ID: 932736902

View in Genome Browser
Species Human (GRCh38)
Location 2:74260620-74260642
Sequence AGAAATCTAGGAGCAGCCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 179}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932736888_932736902 18 Left 932736888 2:74260579-74260601 CCACTCAATGCCCCTCCCTCCCA 0: 1
1: 0
2: 4
3: 71
4: 905
Right 932736902 2:74260620-74260642 AGAAATCTAGGAGCAGCCTTGGG 0: 1
1: 0
2: 1
3: 16
4: 179
932736895_932736902 -2 Left 932736895 2:74260599-74260621 CCATCCACCAGCCCTTTAGACAG 0: 1
1: 0
2: 0
3: 20
4: 174
Right 932736902 2:74260620-74260642 AGAAATCTAGGAGCAGCCTTGGG 0: 1
1: 0
2: 1
3: 16
4: 179
932736893_932736902 2 Left 932736893 2:74260595-74260617 CCTCCCATCCACCAGCCCTTTAG 0: 1
1: 0
2: 2
3: 22
4: 261
Right 932736902 2:74260620-74260642 AGAAATCTAGGAGCAGCCTTGGG 0: 1
1: 0
2: 1
3: 16
4: 179
932736889_932736902 8 Left 932736889 2:74260589-74260611 CCCCTCCCTCCCATCCACCAGCC 0: 1
1: 0
2: 17
3: 160
4: 1567
Right 932736902 2:74260620-74260642 AGAAATCTAGGAGCAGCCTTGGG 0: 1
1: 0
2: 1
3: 16
4: 179
932736894_932736902 -1 Left 932736894 2:74260598-74260620 CCCATCCACCAGCCCTTTAGACA 0: 1
1: 0
2: 0
3: 9
4: 146
Right 932736902 2:74260620-74260642 AGAAATCTAGGAGCAGCCTTGGG 0: 1
1: 0
2: 1
3: 16
4: 179
932736897_932736902 -9 Left 932736897 2:74260606-74260628 CCAGCCCTTTAGACAGAAATCTA 0: 1
1: 0
2: 2
3: 17
4: 137
Right 932736902 2:74260620-74260642 AGAAATCTAGGAGCAGCCTTGGG 0: 1
1: 0
2: 1
3: 16
4: 179
932736896_932736902 -6 Left 932736896 2:74260603-74260625 CCACCAGCCCTTTAGACAGAAAT 0: 1
1: 0
2: 3
3: 6
4: 185
Right 932736902 2:74260620-74260642 AGAAATCTAGGAGCAGCCTTGGG 0: 1
1: 0
2: 1
3: 16
4: 179
932736892_932736902 3 Left 932736892 2:74260594-74260616 CCCTCCCATCCACCAGCCCTTTA 0: 1
1: 0
2: 2
3: 28
4: 357
Right 932736902 2:74260620-74260642 AGAAATCTAGGAGCAGCCTTGGG 0: 1
1: 0
2: 1
3: 16
4: 179
932736891_932736902 6 Left 932736891 2:74260591-74260613 CCTCCCTCCCATCCACCAGCCCT 0: 1
1: 0
2: 19
3: 195
4: 2503
Right 932736902 2:74260620-74260642 AGAAATCTAGGAGCAGCCTTGGG 0: 1
1: 0
2: 1
3: 16
4: 179
932736890_932736902 7 Left 932736890 2:74260590-74260612 CCCTCCCTCCCATCCACCAGCCC 0: 1
1: 1
2: 13
3: 245
4: 2374
Right 932736902 2:74260620-74260642 AGAAATCTAGGAGCAGCCTTGGG 0: 1
1: 0
2: 1
3: 16
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932736902 Original CRISPR AGAAATCTAGGAGCAGCCTT GGG Intronic
904875850 1:33653914-33653936 CCAAAGTTAGGAGCAGCCTTTGG + Intronic
907371939 1:54009474-54009496 AGAAGGCTAGGAGCACCCTCAGG - Intronic
909128088 1:71700694-71700716 AGAAATCCAGCAGAAGCCTATGG + Intronic
911945278 1:104099475-104099497 AGTAATTTAGGAGTAGACTTAGG - Intergenic
912734048 1:112134346-112134368 ACAACACTAGAAGCAGCCTTAGG + Intergenic
913656826 1:120968627-120968649 AGGAATGAAGAAGCAGCCTTGGG - Intergenic
916560944 1:165933768-165933790 AGAAAGCGAGGAGCAGCCTAGGG + Intergenic
920386010 1:205570289-205570311 GGAAATCAAGCAGCAGCCTCTGG - Intronic
921651365 1:217682307-217682329 AGATATCTAGAAGCTGACTTAGG + Intronic
922620597 1:226985803-226985825 AGAAATCCAGGTCAAGCCTTGGG + Intronic
922973475 1:229762586-229762608 AGAAATATAAGAGAAGCATTAGG + Intergenic
923083712 1:230685115-230685137 ATAGAACTTGGAGCAGCCTTAGG + Exonic
923952716 1:238977401-238977423 AGAAATCTAGAAGCAGGTATTGG - Intergenic
1063118502 10:3087682-3087704 AGGAAGATAGGAGCAGCCTGGGG + Intronic
1064042250 10:11977389-11977411 AGAACTCCAGGAGCATACTTTGG - Intronic
1064451363 10:15444925-15444947 AGAGATCTAGGAATAGCTTTTGG - Intergenic
1064492018 10:15868332-15868354 AAGAATGTAGAAGCAGCCTTGGG - Intergenic
1068359945 10:55964860-55964882 ATAAATATAGAAGCATCCTTAGG - Intergenic
1069292921 10:66805314-66805336 TCAAACCTAGGAGCAGTCTTAGG + Intronic
1071781714 10:88853511-88853533 AGAAAGCTAGCAGCAACCTTAGG - Intergenic
1071877281 10:89854720-89854742 AGAAATCTTGGGGCAGGGTTTGG + Intergenic
1071991377 10:91103734-91103756 AGAAATGCTGGAGCTGCCTTTGG + Intergenic
1073085850 10:100888227-100888249 GGAAAGGTAGAAGCAGCCTTGGG - Intergenic
1075846698 10:125550839-125550861 AGCAATGTATGAGCAGCATTTGG - Intergenic
1085030170 11:73266302-73266324 AGAAATGCAGGGGCAGCCATGGG + Intronic
1085912869 11:80849284-80849306 AGAAATTTGAGACCAGCCTTGGG + Intergenic
1087497234 11:98907249-98907271 AGAAATGTAGAAGCAACTTTGGG + Intergenic
1088028358 11:105215018-105215040 AGATGTCTAGCAGAAGCCTTGGG + Intergenic
1089571129 11:119410710-119410732 AGGAATCTAGGATGATCCTTGGG - Intergenic
1089756903 11:120693999-120694021 AGAAATCCAGGAGCTGCCTTGGG + Intronic
1090878172 11:130809863-130809885 AGAAATGGAGGAGAGGCCTTAGG + Intergenic
1093411329 12:18871443-18871465 ATAATTCTAAGAGCAGTCTTTGG - Intergenic
1093860602 12:24161910-24161932 AGAACTCTAGAAGCAACCTAAGG + Intergenic
1094708192 12:32935315-32935337 AGAAACCCAGGAGAAGCCTGGGG - Intergenic
1095862282 12:46930959-46930981 ACAACTCCAGGAGCAGCCCTTGG + Intergenic
1095933645 12:47654022-47654044 ATAAAACTAGGGGCATCCTTTGG - Intergenic
1096556419 12:52406740-52406762 AAAAGCCTAGGAGCAGCCTTGGG - Intergenic
1098415798 12:70233840-70233862 AGAAAACTAGGAGTAAACTTAGG - Intergenic
1099352329 12:81589273-81589295 AGAAATCAATGAGTAGCCTTTGG - Intronic
1101529295 12:105559661-105559683 AGAAAGCCAGGATCAGCCTCAGG + Intergenic
1103262873 12:119603840-119603862 ATAAAGGTAGGAGCAGACTTTGG - Intronic
1105005858 12:132720196-132720218 AGAAGTCTCAGAGCAGCCTCAGG - Intronic
1105321312 13:19324788-19324810 AGAAAACCAGAAGCAGCTTTGGG - Intergenic
1105321318 13:19324835-19324857 AGAAAACCAGAAGCAGCTTTGGG - Intergenic
1106047856 13:26161923-26161945 AGAAATCTAGGAGTTGACTTGGG - Intronic
1106387159 13:29298948-29298970 AGCAATCTAGACTCAGCCTTGGG - Intronic
1108372002 13:49779459-49779481 AGAGATCTTGAAGCAGCCTCAGG - Intronic
1109142370 13:58730485-58730507 GGAAAACTAGGAGCAGTCATTGG + Intergenic
1113884972 13:113653729-113653751 AGAAACCCAGGTGCAGCCTCTGG - Intronic
1114437967 14:22723801-22723823 TGAAACCAAGGAGCAGCCTGTGG + Intergenic
1117318224 14:54595548-54595570 AGGAACCAAGGAACAGCCTTCGG + Intronic
1118300531 14:64611605-64611627 AGCAGCCTAGGAGCAGACTTGGG + Intergenic
1120104207 14:80475893-80475915 AGATATTTAGCAGCATCCTTGGG - Intergenic
1122127866 14:99588811-99588833 GCCAAGCTAGGAGCAGCCTTGGG + Intronic
1122588560 14:102828132-102828154 GGAAATCTAGAAGAAGCCTCAGG + Intronic
1122757646 14:103995360-103995382 GAATCTCTAGGAGCAGCCTTGGG + Intronic
1125908285 15:43413764-43413786 AGATATTTTGAAGCAGCCTTTGG + Intronic
1126968943 15:54088168-54088190 AAAAATGTAGAAGCAGCCATGGG + Intronic
1127785627 15:62352345-62352367 AGAAATCCAGGAACAGACTTTGG - Intergenic
1128065055 15:64759283-64759305 ATAGATCTAGGAGGAGCTTTTGG + Intronic
1128242004 15:66107618-66107640 AGAATTCTGGGAGAAGCTTTGGG + Intronic
1128311727 15:66635173-66635195 AGAATTCTAGGTTCAGCCCTTGG - Intronic
1128311733 15:66635217-66635239 AGAATTCTAGGTTCAGCCCTCGG + Intronic
1129072433 15:72962391-72962413 AGAAACCTAGGGGCAGCCACTGG - Intergenic
1131163678 15:90126957-90126979 AGAAAGAGAGCAGCAGCCTTAGG + Intergenic
1131695432 15:94872229-94872251 CAAAATCTAGTAGCACCCTTCGG - Intergenic
1133574479 16:7075337-7075359 AGAACTCTAGGAGAAGAGTTGGG + Intronic
1135119022 16:19749550-19749572 AGGAATTTAAGACCAGCCTTGGG + Intronic
1135600242 16:23776709-23776731 AAAAATCAGGGAGCAGCCTCTGG - Intergenic
1136965049 16:34898201-34898223 AGAAATCGAGTAGAATCCTTTGG - Intergenic
1138188210 16:54993042-54993064 AGAATTCGAGGAGCATCCTCAGG + Intergenic
1139606080 16:68019688-68019710 ACCACACTAGGAGCAGCCTTTGG + Intronic
1141649783 16:85386791-85386813 AGAACTCCAGGAGAAGCCTCTGG - Intergenic
1144508176 17:15851403-15851425 CAAGATCTAGGATCAGCCTTGGG + Intergenic
1145172297 17:20669037-20669059 CAAGATCTAGGATCAGCCTTGGG + Intergenic
1147770796 17:42866680-42866702 AGAATCCTAGCAGCAGCCTGAGG - Intergenic
1149881823 17:60299702-60299724 AGAAATTTAGAAGCAGTCTCAGG + Intronic
1150821986 17:68442617-68442639 AGAAAGCTAGAAGCTGCCTGTGG - Intronic
1152781698 17:82229722-82229744 GGAAAACCAGGCGCAGCCTTTGG + Intronic
1153585739 18:6618079-6618101 AGTCATCTCAGAGCAGCCTTTGG + Intergenic
1155986793 18:32238628-32238650 AAAAATCTAGGAACAGCTTCAGG + Intronic
1157067432 18:44367926-44367948 AGAAATCTAGAAGAAACCCTAGG - Intergenic
1158402516 18:57133777-57133799 AGAAAATCATGAGCAGCCTTAGG + Intergenic
1159946630 18:74448668-74448690 AGAAGCCTGGGAACAGCCTTGGG + Intronic
1161176782 19:2848130-2848152 AGAAAACAAAGAGCAGCGTTTGG - Intronic
1163990568 19:20995534-20995556 ACAAATTTAGGAGCAGCTATGGG - Intergenic
1168601221 19:57720245-57720267 GGAACTCTGGGAGCAGCCATTGG - Exonic
927084316 2:19659450-19659472 ACAAATCTAGAACCAGTCTTTGG + Intergenic
928074971 2:28255871-28255893 AGAAATTTAAGACCAGCCTGGGG - Intronic
931102852 2:59021744-59021766 AGAAATCTTGGCTCTGCCTTTGG + Intergenic
931218466 2:60267490-60267512 AGAAATCGTTGGGCAGCCTTGGG - Intergenic
931388063 2:61815096-61815118 AGATGACTAGGAGCAACCTTGGG + Intergenic
932736902 2:74260620-74260642 AGAAATCTAGGAGCAGCCTTGGG + Intronic
933608870 2:84413537-84413559 AGAAGGCTAGGAGCAGGATTTGG + Intergenic
933701161 2:85256249-85256271 AGAACACAAAGAGCAGCCTTCGG - Intronic
935748052 2:106206457-106206479 AGAAAACTATGAGAAGCCATTGG + Intergenic
936169951 2:110161992-110162014 AGAAATCTATGAGCACTTTTTGG + Intronic
938689844 2:133777338-133777360 AGCAATCTAGAAGTAGGCTTGGG - Intergenic
944747921 2:202676789-202676811 AGAAATGTGGAAGAAGCCTTAGG + Intronic
947124326 2:226851455-226851477 ACAAATCTAGGAGCCGAATTAGG + Intronic
947161505 2:227219966-227219988 AGAAATCTTGGGGCAGAATTTGG - Intronic
948836376 2:240628043-240628065 AGAAGTCCAGGGCCAGCCTTGGG - Intronic
1172981341 20:38944558-38944580 AGAAATCTATGAGCAGGCACCGG + Intronic
1178516383 21:33250971-33250993 AGGAATCTAGGAGGAGACGTGGG + Intronic
1180781641 22:18523495-18523517 AGGAATCTAGGCTCACCCTTGGG - Intergenic
1181238525 22:21462838-21462860 AGGAATCTAGGCTCACCCTTGGG - Intergenic
951648018 3:24915513-24915535 AGCAATTTATGAGCAGTCTTTGG - Intergenic
951829496 3:26909455-26909477 AGAATTTTAAGAGGAGCCTTGGG + Intergenic
952604730 3:35131496-35131518 AGACATCTTGGAGCTGCTTTTGG - Intergenic
953739013 3:45520576-45520598 ACAAATCTAGGACCAGACTCAGG + Intronic
954461449 3:50629285-50629307 GGAAAGCTAGGTGCAGCCTTGGG - Intronic
958597993 3:96255517-96255539 AGAAATCTAGGTCCAATCTTAGG + Intergenic
959309124 3:104709342-104709364 AGAAGTCTAGGAGCCTACTTAGG + Intergenic
959732539 3:109620437-109620459 AGAACTGTAGGAGCTACCTTTGG - Intergenic
960080409 3:113534337-113534359 AGATGTCTAGGAGCAGTGTTAGG - Intronic
960352910 3:116615354-116615376 AGAGATGTAGGAGCTTCCTTAGG + Intronic
961870079 3:129981082-129981104 AGAAATGGAGGGGCAGCATTGGG + Intergenic
962316925 3:134364729-134364751 AGAAATGGAGGAGCAGCTTGAGG - Intronic
962585011 3:136833281-136833303 AGACATATAGTAGCAGCCTCTGG + Intronic
963422813 3:145082858-145082880 AGAAATCTCAGAGCTACCTTGGG + Intergenic
964383966 3:156127606-156127628 AGCATTCTAGTAGCAGCCTCTGG + Intronic
967857964 3:194132673-194132695 AAAAATCTCAGAGTAGCCTTAGG + Intergenic
969094004 4:4718610-4718632 AGCAATCAAGGGGCAGCCTGTGG - Intergenic
969259248 4:6023162-6023184 AGAAGTCTAGGGGCACCCATGGG - Intergenic
971656507 4:29353172-29353194 AAAACTCTAGGAGAAGGCTTAGG + Intergenic
973041577 4:45475913-45475935 AGGAAGCTAAGAGCAGACTTGGG + Intergenic
974112518 4:57542200-57542222 AGGAGTAGAGGAGCAGCCTTGGG + Intergenic
978081039 4:104591911-104591933 GAAAATCTAGGAGCAGTCTTTGG - Intergenic
979557661 4:122067966-122067988 TAAAACCTAGGATCAGCCTTAGG - Intergenic
985128336 4:186717335-186717357 AGAAATTGAGCAGCAGCCTTAGG + Intronic
985715992 5:1461927-1461949 AGAAATCCTAGTGCAGCCTTTGG - Exonic
986740723 5:10703036-10703058 AGAAATTGTGGAGTAGCCTTAGG - Intronic
987148978 5:15019676-15019698 AGAAAACTAGGCAAAGCCTTCGG - Intergenic
987552544 5:19402946-19402968 AGAAATGTAGGGGCTGCTTTTGG - Intergenic
993153044 5:84184769-84184791 AGCAATCTTGGGGCAGCCTCTGG + Intronic
993950267 5:94166454-94166476 AGCAATCTGGGGGTAGCCTTAGG + Intronic
996488482 5:124064901-124064923 TGAAATATAGGAGCTCCCTTAGG - Intergenic
997279177 5:132627994-132628016 AAATATGTAGGAGCAACCTTTGG - Intronic
1000267718 5:159653727-159653749 AGAAGTAGAGGAGAAGCCTTGGG + Intergenic
1001758322 5:174187377-174187399 AGAAATCTAGGGGAAGACTTTGG + Intronic
1003798695 6:9636215-9636237 AAAAATCTTGGGGCAGCCCTCGG - Intronic
1004064374 6:12228581-12228603 AGAGCTCTTGGAGCAGCCTGAGG + Intergenic
1006085689 6:31593241-31593263 AGAAATCTTGGAGTAGCCCTGGG - Intergenic
1007321278 6:41030485-41030507 AGAGCTCTGGGGGCAGCCTTAGG + Exonic
1008970397 6:57360757-57360779 AGAGAAATAAGAGCAGCCTTGGG - Intronic
1009159366 6:60262574-60262596 AGAGAAATAAGAGCAGCCTTGGG - Intergenic
1012997083 6:105984856-105984878 AAAAACCTTGGAGCAGCCCTTGG - Intergenic
1013424631 6:109999515-109999537 AGAAAGCACAGAGCAGCCTTTGG - Intergenic
1013494882 6:110688704-110688726 AGAAAGGTAGGAGCAGCAGTGGG + Intronic
1013780050 6:113719180-113719202 ATAAACCTAGGAGGGGCCTTAGG - Intergenic
1016894352 6:149037705-149037727 AGAAATTAAGAAGCAGCATTTGG + Intronic
1017820613 6:158046451-158046473 AAATAACTAGAAGCAGCCTTAGG - Intronic
1018935675 6:168272494-168272516 AGAAAGCCAGGAGCAGCTCTCGG - Intergenic
1020792334 7:12642252-12642274 AGAAATCCAGGAGATTCCTTAGG - Intronic
1022816320 7:33917947-33917969 AGAAATGGAAGAGCAGCTTTGGG - Intronic
1022960394 7:35420326-35420348 ACAAGTTTAGGAGCAGCCTTGGG - Intergenic
1024112133 7:46158131-46158153 AACATTCTAGGAACAGCCTTAGG - Intergenic
1026846374 7:73701024-73701046 GGAAATGTGGGAGCTGCCTTGGG - Intronic
1028734363 7:94190604-94190626 AGAACTATAGGAGCAGGCTCTGG + Intergenic
1032924693 7:136590033-136590055 AGACATCTATAAGCAGCTTTTGG - Intergenic
1033489689 7:141830237-141830259 AAAAATCTAGGGTCTGCCTTTGG - Intergenic
1034609554 7:152353434-152353456 AGTAATCTAGGAGTAGCCATTGG - Intronic
1034776403 7:153831294-153831316 AGAAAACGTGGAGCTGCCTTTGG - Intergenic
1036294878 8:7527733-7527755 AGAAATAGAGCACCAGCCTTAGG - Intergenic
1036296513 8:7542314-7542336 AGAAATAGAGCATCAGCCTTAGG - Exonic
1036326053 8:7778705-7778727 AGAAATAGAGCATCAGCCTTAGG + Exonic
1036327685 8:7793258-7793280 AGAAATAGAGCACCAGCCTTAGG + Intergenic
1036509471 8:9387162-9387184 AGCACCCTAGTAGCAGCCTTTGG + Intergenic
1036607127 8:10317463-10317485 AGAAACCTCAGAGCAGTCTTAGG + Intronic
1037743873 8:21628182-21628204 AGGAATTCAAGAGCAGCCTTAGG + Intergenic
1038569432 8:28647893-28647915 AGAAGTCGGGGTGCAGCCTTGGG + Intronic
1039051667 8:33500638-33500660 AGAAATCTAGAGGCTGTCTTTGG - Exonic
1039055149 8:33530177-33530199 TGAAATTTAGGATCAGCCTTGGG + Intergenic
1041119815 8:54574627-54574649 AGAAATCTGGGAATAGGCTTTGG + Intergenic
1045282343 8:100759919-100759941 AGAACTATGGGAGCAGCCTGTGG + Intergenic
1046589292 8:116186748-116186770 AGAAATCTAGGTTCAGGCTAAGG + Intergenic
1046602880 8:116338609-116338631 ATAGATGTAGCAGCAGCCTTTGG + Intergenic
1047151293 8:122266253-122266275 AGAAAGCTAGGAGGGGCCTTGGG - Intergenic
1049967553 9:793057-793079 TGAAATCTGGGAGAAGTCTTTGG + Intergenic
1051179751 9:14398077-14398099 AAAAATCAATAAGCAGCCTTTGG - Intronic
1053495110 9:38543956-38543978 AGAAATATAGGAGCAGCAAGAGG - Intronic
1056251251 9:84750523-84750545 AGAAATCTCAGAGCAGGCATTGG + Intronic
1056280479 9:85037033-85037055 AGAAATGGAGGTGTAGCCTTAGG + Intergenic
1061667456 9:132168850-132168872 ATAATTCTAGGACCAGCTTTGGG + Intronic
1062467099 9:136686323-136686345 AGAAATGTAGCAACAGCCTGGGG + Intronic
1185573751 X:1154289-1154311 GGAAATCTAGGTGCAGTCTTGGG - Intergenic
1188848552 X:35103856-35103878 AGAAGTCCAGGAGCATCCTGGGG + Intergenic
1189097919 X:38159758-38159780 AGGAACCTAGGGCCAGCCTTTGG - Intronic
1189206557 X:39244567-39244589 AGAACTCAAGGAGAAGCCTCAGG + Intergenic
1189989947 X:46584834-46584856 GGAAAGCTATGAGCAGCTTTAGG + Intronic
1190461344 X:50679123-50679145 AGAAATGTAGGAGGAGACGTGGG - Intronic
1191731108 X:64336445-64336467 ATAAAGCTAAGAGCTGCCTTTGG - Intronic
1192226005 X:69228386-69228408 AGAAATCCTGGGGAAGCCTTTGG + Intergenic
1194227782 X:91282503-91282525 AGGAATCCAGGACCTGCCTTTGG + Intergenic
1195235858 X:102897695-102897717 AGTAGTCTAGGAGCAGCCACTGG + Intergenic
1195428203 X:104759496-104759518 ATATGTCTAGGAGCAGCATTTGG + Intronic
1202191136 Y:22246985-22247007 AGAAATTTAGGATAAACCTTTGG - Intergenic