 CAGAAATTCAAGATCAGCCTAGG + Intergenic
1185326891 22:50230259-50230281 CAGAAGTCTGAGACCAGCCTGGG + Intronic
1185359083 22:50394384-50394406 CAGAAATTTGAGACCAGCCTGGG + Intronic
949718874 3:6965541-6965563 CAGAAATGCAAGACCAGCCTGGG - Intronic
949804895 3:7944150-7944172 CAGAAATTTGAGACCAGCCTGGG - Intergenic
950244733 3:11405826-11405848 CAGAAGTTTAGGACCAGCCTGGG - Intronic
950340649 3:12241103-12241125 CAGATATTCAAGAGCAGCCTAGG - Intergenic
950355331 3:12403562-12403584 CAGGAATTTGAGAGCAGCCTGGG - Intronic
950356836 3:12418175-12418197 CAGGAATCTGAGATCAGCCTGGG - Intronic
950907147 3:16549518-16549540 CAGAAGTTTAAGACCAGCCTGGG + Intergenic
951028301 3:17852561-17852583 CAGAAATCCAAGAGTAGCTTAGG - Intronic
951426546 3:22552863-22552885 CAGAAATTTAACACCAGCCTGGG + Intergenic
951512617 3:23520849-23520871 CAGAAATCTGAGACCAGCCTGGG - Intronic
951546895 3:23835259-23835281 CAGGAGTTTAAGAGCAGCCTGGG + Intronic
951563240 3:23988602-23988624 CAGAAATTTGAGACCAGCCTAGG - Intergenic
951749643 3:26020162-26020184 CAAAAATCTAGGGGCAGACTTGG + Intergenic
951997583 3:28748319-28748341 CAGAAAACGAGGAGCAACTTGGG + Intergenic
952403454 3:32984567-32984589 CAGAAATTTGAGACCAGCCTGGG + Intergenic
952469764 3:33635041-33635063 CAGGAATTTGGGACCAGCCTGGG + Intronic
952493033 3:33889906-33889928 CAAAAATCTGGGAGCTGACTTGG + Intergenic
952757687 3:36886315-36886337 CAGAAATTTGAGACCAGCCTGGG - Intronic
952891080 3:38041349-38041371 CAGAAATTTGAGACCAGCCTGGG - Intronic
952948676 3:38499676-38499698 CAGAAATTCAAGACCAGCCTAGG - Intronic
953318398 3:41949942-41949964 CAGAAGTTCAGGACCAGCCTGGG - Intronic
953701932 3:45203245-45203267 CAGAAATTCAAGACCAGCCTGGG + Intergenic
953720903 3:45354359-45354381 TAGGAGTCTAGGAACAGCCTGGG + Intergenic
953817527 3:46172018-46172040 CAGGAATTTGGGACCAGCCTGGG - Intronic
954174296 3:48831569-48831591 CAGAGGCCTAGGACCAGCCTGGG - Intronic
954262146 3:49447218-49447240 CAGAAGTTTAAGACCAGCCTTGG + Intergenic
954461450 3:50629286-50629308 GGGAAAGCTAGGTGCAGCCTTGG - Intronic
954516191 3:51179700-51179722 CAGGAATTCAGGACCAGCCTGGG + Intronic
955229713 3:57087935-57087957 CAGAAGTCTAAGACCAGCCTGGG - Intergenic
955231731 3:57105327-57105349 CAGGAGTCTAAGACCAGCCTGGG + Intronic
955354908 3:58223236-58223258 CAGAAATTTGAGACCAGCCTGGG - Intergenic
955404762 3:58619207-58619229 CAGGAATTCAGGACCAGCCTGGG - Intronic
956078684 3:65534271-65534293 CAGGAATTTGGGACCAGCCTGGG + Intronic
956276931 3:67512062-67512084 CAGGAATTCAAGAGCAGCCTGGG - Intronic
956903976 3:73746298-73746320 CAGAAATTTGAGACCAGCCTGGG + Intergenic
957098456 3:75800163-75800185 CAGAAGTTTGAGAGCAGCCTGGG - Intergenic
957171638 3:76744568-76744590 CAGAAATTTGAGACCAGCCTGGG - Intronic
957293761 3:78310456-78310478 CAGAAGTTTATGACCAGCCTAGG + Intergenic
957478222 3:80755186-80755208 CAGAAATCTCGAGGCAGCTTGGG - Intergenic
958024329 3:88033002-88033024 CAGGAATTCAAGAGCAGCCTGGG + Intergenic
958823584 3:99003554-99003576 CAAAAATGTGGGAGCAGCTTTGG - Intergenic
958988559 3:100813087-100813109 CAGAATTTTATGACCAGCCTTGG - Intronic
959090394 3:101896300-101896322 CAGAAATTTGAGACCAGCCTAGG - Intergenic
959307224 3:104683720-104683742 CAGGAATCCAGGACCAACCTGGG - Intergenic
959323816 3:104910690-104910712 CAGAAGTTTAAGAACAGCCTAGG + Intergenic
959818345 3:110702863-110702885 CAGAACTTTAAGACCAGCCTGGG - Intergenic
959852461 3:111105339-111105361 CAGGAATTTAAGACCAGCCTGGG - Intronic
960431008 3:117568595-117568617 CAGAAATTTGAGACCAGCCTGGG + Intergenic
960632477 3:119746447-119746469 CAGAAAGCTAGAAGGATCCTGGG - Intronic
960638430 3:119806492-119806514 CAGGAATCTGAGACCAGCCTGGG - Intronic
960670663 3:120152751-120152773 CAGAAATTCCAGAGCAGCCTGGG - Intergenic
960768003 3:121159374-121159396 CAGAAGCTTAGGACCAGCCTGGG - Intronic
961178456 3:124856092-124856114 CAGAAATCTGAGACCAGCCTGGG - Intronic
961235250 3:125360768-125360790 CAGAAGTTTAAGACCAGCCTGGG + Intronic
961852893 3:129839544-129839566 CAGAAGTTTAAGACCAGCCTAGG + Intronic
961870078 3:129981081-129981103 CAGAAATGGAGGGGCAGCATTGG + Intergenic
962498718 3:135967216-135967238 CAGAAATCTAGGAGATTTCTAGG + Intronic
962518563 3:136176614-136176636 CATGAATCTAAGACCAGCCTGGG + Intronic
962538003 3:136348610-136348632 CAGAAATTTGAGACCAGCCTGGG - Intronic
962779408 3:138697639-138697661 CAGCAATTTAAGACCAGCCTGGG - Intronic
962779842 3:138702281-138702303 CAGGAATTTGAGAGCAGCCTGGG - Intronic
962944574 3:140155355-140155377 CAGAAATCAAGGTACATCCTAGG + Intronic
963126601 3:141822375-141822397 GAGAGGCCTAGGAGCAGCCTTGG - Intergenic
963224456 3:142847743-142847765 CAGAAATTCAAGACCAGCCTGGG - Intronic
963350677 3:144147580-144147602 CAGAAATTTGAGACCAGCCTGGG - Intergenic
963422812 3:145082857-145082879 CAGAAATCTCAGAGCTACCTTGG + Intergenic
963797498 3:149645378-149645400 CAGGAGTTTAAGAGCAGCCTGGG - Intronic
963899820 3:150723540-150723562 CAGAAATTTGAGACCAGCCTAGG - Intergenic
964062643 3:152542210-152542232 CAGAAATTCAAGACCAGCCTGGG - Intergenic
964108577 3:153065534-153065556 CAGAAATTCAAGATCAGCCTGGG - Intergenic
964355034 3:155842798-155842820 CAGAAATTCAAGACCAGCCTGGG + Intronic
964587027 3:158317766-158317788 CAGGAATTTAAGACCAGCCTGGG - Intronic
965544074 3:169897773-169897795 CAGAAATTAAAGACCAGCCTGGG - Intergenic
966029381 3:175326485-175326507 TAGAAATGTAGAAGCAGCTTTGG - Intronic
966376435 3:179300750-179300772 CAGAAGTTCAAGAGCAGCCTGGG - Intergenic
966721917 3:183072074-183072096 CAGAAGTTTAAGACCAGCCTGGG - Intronic
966849919 3:184158124-184158146 CAGGAATCTGAGACCAGCCTTGG + Intronic
966867616 3:184268488-184268510 CAGGAGTTTAGGACCAGCCTCGG - Intronic
966987123 3:185191164-185191186 CAGAAATTTGAGACCAGCCTGGG - Exonic
967001732 3:185342208-185342230 CAGGAATCTCGGAGCAGCATGGG - Intronic
967210436 3:187163400-187163422 CAGAAATTCAAGACCAGCCTGGG + Intronic
967386580 3:188917574-188917596 CAGGAATTTAGGACCAGCCCTGG + Intergenic
967675669 3:192296112-192296134 CAGGAATTTAAGACCAGCCTGGG - Intronic
967700571 3:192587605-192587627 CAGAAATTTGAGACCAGCCTGGG + Intronic
967717644 3:192781376-192781398 CAGAAGTCTGAGATCAGCCTGGG - Intergenic
968118863 3:196110458-196110480 CAGGAATTTAAGACCAGCCTGGG - Intergenic
968977523 4:3829833-3829855 CAGACGTCTAGGGGCAGCCCAGG + Intergenic
969259249 4:6023163-6023185 CAGAAGTCTAGGGGCACCCATGG - Intergenic
970157069 4:13152357-13152379 AAGAAATCAAAGAGCAGCCAAGG + Intergenic
970740580 4:19233073-19233095 CAGGAATTTAAGACCAGCCTGGG + Intergenic
970807619 4:20054501-20054523 CAAAAATTTAAGACCAGCCTGGG + Intergenic
971022567 4:22552343-22552365 CAGAAATCTGGGATCAGCTTAGG + Intergenic
971194427 4:24458289-24458311 CAGGAGTTTAAGAGCAGCCTGGG + Intergenic
971302074 4:25450202-25450224 CAGGAGTCTGAGAGCAGCCTGGG + Intergenic
971367922 4:25992487-25992509 CAGAAGTTTAAGATCAGCCTGGG - Intergenic
971407035 4:26331293-26331315 CAGAAGTTTAAGATCAGCCTGGG - Intronic
971463687 4:26930916-26930938 CAGAAATCTTAGTGCAGCTTAGG + Intronic
971875500 4:32302454-32302476 CAGAAATCCAAGACCAGCCTGGG + Intergenic
972365482 4:38370657-38370679 CAGAAGTTCAAGAGCAGCCTGGG - Intergenic
972409708 4:38781212-38781234 CAGGAGTTTAAGAGCAGCCTTGG - Intronic
972525315 4:39904735-39904757 CAGAAATTTGAGACCAGCCTAGG - Intronic
972647744 4:40985121-40985143 CAGAAGTCTGAGACCAGCCTGGG - Intronic
972779228 4:42271567-42271589 CAGGAGTCTGGGACCAGCCTGGG - Intergenic
972787771 4:42343665-42343687 CAGAAGTTTAAGACCAGCCTGGG + Intergenic
973265922 4:48210272-48210294 CAGAAGTTTAAGACCAGCCTAGG + Intronic
973309657 4:48694861-48694883 CAGGAATCTGAGACCAGCCTGGG + Intronic
973372754 4:49265142-49265164 CAGAAATTTGAGACCAGCCTGGG + Intergenic
973388241 4:49529919-49529941 CAGAAATTTGAGACCAGCCTGGG - Intergenic
973545495 4:51977476-51977498 CAGGAATCCAAGATCAGCCTGGG + Intergenic
973548562 4:52007392-52007414 CAGAAATTTGAGAACAGCCTGGG - Intronic
973739241 4:53903122-53903144 CAGAAATTCAAGACCAGCCTAGG + Intronic
973949213 4:55994336-55994358 CAGGAATTCAAGAGCAGCCTGGG + Intronic
973951808 4:56022885-56022907 CAGGAATTTAAGACCAGCCTGGG + Intronic
973962860 4:56129274-56129296 CAGAAATTCAGGACCAGCCTGGG - Intergenic
974005262 4:56550194-56550216 CAGGAATTTGGGACCAGCCTGGG - Intronic
974007987 4:56578867-56578889 CAGAAATTCAAGACCAGCCTGGG + Intronic
974112517 4:57542199-57542221 CAGGAGTAGAGGAGCAGCCTTGG + Intergenic
974183996 4:58422392-58422414 CAGAAATTTGAGACCAGCCTGGG + Intergenic
974504893 4:62756991-62757013 CAGGAATTTAAGACCAGCCTGGG + Intergenic
974973607 4:68862130-68862152 CAGGAATTTAAGACCAGCCTGGG - Intergenic
975328508 4:73087291-73087313 CAGAAATTTAAGACCTGCCTGGG - Intronic
975697246 4:77025326-77025348 CAGGAATTTAAGACCAGCCTGGG + Intronic
975933276 4:79552952-79552974 CAGAAGTTCAAGAGCAGCCTGGG - Intergenic
976193514 4:82511673-82511695 CAGAAATTCAGGACCAGCCTGGG - Intronic
976212567 4:82686212-82686234 CAGAAGTTTAAGACCAGCCTGGG - Intronic
976271396 4:83234195-83234217 CAGAAATTTGAGACCAGCCTGGG - Intergenic
976283046 4:83344224-83344246 CAGGAGTTCAGGAGCAGCCTGGG + Intergenic
976616451 4:87082635-87082657 CAGGAGTCTGAGAGCAGCCTGGG - Intronic
977155013 4:93560686-93560708 CAGGAATCTGAGACCAGCCTGGG - Intronic
977190825 4:93998929-93998951 CAGGAATTCAGGACCAGCCTGGG + Intergenic
977490781 4:97707309-97707331 CAGAAGTCCAAGACCAGCCTGGG + Intronic
977521980 4:98096184-98096206 CAGAAGTTTAAGACCAGCCTGGG + Intronic
977607930 4:99000911-99000933 CAGAAATTCAAGACCAGCCTGGG - Intronic
977694923 4:99954621-99954643 CAGAAATTCAAGACCAGCCTGGG + Intergenic
977924190 4:102681286-102681308 CAGTGAGCTATGAGCAGCCTGGG + Intronic
978194132 4:105950829-105950851 CAGAAATTCAAGACCAGCCTGGG - Intronic
978496247 4:109362265-109362287 CAGCAACATAGAAGCAGCCTGGG + Intergenic
978512795 4:109539314-109539336 CAGAAGTTTAAGACCAGCCTGGG - Intronic
978548955 4:109903588-109903610 CAGAAGTCTGAGACCAGCCTGGG + Intergenic
978947070 4:114512590-114512612 CAGGAATTCAGGACCAGCCTGGG - Intergenic
979014103 4:115410338-115410360 CAGAAGTTTAAGACCAGCCTGGG + Intergenic
979014251 4:115412512-115412534 CAGAAGTTCAAGAGCAGCCTGGG + Intergenic
979180478 4:117720753-117720775 CAGAAATGTTGAAGCAGCTTTGG + Intergenic
980114070 4:128662649-128662671 CAGGAGTTTAGGATCAGCCTGGG - Intergenic
980345526 4:131611763-131611785 CAGAAGTTTGGGAACAGCCTGGG + Intergenic
980406452 4:132358631-132358653 CATAAGTTTGGGAGCAGCCTAGG + Intergenic
980947341 4:139335109-139335131 CAGAAATTCAAGATCAGCCTGGG + Intronic
980984406 4:139681980-139682002 CAGAAGTTCAAGAGCAGCCTGGG + Intronic
980986427 4:139699828-139699850 CAGAAATTCACGACCAGCCTGGG + Intronic
980999043 4:139810396-139810418 CAGAAATTTGAGATCAGCCTGGG - Intronic
981792269 4:148551909-148551931 CAGGAATTCAGGACCAGCCTGGG + Intergenic
981977590 4:150749359-150749381 CAGGAATTTAAGATCAGCCTGGG + Intronic
982029330 4:151283730-151283752 CAGGAATTTGGGATCAGCCTGGG - Intronic
982179073 4:152733279-152733301 CAGAAGTTCAGGAACAGCCTGGG - Intronic
982349711 4:154401378-154401400 TAAAAATCTAGGAGCAGAATTGG + Intronic
982665919 4:158263240-158263262 CAGAAGTTCAAGAGCAGCCTTGG - Intergenic
983196611 4:164813549-164813571 CAGAAATTCAAGACCAGCCTGGG + Intergenic
983726174 4:170929563-170929585 CAGAAATTCAAGATCAGCCTGGG + Intergenic
984237138 4:177173356-177173378 CACAAATTTAAGACCAGCCTGGG + Intergenic
984641340 4:182167662-182167684 CAGAAATTTGAGACCAGCCTGGG + Intronic
984816422 4:183841419-183841441 CAGGAATATAAGACCAGCCTGGG - Intergenic
984974213 4:185216003-185216025 CAGAAATCTGAGACCAGCCTGGG - Intronic
984988920 4:185359142-185359164 CAGAAGTTTACGACCAGCCTGGG + Intronic
985022601 4:185708055-185708077 CTGAAGCCTAGGAGAAGCCTGGG - Intronic
985388390 4:189468597-189468619 TAGAAATCGAGAAGGAGCCTGGG + Intergenic
985753328 5:1696475-1696497 CAGGAATTTGAGAGCAGCCTGGG + Intergenic
986659509 5:10046366-10046388 CAGGAATTCAGGACCAGCCTGGG + Intergenic
986736060 5:10668146-10668168 CAGACATTCAAGAGCAGCCTGGG - Intergenic
986984524 5:13485129-13485151 CAGAAGTTTAAGACCAGCCTGGG + Intergenic
987304444 5:16624553-16624575 CAGAAGTCCAAGACCAGCCTGGG - Intergenic
987520303 5:18973829-18973851 CAGGAATTTTGGACCAGCCTGGG + Intergenic
988397885 5:30719288-30719310 CAGAAGTTTAGGACCCGCCTGGG - Intergenic
989395011 5:40945654-40945676 CAGGAATTTGGGACCAGCCTGGG + Intronic
989497675 5:42127874-42127896 CACATATATAAGAGCAGCCTGGG - Intergenic
989767364 5:45103401-45103423 CAGAAATGTAGAAGCAACTTTGG + Intergenic
989829965 5:45904343-45904365 CAGAAGTCTGAGACCAGCCTGGG - Intergenic
990433269 5:55759097-55759119 CAGAAATTTGAGACCAGCCTGGG - Intronic
990584478 5:57197120-57197142 CAGGAATTTAAGATCAGCCTGGG - Intronic
990771626 5:59252733-59252755 CAGGAATGTAAGACCAGCCTGGG - Intronic
991313189 5:65268936-65268958 CAGAAAACTATGAGCAGCTTTGG + Intronic
991364836 5:65857923-65857945 CAGGAATCTCAGACCAGCCTGGG - Intronic
991489725 5:67170764-67170786 CAGAAATCTAGGATCTGACTCGG - Intergenic
991735032 5:69624075-69624097 TAGAAGTCTGAGAGCAGCCTGGG - Intergenic
991779946 5:70122644-70122666 TAGAAGTCTGAGAGCAGCCTGGG + Intergenic
991811466 5:70479211-70479233 TAGAAGTCTGAGAGCAGCCTGGG - Intergenic
991859233 5:70998072-70998094 TAGAAGTCTGAGAGCAGCCTGGG + Intronic
991872393 5:71122965-71122987 TAGAAGTCTGAGAGCAGCCTGGG + Intergenic
991901096 5:71461394-71461416 CAGGAATTTGAGAGCAGCCTTGG + Intronic
992137480 5:73761902-73761924 CAGAAGTCTGAGACCAGCCTGGG - Intronic
992234358 5:74693948-74693970 CAGAAGTCTGAGACCAGCCTGGG + Intronic
992250186 5:74868214-74868236 CAGAAGTTCAGGACCAGCCTGGG - Intergenic
992544972 5:77804592-77804614 CAGAAGTTTACGACCAGCCTGGG + Intronic
992556458 5:77908140-77908162 CAGAAATTTGAGACCAGCCTAGG - Intergenic
992981806 5:82182951-82182973 CAGAAGTTCAAGAGCAGCCTGGG - Intronic
993122476 5:83793421-83793443 CAGAAATTTTGGACCAGCCTGGG - Intergenic
993176835 5:84497375-84497397 CAGGAATCTGAGACCAGCCTGGG - Intergenic
993716198 5:91278024-91278046 CAGAAATTTGAGACCAGCCTGGG + Intergenic
993810790 5:92473382-92473404 CTGAAAAGTAGGAGCAGCTTTGG + Intergenic
994130072 5:96217247-96217269 CAGAAGTATAGGACCAGCCTGGG - Intergenic
994577110 5:101592608-101592630 CAGAAGTTTAAGAGCAGCCTGGG + Intergenic
995298510 5:110549404-110549426 CAGAAATGTGAGACCAGCCTGGG + Intronic
995523225 5:113030468-113030490 CAGAAATTGAAGACCAGCCTGGG + Intronic
996072963 5:119155628-119155650 CAGGAGTTTAGGATCAGCCTGGG + Intronic
996245284 5:121256112-121256134 CAGGAATCTGGAAGCAGCTTTGG - Intergenic
996268387 5:121571704-121571726 CAAAAATTTATGAGCAGACTGGG - Intergenic
996711637 5:126548849-126548871 CAGGAATTTAAGACCAGCCTGGG + Intronic
997082637 5:130758695-130758717 CAGGAATCTGAGACCAGCCTGGG + Intergenic
997323878 5:133003562-133003584 CAGAAGTCTAAGAACAGCCTAGG - Intronic
997538650 5:134642575-134642597 CAGGAGTTTGGGAGCAGCCTGGG + Intronic
997557367 5:134812271-134812293 CAGGAATCTGAGACCAGCCTGGG - Intronic
997895812 5:137716256-137716278 CAGAAATCTGAGGCCAGCCTGGG - Intronic
997937338 5:138124727-138124749 CAGAAGTTTGAGAGCAGCCTGGG - Intronic
997958586 5:138300353-138300375 CAGGAGTCTAAGACCAGCCTGGG + Intronic
998034665 5:138904746-138904768 CAGGAATCTGAGACCAGCCTGGG + Intronic
998070161 5:139191568-139191590 CAGGAATTTAAGATCAGCCTGGG + Intronic
998197166 5:140084212-140084234 CAGGAATTTGAGAGCAGCCTGGG - Intergenic
998487885 5:142519329-142519351 CAGAAGTTTGGGACCAGCCTGGG - Intergenic
999777831 5:154824878-154824900 CAGGAATTTGAGAGCAGCCTTGG + Intronic
999985245 5:156997864-156997886 CAGAAGTTCAGGACCAGCCTGGG + Intergenic
999993372 5:157068817-157068839 CAGGAATCTGAGACCAGCCTAGG - Intergenic
1000051776 5:157569465-157569487 CAGGAATTTAAGACCAGCCTGGG - Intronic
1000224344 5:159245326-159245348 CAGAAATTTGAGACCAGCCTGGG - Intergenic
1000234956 5:159349228-159349250 CAGGAATTTAAGACCAGCCTGGG - Intergenic
1000726268 5:164774920-164774942 CAGAAGTTTGAGAGCAGCCTGGG - Intergenic
1000836514 5:166161271-166161293 CAGGAATCTGAGACCAGCCTGGG + Intergenic
1001068831 5:168565812-168565834 CAGAAGTTCAAGAGCAGCCTGGG + Intronic
1001148035 5:169202021-169202043 CAGAAGTTTGAGAGCAGCCTGGG + Intronic
1001389097 5:171364480-171364502 CAGAAGTTTAAGACCAGCCTGGG + Intergenic
1002141713 5:177145490-177145512 CAGAAATTCAAGACCAGCCTGGG - Intronic
1002348373 5:178563738-178563760 CAGGAATTTGGGACCAGCCTGGG - Intronic
1002556566 5:180046243-180046265 CAGAACTCCAGGGCCAGCCTCGG + Intronic
1002610479 5:180414796-180414818 CAGGAATTTGAGAGCAGCCTGGG + Intergenic
1003055409 6:2813742-2813764 CAGAAGTCCAAGACCAGCCTAGG + Intergenic
1003141647 6:3476599-3476621 CAGAAATCATGGAGCAGGCTGGG - Intergenic
1003229543 6:4239663-4239685 CAGGAGTTTAGGACCAGCCTGGG - Intergenic
1003250190 6:4421272-4421294 CAGATGTTCAGGAGCAGCCTGGG + Intergenic
1003638681 6:7858291-7858313 CAGAAATTTGAGACCAGCCTGGG - Intronic
1003809138 6:9759860-9759882 CAGAAGTTTAAGACCAGCCTGGG + Intronic
1004079264 6:12375049-12375071 CAGAAGTTTAAGACCAGCCTAGG - Intergenic
1004356230 6:14932135-14932157 CAGAAATTCAAGAGTAGCCTAGG + Intergenic
1004389516 6:15198320-15198342 CAGAAATTTAAAAACAGCCTGGG - Intergenic
1004451144 6:15747864-15747886 CAGGAATTTGGGACCAGCCTGGG + Intergenic
1004598636 6:17126124-17126146 CAGAAATTCAAGACCAGCCTGGG - Intronic
1004599047 6:17129893-17129915 CAGAAATTTAAGACCAGCCTGGG - Intronic
1004607734 6:17209576-17209598 CAGGAATTCAAGAGCAGCCTGGG - Intergenic
1004703523 6:18101519-18101541 CAGGAGTTTAAGAGCAGCCTGGG + Intergenic
1004920799 6:20373661-20373683 CAGAGAGCCAGCAGCAGCCTAGG + Intergenic
1005290122 6:24371393-24371415 CAGGAATTCAAGAGCAGCCTGGG + Intergenic
1005308719 6:24538685-24538707 CAGGAATTTAAGACCAGCCTGGG + Intergenic
1006085690 6:31593242-31593264 TAGAAATCTTGGAGTAGCCCTGG - Intergenic
1006115191 6:31772445-31772467 CAGAAAATTAGCAGCAACCTGGG - Intronic
1006123666 6:31823194-31823216 CAGAAGTCCAAGATCAGCCTGGG - Intergenic
1006316913 6:33296813-33296835 CAGAAATCTAGGTGCAGAGTGGG - Intronic
1006518617 6:34558574-34558596 CAGCAAGCTAGAAGGAGCCTGGG + Intergenic
1006567962 6:34975548-34975570 CAGGAATTTGGGACCAGCCTGGG + Intronic
1006643599 6:35501291-35501313 CAGGAATTTAAGACCAGCCTGGG + Intronic
1006753892 6:36397789-36397811 CAGGAATCCAGGACCAGCCTGGG + Intronic
1006859195 6:37158690-37158712 CAGGAGTTCAGGAGCAGCCTGGG - Intergenic
1006862908 6:37185100-37185122 CAGAAATTTGAGACCAGCCTGGG - Intergenic
1006969475 6:38026637-38026659 CAGAAGTTCAGGATCAGCCTGGG - Intronic
1006995321 6:38254402-38254424 AAGAAATCTTGGCCCAGCCTAGG + Intronic
1007435692 6:41809118-41809140 CAGAAGTTTAAGACCAGCCTGGG - Intronic
1007743087 6:44024747-44024769 CAGAAAGCTAGAGGGAGCCTGGG - Intergenic
1008740411 6:54600223-54600245 CAGGAATTCAGGACCAGCCTGGG - Intergenic
1008758515 6:54826076-54826098 CAGTGATATAGGAGGAGCCTAGG + Intergenic
1008809700 6:55481170-55481192 CAGAAATTCAAGACCAGCCTGGG + Intronic
1008914221 6:56769605-56769627 CAGGAATTCAGGACCAGCCTGGG + Intronic
1009412558 6:63383169-63383191 CAGAAATTTGAGACCAGCCTGGG - Intergenic
1009651771 6:66485280-66485302 CAGAAATTCAAGACCAGCCTGGG + Intergenic
1009759892 6:67991889-67991911 CAGAAATTTGAGATCAGCCTGGG + Intergenic
1009971952 6:70634191-70634213 CAGAAGTTTAGGACCAGCCTGGG + Intergenic
1010234509 6:73563973-73563995 CAGAAATTTGAGACCAGCCTGGG + Intergenic
1010410833 6:75559647-75559669 CAGAAATTTGAGACCAGCCTTGG + Intergenic
1010422494 6:75691050-75691072 CAGAAATTTGAGACCAGCCTGGG - Intronic
1010525454 6:76895169-76895191 CAGAAATGTGGAAGCAACCTTGG - Intergenic
1010759482 6:79706622-79706644 CAGGAATCCAAGACCAGCCTGGG + Intergenic
1010936052 6:81863005-81863027 CATAAATATACCAGCAGCCTGGG - Intergenic
1011212831 6:84972524-84972546 CAGAAATTTGAGACCAGCCTGGG - Intergenic
1011280479 6:85672216-85672238 CAGGAGTTTAAGAGCAGCCTGGG + Intergenic
1011281411 6:85681369-85681391 CAGGAATTTGGGACCAGCCTGGG + Intergenic
1011491498 6:87898210-87898232 CAGGAATTTAAGACCAGCCTGGG - Intergenic
1011577358 6:88817431-88817453 CAGGAATTTAAGACCAGCCTGGG + Intronic
1011585111 6:88916262-88916284 CAGAAGTTCAGGACCAGCCTGGG + Intronic
1011597244 6:89027666-89027688 CAGGAATTCAGGACCAGCCTGGG - Intergenic
1011605896 6:89104842-89104864 CAGGAATTTAAGACCAGCCTGGG + Intronic
1011647119 6:89470408-89470430 CAGAAATTCAAGATCAGCCTGGG + Intronic
1011658870 6:89576971-89576993 CAGAAGTTTAGGACCAGCCTAGG - Intronic
1011707279 6:90013990-90014012 CAGGAATTCAAGAGCAGCCTGGG - Intronic
1011857180 6:91708557-91708579 CAGAAGTCTAAGACCAGCCTGGG + Intergenic
1012115202 6:95288102-95288124 CTAAAATCTAGGATCATCCTTGG - Intergenic
1012553664 6:100487567-100487589 CAGAAATGTGGGAGCAGAATTGG + Intergenic
1013019360 6:106197310-106197332 GAGAAATGTAAGACCAGCCTGGG + Intronic
1013136721 6:107289489-107289511 CAGGAATCTGAGACCAGCCTGGG + Intronic
1013154045 6:107476128-107476150 CAGAAGTTTAAGACCAGCCTTGG - Intergenic
1013351117 6:109306703-109306725 CAGGAATCTGGGAGCAGCTCAGG + Intergenic
1013365238 6:109432668-109432690 CAGGAATTCAGGACCAGCCTAGG - Intronic
1013484817 6:110586784-110586806 CAGAAATTCAAGACCAGCCTGGG + Intergenic
1013518768 6:110913695-110913717 CAGAAGTTTGAGAGCAGCCTGGG - Intergenic
1014095397 6:117454276-117454298 CAGAAATTTGAGACCAGCCTGGG + Intronic
1014153095 6:118081420-118081442 CAGAAGTTTGGGACCAGCCTGGG + Intronic
1014212051 6:118718038-118718060 CAGGAATTTAAGACCAGCCTGGG + Intergenic
1014267508 6:119297856-119297878 CAGAAGTTCAAGAGCAGCCTGGG - Intronic
1014456486 6:121640750-121640772 CAGAAGTTAAAGAGCAGCCTGGG - Intergenic
1014921397 6:127218004-127218026 CAGAAATTTAAGACAAGCCTGGG - Intergenic
1014936706 6:127394203-127394225 CAGAAGTTTAAGACCAGCCTGGG - Intergenic
1015029042 6:128571863-128571885 CAGGAATTTGGGACCAGCCTGGG + Intergenic
1015352202 6:132233493-132233515 CAGAAGTTTGGGACCAGCCTGGG - Intergenic
1015611901 6:135031518-135031540 CAGGAATCTAGTATCATCCTTGG - Intronic
1015831187 6:137370697-137370719 CTGTAATGTAGGAGCAGCCTTGG + Intergenic
1015932091 6:138371345-138371367 CAGAAATTTGAGAGCAGCCTGGG + Intergenic
1015998977 6:139023674-139023696 CAGGAATTCAGGAGCAGCCTGGG - Intergenic
1016210088 6:141521277-141521299 CAGGAATCTGGGACCAGCCTGGG - Intergenic
1016352371 6:143182240-143182262 CAGAAATTTGAGATCAGCCTAGG - Intronic
1016493874 6:144637176-144637198 CAGGAGTTTGGGAGCAGCCTGGG - Intronic
1016971037 6:149764526-149764548 CAGAAATTTGAGACCAGCCTGGG + Intronic
1017180755 6:151549633-151549655 CAGGAGTTTAGGACCAGCCTGGG - Intronic
1017409364 6:154151964-154151986 CAGAAGTTTAAGACCAGCCTGGG + Intronic
1017870749 6:158484357-158484379 CAGAAGTTTAAGACCAGCCTGGG - Intronic
1018008734 6:159648440-159648462 CAGAAGTCTGAGACCAGCCTGGG + Intergenic
1018013214 6:159690385-159690407 CAGGAATTCAAGAGCAGCCTGGG + Intronic
1018531749 6:164771771-164771793 CAGGAGTCTGAGAGCAGCCTGGG - Intergenic
1018921960 6:168181590-168181612 CAGGTATGTAGGACCAGCCTTGG - Intergenic
1019558318 7:1643452-1643474 CAGGAATTTAAGACCAGCCTGGG - Intergenic
1019679847 7:2340973-2340995 CAGGAATTTAAGACCAGCCTGGG + Intronic
1019793937 7:3035897-3035919 AAAAAATCTGGAAGCAGCCTGGG - Intronic
1020148022 7:5660159-5660181 CAGAAATTTGAGAGCACCCTGGG - Intronic
1020653469 7:10903000-10903022 CAGGAGTCTAAGACCAGCCTGGG - Intergenic
1020777549 7:12473577-12473599 CAGGAATTCAAGAGCAGCCTGGG - Intergenic
1021010978 7:15465652-15465674 CAGGAGTTTTGGAGCAGCCTGGG - Intronic
1021394755 7:20133443-20133465 CAGAAGTTTGGGACCAGCCTGGG - Intergenic
1021502777 7:21348454-21348476 CAGAAATTCAATAGCAGCCTGGG + Intergenic
1021719472 7:23491677-23491699 AAGAAAGCTAAGAGCAGCTTGGG - Intergenic
1022294230 7:29034746-29034768 CAGAAGTTTGAGAGCAGCCTTGG - Intronic
1022374073 7:29797114-29797136 TAGAAATCAAGGAGAAGACTAGG + Intergenic
1022462030 7:30618423-30618445 CAGAAATTTGAGACCAGCCTGGG + Intronic
1022733699 7:33056426-33056448 CAGGAATTTAAGACCAGCCTGGG + Intronic
1022733821 7:33057311-33057333 CAGCAATCTGAGAACAGCCTGGG + Intronic
1022828842 7:34044631-34044653 GAGGAATCTCAGAGCAGCCTGGG + Intronic
1022960395 7:35420327-35420349 TACAAGTTTAGGAGCAGCCTTGG - Intergenic
1023053061 7:36269685-36269707 CAGGAGTTTAAGAGCAGCCTGGG + Intronic
1023146232 7:37153538-37153560 CAGCAATCTAAGATCAACCTGGG + Intronic
1023313910 7:38915723-38915745 CAGAAAGATAGGAGAAGCCTGGG + Intronic
1023404660 7:39820089-39820111 CAGAAATTTGAGACCAGCCTGGG + Intergenic
1023533545 7:41183652-41183674 CAGGAGTTTAAGAGCAGCCTGGG - Intergenic
1023789548 7:43742354-43742376 CAGGAATCCAAGATCAGCCTAGG + Intergenic
1023961891 7:44934257-44934279 CAGGAATTTAAGACCAGCCTGGG - Intergenic
1023971689 7:44996224-44996246 CAGGAATTTGAGAGCAGCCTGGG + Intergenic
1024190569 7:47002948-47002970 CAGAAATTTGAGACCAGCCTGGG - Intergenic
1026012473 7:66647437-66647459 CAGGAGTCCAGGACCAGCCTGGG + Intronic
1026059343 7:67012141-67012163 CAGACATGTAAGAACAGCCTGGG + Intronic
1026108048 7:67436628-67436650 CAGGAATCTGAGACCAGCCTGGG + Intergenic
1026188901 7:68106552-68106574 CAGGAGTTGAGGAGCAGCCTGGG - Intergenic
1026388310 7:69874182-69874204 CAGGAGTTTAAGAGCAGCCTTGG + Intronic
1026398650 7:69985969-69985991 CAGAAGTTCAGGACCAGCCTGGG - Intronic
1026567482 7:71501474-71501496 CAGAAATTTGAGACCAGCCTGGG - Intronic
1026572067 7:71540000-71540022 CAGGAGTTTAGGACCAGCCTCGG - Intronic
1026687770 7:72526185-72526207 CAGGAGTCCAGGACCAGCCTGGG + Intergenic
1026722991 7:72848026-72848048 CAGGAGTCCAGGACCAGCCTGGG + Intergenic
1026838517 7:73654274-73654296 CAGGAATTTGAGAGCAGCCTGGG + Intergenic
1026985192 7:74550697-74550719 CAGGAATTTGAGAGCAGCCTGGG + Intronic
1027198064 7:76044902-76044924 CAGGAATTCAGGACCAGCCTGGG - Intronic
1027311229 7:76955185-76955207 CAGAAGTTTAAGACCAGCCTGGG - Intergenic
1027341519 7:77213299-77213321 CAGGAATTTAAGACCAGCCTGGG - Intronic
1027392967 7:77723984-77724006 CAGAAATTCAAGACCAGCCTGGG - Intronic
1028207998 7:88038987-88039009 CAGAAGTCTGAGACCAGCCTGGG - Intronic
1028915587 7:96255475-96255497 CAGAAGTTTAAGACCAGCCTGGG + Intronic
1029091931 7:98055275-98055297 CAGGAATTCAGGACCAGCCTGGG + Intergenic
1029191521 7:98775569-98775591 CAGAAATTTGAGACCAGCCTGGG + Intergenic
1029520389 7:101057532-101057554 CAGGAGTTTAGGACCAGCCTGGG + Intronic
1029545742 7:101209747-101209769 CAGAAGTCCAAGACCAGCCTGGG - Intronic
1029630302 7:101746112-101746134 CAGGAGTCCAGGACCAGCCTGGG - Intergenic
1029644746 7:101846921-101846943 CAGGAATTCAAGAGCAGCCTGGG + Intronic
1029929342 7:104354302-104354324 TAGAAATCTAGGGGCAATCTGGG - Intronic
1030056835 7:105590670-105590692 CAGGAATTTAAGACCAGCCTGGG - Intronic
1030234261 7:107241988-107242010 CAGGAATTCAGGACCAGCCTAGG - Intronic
1030264089 7:107598861-107598883 CAGGAATTTAAGACCAGCCTGGG + Intronic
1030310602 7:108065114-108065136 CAGGAATCCAAGACCAGCCTGGG - Intronic
1030753943 7:113266480-113266502 CAGAAATTTGAGACCAGCCTGGG + Intergenic
1030872735 7:114776766-114776788 CAGAAGTTTGGGACCAGCCTGGG - Intergenic
1030884247 7:114919493-114919515 CAGCACTCTAGGACCAGCCTGGG - Intergenic
1031039776 7:116827197-116827219 CAGGAATTTAAGACCAGCCTGGG - Intronic
1031393015 7:121238946-121238968 CAGAAGACTATGAGCAGCCAGGG + Intronic
1032175780 7:129624721-129624743 CAGGAGTCTGAGAGCAGCCTGGG - Intronic
1032216059 7:129958251-129958273 CAGGAATTTAAGAGCAGTCTGGG - Intergenic
1032338969 7:131053315-131053337 CAGGAATCTGAGACCAGCCTGGG - Intergenic
1032563523 7:132916786-132916808 CAGAAATTTGAGACCAGCCTGGG - Intronic
1032609761 7:133400105-133400127 CTGAGATATATGAGCAGCCTGGG + Intronic
1032727190 7:134601528-134601550 CAGGAGTTTAAGAGCAGCCTGGG + Intergenic
1032817809 7:135495168-135495190 ATGAAATTTAAGAGCAGCCTGGG + Intronic
1032991683 7:137401321-137401343 CAGGAATTCAAGAGCAGCCTGGG + Intronic
1033089879 7:138375767-138375789 CAGAAGTTTAAGACCAGCCTGGG + Intergenic
1033117025 7:138634432-138634454 CAGAAATTTAAGACCAGCCTGGG + Intronic
1033229780 7:139587668-139587690 CAGAAGTTTGAGAGCAGCCTGGG + Intronic
1033531009 7:142264177-142264199 CAGGAATTTAAGACCAGCCTTGG - Intergenic
1033567125 7:142589596-142589618 AAGAAGTTTAGGACCAGCCTGGG - Intergenic
1033569646 7:142615288-142615310 CAGGAATTTGGGACCAGCCTGGG + Intergenic
1034500766 7:151448956-151448978 CAGAAATTCAAGACCAGCCTGGG - Intergenic
1034639827 7:152593744-152593766 CAGAAATTCAAGACCAGCCTGGG - Intergenic
1035164715 7:156979714-156979736 CAGAAATTTGAGACCAGCCTGGG - Intergenic
1035187215 7:157135932-157135954 CAGGAATCTGAGACCAGCCTGGG + Intergenic
1035581497 8:742714-742736 CAGGAATCTAAGGCCAGCCTGGG - Intergenic
1035945712 8:3959286-3959308 CAGAAATGTGGGATCAGCCTGGG + Intronic
1036144514 8:6242149-6242171 CAGGAGTTTAGGACCAGCCTGGG + Intergenic
1036159342 8:6371917-6371939 CAGGAATTTGAGAGCAGCCTGGG + Intergenic
1036813836 8:11886578-11886600 CAGAAGTTTAAGACCAGCCTAGG - Intergenic
1037054516 8:14422816-14422838 CAGAAATCTGAGACCAGCCTGGG + Intronic
1037145479 8:15566839-15566861 CAGAAATTTAAGAGCAGCCTGGG - Intronic
1037486113 8:19348303-19348325 CAGAAGTTCAAGAGCAGCCTGGG - Intronic
1037550611 8:19967976-19967998 CAGGAATTTAAGACCAGCCTGGG - Intergenic
1037728099 8:21500753-21500775 CAGAGACCTTGGTGCAGCCTGGG + Intergenic
1037752000 8:21688639-21688661 CAGACAATTAGGATCAGCCTGGG + Intergenic
1037858086 8:22385786-22385808 CAGGAGTTCAGGAGCAGCCTGGG + Intronic
1037937131 8:22922514-22922536 CAGGAATCTGAGACCAGCCTAGG + Intronic
1038041016 8:23724272-23724294 CAGGAATTTAAGACCAGCCTGGG - Intergenic
1038160787 8:25035542-25035564 CAGGAGTCTAAGACCAGCCTGGG - Intergenic
1038330798 8:26607579-26607601 CAGAAATTCAAGACCAGCCTGGG + Intronic
1038435967 8:27536311-27536333 CAGGAGTTTAAGAGCAGCCTGGG - Intronic
1038654925 8:29441405-29441427 CAGGAATCTGGGAGCAGCTTAGG + Intergenic
1038737136 8:30180821-30180843 CAGGAATTTAAGAGCAGCCTGGG + Intronic
1038802914 8:30765480-30765502 CAGAAATTTGAGACCAGCCTGGG - Intronic
1039052835 8:33510583-33510605 CAGGAATTCAGGACCAGCCTGGG - Intronic
1039055148 8:33530176-33530198 ATGAAATTTAGGATCAGCCTTGG + Intergenic
1039269059 8:35860928-35860950 CAGAAATCCAAAACCAGCCTGGG - Intergenic
1039482474 8:37884889-37884911 CAGGAATTTAAGACCAGCCTGGG - Intronic
1039830410 8:41209184-41209206 CAGAAATTCAAGACCAGCCTGGG + Intergenic
1039901810 8:41758114-41758136 CAGAAAGCTGGTAGCAGCATCGG + Exonic
1040799302 8:51323495-51323517 CAGGAGTTTAGGATCAGCCTGGG - Intronic
1040857844 8:51968875-51968897 CAGAAATTAAAGACCAGCCTGGG - Intergenic
1041261181 8:56021752-56021774 CAGAAATTTGAGACCAGCCTGGG + Intergenic
1041343618 8:56872052-56872074 CAGAAGTTCAGGACCAGCCTGGG - Intergenic
1041751144 8:61262222-61262244 CAGAAGTTCAAGAGCAGCCTGGG - Intronic
1042016053 8:64313107-64313129 CAGAAGTTTAAGACCAGCCTAGG + Intergenic
1042273871 8:66982989-66983011 CAGGAATACAAGAGCAGCCTGGG - Intronic
1042596952 8:70459933-70459955 CAGCAATCCAAGACCAGCCTGGG - Intergenic
1043082844 8:75786828-75786850 CAGAAGTTTGAGAGCAGCCTGGG - Intergenic
1043400373 8:79878712-79878734 CAGAAGTCTGAGACCAGCCTGGG + Intergenic
1043414322 8:80032493-80032515 CAGAAGTTTAGGGCCAGCCTGGG + Intronic
1043439864 8:80267499-80267521 CAGAAATTTGAGAACAGCCTGGG + Intergenic
1043788973 8:84438598-84438620 CAGGAATCTGAGACCAGCCTGGG - Intronic
1044139708 8:88635246-88635268 CAGGAATTTAAGATCAGCCTGGG + Intergenic
1044318821 8:90779513-90779535 CAGGAATCCAAGACCAGCCTGGG - Intronic
1044363543 8:91316514-91316536 CAGAAATTTGAGAGAAGCCTGGG - Intronic
1044572051 8:93730950-93730972 CAGAAATTTGAGAACAGCCTGGG + Exonic
1044701882 8:94972680-94972702 CAGGAGTTTAGGACCAGCCTGGG + Intronic
1044814748 8:96100085-96100107 CAGAAATTTGAGACCAGCCTGGG + Intergenic
1044972547 8:97634090-97634112 CAGGAGTCTGGGACCAGCCTAGG - Intergenic
1045017800 8:98013898-98013920 CAGAAATTTAAGACCAGCCTGGG + Intronic
1045061877 8:98418118-98418140 CAGGAATTTAAGACCAGCCTGGG - Intronic
1045182612 8:99801939-99801961 CAGAAGTTCAAGAGCAGCCTGGG + Intronic
1045267817 8:100635177-100635199 CAGAAATTTGAGACCAGCCTGGG + Intronic
1045371734 8:101531020-101531042 CAGAAGTCCAAGACCAGCCTGGG + Intronic
1045513867 8:102839223-102839245 CAGGAGTTTAGGATCAGCCTGGG - Intronic
1045541797 8:103093571-103093593 CAGATATTTAAGACCAGCCTGGG - Intergenic
1045791662 8:105990883-105990905 CAGACATCCTGGACCAGCCTGGG - Intergenic
1045886949 8:107109309-107109331 CAGGAATTTGGGACCAGCCTTGG - Intergenic
1046275913 8:111959410-111959432 CAGAAGTTTAAGACCAGCCTGGG - Intergenic
1046380475 8:113444099-113444121 TAGAAAGCTAAGAGCAGCCAGGG + Intergenic
1046816210 8:118586549-118586571 CAGGAGTCTAAGACCAGCCTGGG - Intronic
1047151294 8:122266254-122266276 TAGAAAGCTAGGAGGGGCCTTGG - Intergenic
1047236913 8:123050133-123050155 CAGAAGTTTGGGACCAGCCTGGG + Intronic
1047462417 8:125079397-125079419 CAGACATTTAAGACCAGCCTGGG - Intronic
1047976970 8:130140247-130140269 CAGGAGTTTAAGAGCAGCCTGGG - Intronic
1048609689 8:136008954-136008976 CAGGAATTTAAGACCAGCCTGGG - Intergenic
1048741660 8:137567397-137567419 CAGAAGTTTAAGACCAGCCTGGG - Intergenic
1048884810 8:138901573-138901595 CAGAAATTTGAGACCAGCCTAGG - Intronic
1049408713 8:142463011-142463033 CACAAATTTAGGGTCAGCCTGGG + Intronic
1049736824 8:144212291-144212313 CAGGAATCCAGGACCAGCCTGGG - Intronic
1049917506 9:332864-332886 CAGAATTATGAGAGCAGCCTGGG - Intronic
1049958390 9:714028-714050 CAGAAATTTGAGACCAGCCTGGG + Intronic
1049970106 9:814557-814579 CAGAAATTTAAGACCAGACTGGG + Intergenic
1050013067 9:1205105-1205127 CAGAAATTCAAGACCAGCCTAGG - Intergenic
1050291693 9:4161979-4162001 CAGAATTCTAGCCTCAGCCTGGG - Intronic
1050318199 9:4424776-4424798 CAGAAGTTTAAGACCAGCCTGGG - Intergenic
1050476699 9:6048065-6048087 CAGGAGTTTAAGAGCAGCCTAGG - Intergenic
1050573978 9:6973249-6973271 CAGAAGTTCAAGAGCAGCCTGGG - Intronic
1050869665 9:10551123-10551145 CAGAAGTCCAAGACCAGCCTGGG + Intronic
1051072965 9:13195077-13195099 CAGAAGTCCAAGACCAGCCTGGG + Intronic
1051144396 9:14010963-14010985 CAGGGATTCAGGAGCAGCCTGGG - Intergenic
1051258579 9:15238775-15238797 CAGAAGTTTAAGACCAGCCTGGG + Intronic
1051625861 9:19099668-19099690 CAGAAATTTGAGACCAGCCTGGG - Intronic
1051628091 9:19117365-19117387 CAGGAATTCAGGACCAGCCTGGG - Intronic
1051993283 9:23180247-23180269 CAGAAATTTGAGACCAGCCTGGG - Intergenic
1052076739 9:24151598-24151620 CAGGAATTCAAGAGCAGCCTTGG + Intergenic
1052191079 9:25662712-25662734 CAGAAGTCTGAGACCAGCCTGGG - Intergenic
1052335274 9:27312783-27312805 CAGGAATCTATGAGCAGCCAAGG + Intergenic
1052819819 9:33129690-33129712 CAGAAAGTTCTGAGCAGCCTGGG + Intronic
1052965596 9:34338282-34338304 CAGAAGTTCAGGATCAGCCTGGG + Intronic
1052967146 9:34348739-34348761 CAGAAATTTCTGAGTAGCCTGGG - Intergenic
1053016232 9:34663841-34663863 CAGGAAGCTGGGAGCTGCCTAGG + Intronic
1053328602 9:37181891-37181913 CAGAAGTTTAAGACCAGCCTGGG - Intronic
1053379872 9:37639867-37639889 CAGGAGTCCAGGACCAGCCTGGG - Intronic
1053380011 9:37641094-37641116 CAGGAGTCCAGGACCAGCCTGGG - Intronic
1053471351 9:38347830-38347852 CAGGAATTCAAGAGCAGCCTGGG + Intergenic
1053655729 9:40216831-40216853 CAGAAATTTGAGACCAGCCTGGG - Intergenic
1053906091 9:42846052-42846074 CAGAAATTTGAGACCAGCCTGGG - Intergenic
1053906257 9:42847412-42847434 CAGAAGTTCAGGACCAGCCTGGG - Intergenic
1054352121 9:64026855-64026877 CAGAAATTTGAGACCAGCCTGGG - Intergenic
1054367847 9:64363061-64363083 CAGAAATTTGAGACCAGCCTGGG - Intergenic
1054528878 9:66159453-66159475 CAGAAATTTGAGACCAGCCTGGG + Intergenic
1054675465 9:67852804-67852826 CAGAAATTTGAGACCAGCCTGGG - Intergenic
1054913380 9:70474348-70474370 CAGGAATTTAAGATCAGCCTGGG - Intergenic
1054918013 9:70513681-70513703 CAGAAATCTGAAAGCAGCCTGGG - Intergenic
1054929326 9:70619621-70619643 CAGAAGTTTAAGACCAGCCTGGG - Intronic
1054945643 9:70793243-70793265 CAGGAATTCAGGATCAGCCTGGG + Intronic
1055209715 9:73776037-73776059 CAGAAGTTTGGGAGCAGCCTGGG + Intergenic
1055310257 9:74972005-74972027 CAGAAGTCCAAGACCAGCCTAGG - Intergenic
1056448331 9:86688501-86688523 CAGAAATTCAAGACCAGCCTGGG - Intergenic
1057372692 9:94488428-94488450 CAGAAATTTGAGACCAGCCTGGG - Intergenic
1057414726 9:94851002-94851024 CAGCAATCTGGTACCAGCCTGGG + Intronic
1058022558 9:100104271-100104293 CAGAAGTTTGAGAGCAGCCTGGG - Intronic
1058444536 9:105043195-105043217 CAGGAGTTTAGGACCAGCCTGGG + Intergenic
1058717632 9:107737113-107737135 CAGAAGTTTGAGAGCAGCCTGGG + Intergenic
1058966497 9:110043925-110043947 CAGAAATTTGAGACCAGCCTGGG - Intronic
1059296790 9:113277791-113277813 CAGGAATCCAAGACCAGCCTGGG + Intronic
1059480183 9:114583299-114583321 CAGAAGTTTAAGACCAGCCTGGG - Intergenic
1059791950 9:117649676-117649698 CAGGAATTCAGAAGCAGCCTGGG + Intergenic
1060048946 9:120363121-120363143 CAGAATTCGAGAACCAGCCTGGG - Intergenic
1060389021 9:123263306-123263328 CAGAAGTCCAAGATCAGCCTGGG + Intronic
1060489698 9:124073640-124073662 CAGAAATTCAAGACCAGCCTGGG + Intergenic
1060516144 9:124266987-124267009 CAGACATGTGGGAGCTGCCTCGG - Intronic
1060554742 9:124502535-124502557 CAGAAGTTTAAGACCAGCCTGGG - Intronic
1060619003 9:125045542-125045564 CAGGAATTTAAGACCAGCCTGGG - Intronic
1060625363 9:125107555-125107577 CAGGAATTCAAGAGCAGCCTGGG + Intronic
1061018751 9:127999922-127999944 CAGAAATTCAAGACCAGCCTGGG + Intergenic
1061139312 9:128754730-128754752 CAGAAATTCAAGATCAGCCTGGG - Intronic
1061156969 9:128869046-128869068 CAGAAATTTGAGACCAGCCTGGG - Intronic
1061186052 9:129054243-129054265 CAGAAATTCAAGACCAGCCTGGG + Intronic
1061437916 9:130578476-130578498 CAGAAATTCAAGACCAGCCTAGG - Intergenic
1061527530 9:131179208-131179230 CAGAAATTTGAGACCAGCCTGGG - Intronic
1061635298 9:131904245-131904267 CAGGAGTCTAAGACCAGCCTGGG - Intronic
1061667455 9:132168849-132168871 CATAATTCTAGGACCAGCTTTGG + Intronic
1061758958 9:132836589-132836611 CAGAAGTTTGAGAGCAGCCTGGG - Intronic
1062235846 9:135507181-135507203 CAGAACTCTAGCAGGACCCTGGG - Intergenic
1062467098 9:136686322-136686344 GAGAAATGTAGCAACAGCCTGGG + Intronic
1062597901 9:137307314-137307336 CACCACTCTGGGAGCAGCCTGGG - Intronic
1203696475 Un_GL000214v1:103166-103188 CAGAAATTTGAGACCAGCCTGGG + Intergenic
1203552747 Un_KI270743v1:177858-177880 CAGAAATTTGAGACCAGCCTGGG - Intergenic
1203639798 Un_KI270751v1:897-919 CAGAAATTTGAGACCAGCCTGGG - Intergenic
1185573752 X:1154290-1154312 AGGAAATCTAGGTGCAGTCTTGG - Intergenic
1186878718 X:13842668-13842690 CAGGAGTTCAGGAGCAGCCTGGG + Intronic
1186987374 X:15031534-15031556 CAGAAATTCAAGACCAGCCTGGG - Intergenic
1187024878 X:15424786-15424808 CAGGAATCTGAGACCAGCCTGGG + Intronic
1187137817 X:16565291-16565313 CAGGAGTCCAGGACCAGCCTGGG + Intergenic
1187381026 X:18802278-18802300 CAGGAATTCAAGAGCAGCCTGGG - Intronic
1187468460 X:19546941-19546963 CAGGAATTTGGGACCAGCCTGGG + Intronic
1187874200 X:23790177-23790199 TAGAATTCTAGGAGCAGACATGG - Intergenic
1187885960 X:23888929-23888951 CAGAAGTTTAAGACCAGCCTGGG + Intronic
1188000319 X:24974298-24974320 TAGAAGTTTAGTAGCAGCCTTGG - Intronic
1188010609 X:25051912-25051934 CAGGAATTCAGGATCAGCCTGGG - Intergenic
1188848551 X:35103855-35103877 CAGAAGTCCAGGAGCATCCTGGG + Intergenic
1189147652 X:38671833-38671855 CAGAAGTTCAAGAGCAGCCTGGG + Intronic
1189271993 X:39758451-39758473 CAGGAGTCTAAGACCAGCCTGGG + Intergenic
1189302319 X:39960893-39960915 CAGGAGTTTAGGACCAGCCTGGG + Intergenic
1189767908 X:44390990-44391012 CAGGAATTTGAGAGCAGCCTGGG - Intergenic
1189784123 X:44543823-44543845 CAGAAGTTTAAGAGCAGCCTGGG - Intergenic
1189993459 X:46616110-46616132 CAGAAATTCAAGACCAGCCTGGG + Intronic
1190047149 X:47121572-47121594 CAGGAATTTAAGACCAGCCTGGG + Intergenic
1190103369 X:47540373-47540395 CAGGAGTCTGGGACCAGCCTGGG + Intergenic
1190407553 X:50102817-50102839 CAGAAGTCTGAGACCAGCCTGGG - Intergenic
1190461345 X:50679124-50679146 CAGAAATGTAGGAGGAGACGTGG - Intronic
1190659793 X:52643590-52643612 CAGGAATTTAAGAACAGCCTGGG + Intergenic
1191750813 X:64540800-64540822 CAGAAGTCTGAGACCAGCCTGGG + Intergenic
1191808128 X:65157187-65157209 CAGAAGTCTGAGACCAGCCTGGG - Intergenic
1191926690 X:66319205-66319227 CAGGAATTTGAGAGCAGCCTGGG + Intergenic
1192122118 X:68466073-68466095 CAGAAATTTGAGACCAGCCTGGG + Intergenic
1192122998 X:68474841-68474863 CAGAGATTTAGAAGCAGACTTGG + Intergenic
1192235566 X:69293484-69293506 CAGGAGTCTGAGAGCAGCCTGGG + Intergenic
1192373546 X:70535813-70535835 CAGAAGTTTGGGACCAGCCTGGG - Intronic
1192752570 X:74009187-74009209 CAGAAGTCTGAGATCAGCCTAGG + Intergenic
1192972016 X:76242285-76242307 CAGAAATTCAAGACCAGCCTTGG + Intergenic
1193200705 X:78687046-78687068 CAGAAATTTGAGATCAGCCTGGG - Intergenic
1193377396 X:80777858-80777880 CAGGAATTTAAGACCAGCCTGGG - Intronic
1193922824 X:87449587-87449609 CAGGATTCCAAGAGCAGCCTGGG + Intergenic
1194646845 X:96468447-96468469 CAGAAATTCAAGACCAGCCTGGG + Intergenic
1195625556 X:107002755-107002777 CAGGAGTCCAAGAGCAGCCTGGG - Intergenic
1195793794 X:108621371-108621393 CAGGAATTTGAGAGCAGCCTGGG - Intronic
1196317745 X:114248884-114248906 CAGAAGTTTAAGACCAGCCTGGG - Intergenic
1196395812 X:115260951-115260973 CAGGCATCTAAGACCAGCCTGGG + Intergenic
1196651813 X:118175605-118175627 CAGGAATTCAGGACCAGCCTAGG + Intergenic
1196744599 X:119058749-119058771 CAGAAGTTTGAGAGCAGCCTGGG - Intergenic
1196760482 X:119196674-119196696 CAGAAATTCAAGACCAGCCTGGG - Intergenic
1196789277 X:119449519-119449541 CAGAAATTCAAGACCAGCCTGGG + Intronic
1196838109 X:119832166-119832188 CAGGAATTTAAGACCAGCCTGGG - Intergenic
1197360406 X:125495069-125495091 CAGAAATCTAGGAGAGTGCTAGG + Intergenic
1197725330 X:129772653-129772675 CAGAAATTTGAGACCAGCCTAGG - Intergenic
1198249732 X:134868318-134868340 CAGAAATTCAAGACCAGCCTGGG - Intergenic
1198427848 X:136537772-136537794 CAGGAATCTAAGACCTGCCTGGG - Intronic
1198620394 X:138501962-138501984 CAGAAATCAGGGAGCAGTCTAGG + Intergenic
1198716923 X:139567549-139567571 CAGAAGTTCAAGAGCAGCCTGGG + Intergenic
1198763950 X:140062264-140062286 CAGGAGTTCAGGAGCAGCCTGGG + Intergenic
1199584728 X:149402456-149402478 CAGGAATTCAAGAGCAGCCTAGG - Intergenic
1200768600 Y:7102953-7102975 CAGAAATGCAGGACCAGCCTGGG + Intergenic
1201154012 Y:11113419-11113441 CAGAAATTTGAGACCAGCCTGGG - Intergenic
1201545023 Y:15152418-15152440 CAGAAATTCAGAAGCAGCCTGGG + Intergenic
1201592661 Y:15632538-15632560 CAGGAGTCTAAGATCAGCCTGGG - Intergenic
1201706698 Y:16945436-16945458 CAGGTATTTGGGAGCAGCCTGGG - Intergenic
1201733055 Y:17226325-17226347 CAGGAATTTAAGACCAGCCTGGG + Intergenic