ID: 932737459

View in Genome Browser
Species Human (GRCh38)
Location 2:74264269-74264291
Sequence ATTGAGAAGCAGATTGAGGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 347
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 311}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932737459_932737463 20 Left 932737459 2:74264269-74264291 CCATCCTCAATCTGCTTCTCAAT 0: 1
1: 0
2: 2
3: 33
4: 311
Right 932737463 2:74264312-74264334 CATACACACCTCATCCCTGTGGG 0: 1
1: 0
2: 2
3: 9
4: 120
932737459_932737461 -7 Left 932737459 2:74264269-74264291 CCATCCTCAATCTGCTTCTCAAT 0: 1
1: 0
2: 2
3: 33
4: 311
Right 932737461 2:74264285-74264307 TCTCAATGACATCATCTGTGTGG 0: 1
1: 0
2: 2
3: 15
4: 176
932737459_932737462 19 Left 932737459 2:74264269-74264291 CCATCCTCAATCTGCTTCTCAAT 0: 1
1: 0
2: 2
3: 33
4: 311
Right 932737462 2:74264311-74264333 ACATACACACCTCATCCCTGTGG 0: 1
1: 0
2: 0
3: 12
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932737459 Original CRISPR ATTGAGAAGCAGATTGAGGA TGG (reversed) Exonic
900761469 1:4474558-4474580 AGTGAGCACCAGATTCAGGAGGG - Intergenic
901945787 1:12702506-12702528 GTTGAGAAGTACATAGAGGAAGG - Intergenic
902210924 1:14903922-14903944 GATGAGAAGCAGACTGCGGAAGG + Intronic
902958284 1:19942132-19942154 TTTGAGAACCAGATTGATGAGGG + Intergenic
904132309 1:28284039-28284061 ATAGATAAGGAAATTGAGGAGGG - Intergenic
904295762 1:29518859-29518881 AAGGAGAAGGAGAATGAGGAAGG - Intergenic
905240858 1:36580667-36580689 ATTGGGAAGGACAATGAGGAGGG + Intergenic
905337916 1:37258082-37258104 ATTGGCAGGCAGACTGAGGAAGG + Intergenic
905642005 1:39596539-39596561 CCTGAGCAGAAGATTGAGGAAGG + Intergenic
907265411 1:53256960-53256982 CTTGTGAAGCAGGTTGTGGAAGG + Intronic
907328831 1:53658304-53658326 TCTGGGAAGCAGCTTGAGGAAGG + Intronic
907336859 1:53705337-53705359 ATTTAGATGCAGAGTGAGGGAGG - Intronic
907509489 1:54947580-54947602 ATTGAGATGCAGAGAGGGGAAGG + Intergenic
907651207 1:56296424-56296446 ATTGAGGCTCAGATTGAGGAAGG - Intergenic
907733877 1:57092960-57092982 ATTGAGAAGGCGATGGAAGAGGG + Intronic
908308170 1:62846831-62846853 ATTGAGAACCAGCTAGAGGCAGG - Intronic
908411243 1:63867844-63867866 AAAGAGAAGCAGATCAAGGAAGG - Intronic
910526284 1:88182569-88182591 AATGAGAAGCAGAATGACAAAGG + Intergenic
910709538 1:90165492-90165514 TTTCAGAAGCAGGTTGGGGATGG + Intergenic
910811688 1:91243847-91243869 ATTGACCAGCAGATTGTAGAAGG - Intergenic
911133442 1:94414729-94414751 AGACCGAAGCAGATTGAGGAAGG - Intergenic
911138554 1:94470480-94470502 ATTGAGGGGGAGATTGAGGGAGG - Intronic
911525368 1:98978349-98978371 ATGGAGAAGAAGATTGAAGATGG - Intronic
912864101 1:113241567-113241589 ATTGAGAAGCATTTTAAGGCTGG + Intergenic
915563451 1:156700887-156700909 TTTGAGGAGCAGACTGTGGATGG - Exonic
915929317 1:160049267-160049289 GTTCAGAAGCAGACTGCGGAAGG - Intronic
915959254 1:160251056-160251078 CTTGAGTAGCAGAATGAGGCAGG - Intronic
916344464 1:163772240-163772262 GAAGAGAAGCAGATTGGGGAGGG + Intergenic
917329206 1:173864545-173864567 ACTGAGAAGGAAATTGAGTAGGG - Intergenic
917790842 1:178497807-178497829 ATTAATAAGCAGATCGGGGAGGG + Intergenic
918434561 1:184498127-184498149 TTTGTGATGCAGATTGGGGAAGG - Intronic
919236096 1:194844315-194844337 GTTGAGAAGCAGATGGATGCTGG + Intergenic
919676623 1:200389894-200389916 AATGAGGAGCAGAATGATGATGG - Intergenic
920341640 1:205278843-205278865 AGTGAGAAGGAGAATGAGGATGG + Intergenic
920545181 1:206810505-206810527 ATTAAGAAACACATTGACGAAGG + Intronic
920693050 1:208161286-208161308 GGTGAGAAGGGGATTGAGGAAGG - Intronic
920770395 1:208879418-208879440 AATGAGGAACAGATTGTGGAAGG - Intergenic
921418584 1:214919808-214919830 ATGGAGAAGGAGAATCAGGAAGG - Intergenic
922170469 1:223150339-223150361 CTTGGGAAGCTGAGTGAGGAGGG - Intergenic
923090348 1:230735767-230735789 AAGGAGAAGCAGTTTCAGGAAGG - Intergenic
923152354 1:231244811-231244833 AATGAAAAGAAGACTGAGGATGG + Intronic
923352710 1:233125314-233125336 TTTAAGAAGCAGGTAGAGGAAGG - Intronic
923373869 1:233340492-233340514 ATTTAGAATGAGATTGAGAAGGG + Intronic
923760979 1:236843823-236843845 ACTGAGAAGCAGGTTTGGGATGG + Intronic
1063424294 10:5939509-5939531 ATTGAGAAGTAGTTAGAGGCTGG + Intronic
1063866044 10:10366831-10366853 AGTGAGGAGCAGGTGGAGGAAGG - Intergenic
1064464945 10:15569548-15569570 AGTAAGAAGCAGACAGAGGATGG - Intronic
1064960260 10:20955570-20955592 ATTTAGGAGCAGATTGTGGAGGG + Intronic
1067044869 10:42979899-42979921 TGTGAGAAGCAGCATGAGGAGGG + Intergenic
1068011687 10:51459474-51459496 ATTGAGAAGCAGTTTTAAGTGGG - Intronic
1068168778 10:53365891-53365913 TTTGAGAAGCAGAATGGGAATGG + Intergenic
1068434129 10:56968901-56968923 GTGAAGAAGCAGATTGAGTAGGG + Intergenic
1068916571 10:62438825-62438847 TGTGAGAAGCATACTGAGGAAGG - Intronic
1068960383 10:62861269-62861291 ATTGACCATCAAATTGAGGAGGG - Intronic
1069788265 10:71003656-71003678 AGTGAGAAGCAGTTTCAAGAGGG - Intergenic
1069905193 10:71728087-71728109 TTGGACAAGCAGATTGAGGAAGG + Intronic
1070276064 10:75008147-75008169 ATGGTGATGCAGAGTGAGGATGG + Intronic
1070313072 10:75287702-75287724 ATGGAGCAGCAGAATGAGGAGGG - Intergenic
1071117316 10:82236674-82236696 ATGGAGAAGGAGATAGAGGGAGG - Intronic
1071119405 10:82260611-82260633 CTAGAGAAGCAGAGTGAGAATGG + Intronic
1072228634 10:93393786-93393808 GATGAGAAGCAGAAGGAGGAAGG - Intronic
1072252753 10:93594581-93594603 ATTAATAAGCAGAATTAGGATGG - Intronic
1072736121 10:97880859-97880881 CTTGAGCAGCTGATTGATGATGG - Intronic
1073322890 10:102626289-102626311 ATGGCCCAGCAGATTGAGGAAGG + Intronic
1075275443 10:121088971-121088993 ATTGAGATGCAGAGGGTGGATGG + Intergenic
1075345591 10:121679740-121679762 AGGGAGAGGCAGACTGAGGAGGG - Intergenic
1075359055 10:121813327-121813349 GTTGAGATGGAGAATGAGGAGGG - Intronic
1075561263 10:123470193-123470215 ACTGAGGAGCAAATTGAGCAAGG + Intergenic
1076026842 10:127122484-127122506 AATGAGATGCTGCTTGAGGAAGG - Intronic
1076456774 10:130605337-130605359 AGAGAGAAGCAGCTTGGGGAGGG + Intergenic
1076643753 10:131937126-131937148 AGTGAGCACCAGATTGTGGAAGG + Intronic
1077767156 11:5171326-5171348 ATTGAGAAGCACATGGAGACTGG + Intronic
1079843897 11:25438863-25438885 ATAGATTTGCAGATTGAGGACGG - Intergenic
1080135462 11:28848976-28848998 ATTGAGAAGGAGGTTAAGGCCGG - Intergenic
1080430416 11:32193376-32193398 ACTGAGAAGCAGATTTTGGGGGG + Intergenic
1080436597 11:32250366-32250388 ATGGAGAAGCAGGTTCAGGGAGG - Intergenic
1080500606 11:32867184-32867206 GCTGAGAACCAAATTGAGGAAGG + Intergenic
1083830875 11:65232826-65232848 AAAGAGAAGAAGATGGAGGAAGG - Intergenic
1084079962 11:66815901-66815923 ATAGAGAAACAGGTTCAGGAGGG + Intronic
1084449428 11:69227029-69227051 GTTGATAAGCAGAATGTGGAAGG + Intergenic
1087141907 11:94772374-94772396 ATTTAGCAACAGAGTGAGGATGG - Intronic
1087193251 11:95278774-95278796 TGAGAGAAGCAGAATGAGGAGGG + Intergenic
1087736980 11:101845360-101845382 TCTGAAAAGCAGAATGAGGAAGG - Intronic
1087968211 11:104445953-104445975 ATCTAGAAGAAAATTGAGGAAGG - Intergenic
1089352450 11:117829182-117829204 ACTGAGAAGCAGAGTTAGGAGGG + Intronic
1089465242 11:118680733-118680755 CTTAAGAAGCAGATTCAGGCTGG + Intergenic
1089959697 11:122604881-122604903 AGTGAGCAGCAGAGTGAGTAGGG + Intergenic
1091057145 11:132429930-132429952 AGCTAGAAGCAGACTGAGGAAGG + Intronic
1091226730 11:133961425-133961447 ATTGGGAGGCTGAGTGAGGATGG - Intergenic
1092100990 12:5883614-5883636 ATGGAGAAGCAGGGTGTGGAGGG + Intronic
1092766686 12:11859435-11859457 ATTAAGAAGCAGATTCAGGCCGG - Intronic
1093236829 12:16619699-16619721 ATTAAGAAGCAGCTTTAGGTTGG + Intergenic
1093565832 12:20602639-20602661 GTTGGGAAGCAGTTTGATGAAGG + Intronic
1094098063 12:26730328-26730350 GTTTAGAAGCAGGATGAGGAGGG - Intronic
1094272018 12:28627338-28627360 GTTGAGAAGAAGAATGAGTAGGG + Intergenic
1094317884 12:29151947-29151969 TTTCAGAAGTAGCTTGAGGAAGG + Intronic
1096863114 12:54544323-54544345 ATGCAGATGCAGATGGAGGAGGG - Exonic
1097030136 12:56083920-56083942 AAAGAGGAGCAGGTTGAGGAAGG - Intronic
1097437421 12:59568346-59568368 ACTGAGAAGCAGAATGAGAGGGG + Intergenic
1099403216 12:82225799-82225821 AAGGAGAAGTAGGTTGAGGATGG - Intronic
1102243651 12:111341607-111341629 ATGCAGAAGGAGAGTGAGGAGGG + Intronic
1102514143 12:113435288-113435310 AGGGAGAAGCAGAGTGAGGGAGG - Intronic
1103037002 12:117664690-117664712 ACTGAGACCCAGATAGAGGAAGG + Intronic
1106833921 13:33613797-33613819 ATTTAGCAGCAGGGTGAGGAAGG + Intergenic
1108830597 13:54473188-54473210 CTTGAGAAGCAGCCTGAGGTTGG + Intergenic
1108881109 13:55117298-55117320 ATTGAGTTGGACATTGAGGATGG + Intergenic
1108903519 13:55442743-55442765 AATGAGAAACAGATTGGGGTGGG + Intergenic
1109428124 13:62194503-62194525 AGTGAGAAGGACATAGAGGATGG - Intergenic
1109752880 13:66719419-66719441 ATTATGAAAGAGATTGAGGAGGG + Intronic
1112313061 13:98336735-98336757 AATGAAAAGCCAATTGAGGATGG + Intronic
1112667327 13:101590576-101590598 ATTGAAAACCAGATTGAAGAGGG - Intronic
1115631531 14:35250651-35250673 GTAGAGAGGTAGATTGAGGAAGG + Intronic
1118294676 14:64558193-64558215 GGTGAGAAGCAGCTTCAGGAAGG + Intronic
1119565375 14:75624439-75624461 AATGAGAAGCAGCTTCAAGAAGG + Intronic
1120197614 14:81502740-81502762 TTTGAGAAGCTGACTGAGGAAGG - Exonic
1120344319 14:83265843-83265865 TTTAAAAAGCAGATTGAGGCTGG + Intergenic
1124245234 15:28064535-28064557 ATTCAACAGCAGATTTAGGAAGG - Intronic
1125324448 15:38522726-38522748 ATTGAGAAGTTCAGTGAGGAAGG + Intronic
1125437828 15:39666991-39667013 GCTGAGAAGCAGATTTAGGGTGG - Intronic
1125782532 15:42282684-42282706 ATTAAGGAGCAGATTGGGGAAGG - Intronic
1126169057 15:45679331-45679353 TTTGGGGTGCAGATTGAGGATGG + Intronic
1126326112 15:47479333-47479355 ATAGAGAAACAGGTTGAGGATGG - Intronic
1126431918 15:48594996-48595018 AAAGAGAAGCAGTTTAAGGAGGG + Intronic
1129027397 15:72590267-72590289 ACTGAGAAGCAGATACAGCATGG - Exonic
1131620077 15:94058909-94058931 TTTGAGACCCAGAGTGAGGAAGG - Intergenic
1131994919 15:98124531-98124553 ATTTAGAAACGGAGTGAGGAAGG - Intergenic
1132001655 15:98186615-98186637 ATAGATAAGCACATTGAGGTTGG + Intergenic
1133162380 16:3920584-3920606 ATGGAGAAGCAGGCAGAGGACGG - Intergenic
1134038103 16:11047463-11047485 ATGGGGAAGCAGATTTAGAATGG + Intronic
1134303165 16:13009336-13009358 ATTGGGAAGGACATTCAGGAAGG + Intronic
1136246175 16:28977539-28977561 ATTGGGATGCAGACAGAGGAAGG + Intronic
1139369295 16:66456401-66456423 GTTGAGAAGCAGATTCTGGGGGG - Intronic
1140288701 16:73629569-73629591 AATGAGAAGAAGATGGAGGCTGG + Intergenic
1140851666 16:78940534-78940556 ATTAAGAAGCAGATGGAACACGG - Intronic
1140973681 16:80038665-80038687 ATTTGGAAGCAGGTTGAGGGAGG + Intergenic
1141867696 16:86762059-86762081 ATGGAAAATCAGAATGAGGAAGG + Intergenic
1143276953 17:5718807-5718829 AGTGAGAAAGAGATTGAGGATGG + Intergenic
1143434894 17:6916069-6916091 ATTCAGAAGGAGATTCAGGAGGG + Intronic
1143588327 17:7863628-7863650 ATTTAGAAACAGTTTCAGGATGG - Intronic
1144143219 17:12370491-12370513 GTGGAGAAGCAGAGAGAGGAAGG + Intergenic
1146471479 17:33128435-33128457 ACTGGGAAGCAGAATGGGGATGG + Intronic
1146565369 17:33908393-33908415 ATAGAGAAGCAGACAGGGGAGGG + Intronic
1146761049 17:35479106-35479128 ATTCAGAACCAGGTTGAGGAAGG - Exonic
1147745443 17:42691783-42691805 CTAGAAAAGCAGATGGAGGAAGG - Intronic
1148682730 17:49484025-49484047 ATGGAGAAGAAGAGAGAGGAAGG - Intergenic
1148913358 17:50955059-50955081 AGTATGAAGCAGGTTGAGGAAGG - Intergenic
1152274140 17:79344475-79344497 ATTGAGAAGCCCAATGAGGAAGG - Intronic
1152907767 17:82978259-82978281 ATTAGGAAGCAAACTGAGGAAGG - Intronic
1155433791 18:25790035-25790057 GTTGAGAAGAATATTGAGAAAGG + Intergenic
1155567120 18:27147529-27147551 AGTGGGAAGGAGATAGAGGATGG - Intronic
1156069638 18:33190948-33190970 AGTGAGAAGCAAATTGCTGATGG - Intronic
1156108514 18:33694570-33694592 ATTTAGAAGCAGTTGGGGGATGG - Intronic
1156700428 18:39818381-39818403 GTTGAGAAGCAGATTTTGGAGGG + Intergenic
1156708195 18:39909542-39909564 ATGGAGGAGCAGCTTGAGAAAGG - Intergenic
1156860716 18:41833238-41833260 CTTTAGAAGCTGTTTGAGGAGGG - Intergenic
1157175019 18:45443702-45443724 AATGAGAGGCAGAGAGAGGAGGG + Intronic
1157423820 18:47568274-47568296 ATTGGGAAGCAGAGAGGGGATGG + Intergenic
1157724130 18:49950412-49950434 TTTTAGAAGCAGATTGATGATGG - Intronic
1158013623 18:52757906-52757928 ATTGAGAAGCAAAGTGATAAGGG - Intronic
1159946873 18:74450547-74450569 TGTGAAAAGCAGAGTGAGGAGGG + Intronic
1160254867 18:77239699-77239721 AATGAGGAGCAGAGTGAGGAAGG - Intergenic
1162888301 19:13712944-13712966 TTTGAGAAGCTGAAAGAGGAGGG + Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166941274 19:46367612-46367634 TTTGAGAAGCAGATTTATGAGGG + Intronic
925789810 2:7472537-7472559 ACTGAGCAGGAGATGGAGGAGGG - Intergenic
925843903 2:8018753-8018775 ATTGAGACACTGCTTGAGGAAGG + Intergenic
925901797 2:8514116-8514138 GATGAGAAGCAGAATTAGGATGG + Intergenic
928215071 2:29354555-29354577 ATTGAGAAGAAGGATGAAGAAGG - Intronic
928643858 2:33330229-33330251 ATTAACAAGCAGATTTAGCAAGG - Intronic
929770490 2:44887742-44887764 ATAGAGAATCATCTTGAGGAAGG - Intergenic
929801831 2:45111197-45111219 ATTCAGAGACAGATTGAGCACGG - Intergenic
929877578 2:45809354-45809376 CTTGAGAAGCATTTTGAGTAAGG + Intronic
929992644 2:46802722-46802744 AGTGAAATGAAGATTGAGGATGG - Intergenic
932226347 2:70044079-70044101 TCTGAGAACCAGACTGAGGAAGG - Intergenic
932512985 2:72313979-72314001 ACTGAGAACCACATTGAGAAAGG + Intronic
932706411 2:74028962-74028984 AGAGATAAGCAGATTGAGCATGG - Intronic
932737459 2:74264269-74264291 ATTGAGAAGCAGATTGAGGATGG - Exonic
934492365 2:94770267-94770289 ATGTAGAAGCAGATTCAGAAGGG - Intergenic
936752531 2:115662788-115662810 ATTGAATAACAGTTTGAGGAAGG - Intronic
937180690 2:119993516-119993538 ATTGTGAAGAACATTGATGATGG - Intergenic
937253518 2:120539252-120539274 AATGAAAAGCTGATAGAGGAAGG + Intergenic
937408737 2:121654200-121654222 ATGGAGGAGCAGGTTGGGGATGG + Intergenic
938969083 2:136415812-136415834 ATTGATGAGCTGATTCAGGAAGG - Intergenic
939459159 2:142476769-142476791 ATGAAGAAGCAGATTTAGGCTGG - Intergenic
939656998 2:144838214-144838236 CTTTAGAAGCAGATTAAGGTAGG + Intergenic
939936917 2:148304390-148304412 ATTGAGAAGCAGTTTGCTGCTGG - Intronic
940692925 2:156941834-156941856 GATGAGAAGGAGTTTGAGGAGGG + Intergenic
941397572 2:164992147-164992169 CCTGAGAAGCAGATTAAGGCAGG - Intergenic
942163263 2:173214973-173214995 CCTGAGAGACAGATTGAGGAAGG + Intronic
942166581 2:173246619-173246641 ATTCAAAAGCAGAATTAGGAAGG + Intronic
942437804 2:176000060-176000082 ATTGAAAAGCACATTTAGGTCGG - Intronic
943088164 2:183340592-183340614 ATGGAGAAGAAGGTTCAGGAGGG - Intergenic
945827173 2:214736398-214736420 ATTGGGAAGGAGATTTGGGAAGG - Intronic
946400938 2:219468211-219468233 TCTGAGAAGTAGATGGAGGAGGG + Intronic
947182303 2:227422010-227422032 ATTAAGAAGCAAAATGAGGCTGG - Intergenic
947292784 2:228596122-228596144 AATGAGAAGCAGTTTTAGAAGGG + Intergenic
948095338 2:235328994-235329016 ATTGAGAAGGGGATTGAGGAGGG + Intergenic
948363398 2:237438293-237438315 AATGAGAAGCATATCCAGGAAGG + Intergenic
1169355409 20:4901100-4901122 ATTCTGAACCAGATTCAGGAAGG - Intronic
1169612091 20:7392883-7392905 ATTGGGAAGCAAATAGAGCAGGG + Intergenic
1169941492 20:10942600-10942622 ATTGAAGAGCAGAGGGAGGAAGG - Intergenic
1170010127 20:11713838-11713860 ATTGGGAAGCAGATGTGGGAGGG + Intergenic
1170236720 20:14114591-14114613 TTTTATAAGAAGATTGAGGAAGG + Intronic
1170962241 20:21035768-21035790 ATTGAGGAGCAAAAAGAGGAAGG + Intergenic
1172261882 20:33574099-33574121 ATTATGATGAAGATTGAGGATGG + Exonic
1172511118 20:35501757-35501779 ATATAGAGGCAGATGGAGGATGG - Intronic
1173925359 20:46777165-46777187 ATTGAAAAACAGATTGAAGTTGG + Intergenic
1174466907 20:50724849-50724871 GGTGGGAAGCAGATTGAGAAGGG - Intergenic
1176845966 21:13876817-13876839 ATGTAGAAGCAGATTCAGAAGGG - Intergenic
1177381167 21:20346357-20346379 AATGAAAAGCAGAATGTGGATGG - Intergenic
1178191782 21:30290913-30290935 AGTGAGAAGATGATTGAGAATGG - Intergenic
1179958691 21:44756047-44756069 ATGGAGAAGAAGAGGGAGGAGGG + Intergenic
1182806383 22:33074172-33074194 ATAAAGAAGAAGAGTGAGGAGGG - Intergenic
1184170860 22:42759022-42759044 GTTGGGGAGCAGTTTGAGGAGGG - Intergenic
949102541 3:163459-163481 AAGGAGAAGAAGATGGAGGAGGG - Intergenic
949825750 3:8163411-8163433 ATTAAGAAGGAGATAGAGGCAGG + Intergenic
951362021 3:21736703-21736725 ATAGAGAAGTAGACTGGGGAGGG + Intronic
952588356 3:34920506-34920528 ATTAAGAAGGAGAATGAGAATGG - Intergenic
953560944 3:43992935-43992957 AGTGAGAAGCAAATTCAGCATGG + Intergenic
955542170 3:59989011-59989033 ATTGAGGAGCAGTTTGGGGTAGG + Intronic
955621519 3:60869430-60869452 ATTGAGAAGCAGAGATAGAAGGG - Intronic
955914844 3:63896550-63896572 CTGAAGAAACAGATTGAGGAAGG - Intronic
956665157 3:71635462-71635484 ATTGGGAAGCAGTGGGAGGAGGG - Intergenic
957055231 3:75437453-75437475 GATTGGAAGCAGATTGAGGAAGG + Intergenic
958795310 3:98700842-98700864 AGTCTGAAGCAGACTGAGGAAGG + Intergenic
958880831 3:99667052-99667074 ATGAAGAAACAGATTCAGGAAGG + Intronic
959234016 3:103694370-103694392 ATTGAGCAGGAGAATTAGGAAGG + Intergenic
959577719 3:107952286-107952308 ATTTAGAAGAAGAATAAGGAGGG + Intergenic
959989647 3:112616761-112616783 ATGGAGAAGCAGAAGAAGGAGGG - Exonic
960072359 3:113445338-113445360 ATTGAGAAACAGAATGAAGAAGG - Exonic
962702301 3:138011564-138011586 AAAGAGAACCAGACTGAGGAGGG + Intronic
965582725 3:170286609-170286631 TTTGAGAAGCAGTTTGATGGGGG + Intronic
966306117 3:178536806-178536828 AGTGAGAAGCAGCAAGAGGAGGG + Intronic
966715663 3:183010999-183011021 AGTGAGAAGTTGATTGTGGAGGG + Intergenic
967155955 3:186692416-186692438 ATTCAGAGGCAGATTGAGGGAGG - Intergenic
967347808 3:188477963-188477985 ATTTTGATGCAGATTGAGGATGG + Intronic
968764206 4:2459614-2459636 ATGGAGCAGGAGGTTGAGGAGGG + Intronic
969105178 4:4802000-4802022 ATTGTGAAACAGATTGGGCATGG + Intergenic
969217901 4:5736938-5736960 ATTATGAAGCATAGTGAGGAAGG + Intronic
969755956 4:9150899-9150921 GATTGGAAGCAGATTGAGGAAGG - Intergenic
971108133 4:23549941-23549963 ATTGTGGAGCAGATTTAGGGTGG + Intergenic
971157943 4:24103273-24103295 GTTGAGGAGCTGATTGAGAAGGG - Intergenic
973019860 4:45189104-45189126 AATGAGAAGCAGAGTGTGGTTGG - Intergenic
974519100 4:62957865-62957887 ATGGAGAAGCAGATTGCAAATGG + Intergenic
976668484 4:87626040-87626062 ACTGAGAAGCAGTGAGAGGATGG - Intergenic
976786102 4:88823339-88823361 ATTGAGGAGCAGAAGGAGTAGGG - Intronic
977034333 4:91930742-91930764 TTTGAGACAAAGATTGAGGATGG - Intergenic
977848006 4:101789300-101789322 ATTGTGGAGCAGAGTCAGGATGG + Intronic
978223110 4:106301390-106301412 GTTTAGAAGCAGAGTGAAGATGG - Intronic
979374086 4:119924054-119924076 ATTTTGAAACAGATAGAGGAGGG - Intergenic
979715267 4:123830068-123830090 ATTCACAGGCAGATTCAGGAAGG - Intergenic
980029564 4:127811550-127811572 ATTGAGAAGCAAAATTTGGAAGG + Exonic
981676056 4:147343821-147343843 ATTGAAGAGCAGATTGAAAATGG + Intergenic
982525346 4:156470939-156470961 ATTCAGAAGCAGAAGAAGGAAGG + Intergenic
986032423 5:3906599-3906621 ATAAAGAGACAGATTGAGGAGGG + Intergenic
986550953 5:8955035-8955057 AGTGATAAGCAGTTTGAGAAAGG + Intergenic
987149095 5:15020849-15020871 AAGGAGAAGCAGAGAGAGGAGGG + Intergenic
987201980 5:15586370-15586392 ATTGAGAAAGAGATTGAGAAAGG - Intronic
989609015 5:43273662-43273684 CTGGAAAAGCAGAATGAGGAGGG - Intronic
991293598 5:65058353-65058375 ATTGAAAATGAGATTTAGGAGGG - Intergenic
992197830 5:74357259-74357281 CCTCAGAAGCAGAGTGAGGAGGG - Intergenic
992589245 5:78276433-78276455 ATTTAGAAGCAAATTTAGGCTGG + Intronic
992794122 5:80240270-80240292 GTTGAGAAGCAGTGGGAGGAAGG - Intronic
993384658 5:87250775-87250797 AGGGAAAAGCAAATTGAGGAAGG - Intergenic
996148120 5:120000005-120000027 AGGGAGAAGGAGATAGAGGAAGG + Intergenic
996518083 5:124395653-124395675 TTTGAGAAGCAGAGTGAGCTGGG - Intergenic
996616703 5:125450626-125450648 ATTGAAGAGCAGAGGGAGGAAGG + Intergenic
997281209 5:132647277-132647299 ATGAAGAAGCAGATTTTGGATGG - Intergenic
997669282 5:135657058-135657080 ATTCAGATGCCCATTGAGGAGGG - Intergenic
998781707 5:145664365-145664387 ACTAAGAAGCAGAATGAAGAAGG + Intronic
999981211 5:156959622-156959644 TTTGAGACTCAGATTGGGGAAGG - Intronic
1000228145 5:159289814-159289836 ATGGAGAAGAATATTGTGGAAGG + Intergenic
1000399194 5:160807615-160807637 ATTGAGAAACTGATGGAGGAAGG + Intronic
1001062902 5:168509122-168509144 ATTGCAAAGTAGATTAAGGAAGG + Intronic
1002696109 5:181092274-181092296 ATGGAGAAGGAGATAGACGAGGG + Intergenic
1005596435 6:27382827-27382849 ATTGAAAAGCAGGCTGAGCACGG + Intronic
1007618487 6:43196803-43196825 ATTGAGAAGCATCATGAGGATGG - Exonic
1008639112 6:53443408-53443430 ATTAAGACACAGATTGAGGCTGG + Intergenic
1008690230 6:53970841-53970863 ATTAAAAAGCTGATTGGGGAAGG + Intronic
1009291324 6:61886382-61886404 ATTTAGAAGCAGAGAGAAGAGGG - Intronic
1009986818 6:70790700-70790722 AATAACAAGCAGATTGAGGGAGG + Intronic
1010379989 6:75213357-75213379 CTTGAGAAGCAGATAGAGGGAGG - Intergenic
1013810028 6:114034256-114034278 ATTTAGAACCAGATTGTGGAGGG + Intergenic
1014257920 6:119182677-119182699 AATGAGAACCAGATTGCAGATGG - Intronic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015326877 6:131933478-131933500 ATTAAGAAGGAGAATGAGGGTGG + Intergenic
1015495461 6:133877755-133877777 ATTGTGAAGCAGAGGAAGGAAGG + Intergenic
1017473424 6:154763157-154763179 AATGAAAAGCAGAATGAGGAGGG - Intronic
1018691716 6:166350737-166350759 ATTATTAAGCATATTGAGGAAGG - Intergenic
1019002722 6:168768971-168768993 CTTGAGAAGCAGATTTGTGAGGG + Intergenic
1019171748 6:170136790-170136812 GTTGAGTAGCAGGTGGAGGACGG - Intergenic
1019725684 7:2601239-2601261 AGTGAGAGGCAGAATTAGGATGG - Intronic
1020814030 7:12882280-12882302 TTTGGGAAGGAGGTTGAGGAAGG + Intergenic
1021439596 7:20662802-20662824 TTTGAGAATCTGATTGAGAAAGG + Intronic
1021514639 7:21470866-21470888 ATGGTGAAACAGACTGAGGATGG - Intronic
1026309103 7:69168297-69168319 ATTAAGAGCCAGAATGAGGACGG + Intergenic
1026383869 7:69826181-69826203 ATTGAGAAGTATATTAAGTAAGG + Intronic
1027748310 7:82107427-82107449 AGGGAGAAGCAGAGAGAGGAAGG - Intronic
1029310958 7:99663804-99663826 ATAAAGAAGGAGATTGGGGAAGG - Intronic
1030955298 7:115844570-115844592 ATGGAGAAGCAGGTTTTGGAGGG + Intergenic
1031732992 7:125320864-125320886 ATAGAGAAAGAGAGTGAGGAGGG - Intergenic
1032252728 7:130271895-130271917 ATGGAGTAGCAGATGCAGGAAGG - Intronic
1035168665 7:157006000-157006022 ACTTAGAAGCAGAATGGGGAGGG + Intronic
1036850359 8:12196412-12196434 GATTGGAAGCAGATTGAGGAAGG + Intergenic
1036871723 8:12438685-12438707 GATTGGAAGCAGATTGAGGAAGG + Intergenic
1037118571 8:15255601-15255623 AATAAGAAGCATATTTAGGAAGG + Intergenic
1037775825 8:21835003-21835025 ATGGAAAAGCACATCGAGGATGG - Intergenic
1038918992 8:32061375-32061397 ATTGAGAAACAGTTTTATGAGGG - Intronic
1040581436 8:48701797-48701819 ATGAAGATGCAGATTGTGGAGGG + Intergenic
1043975175 8:86577056-86577078 ATTGAGAAACAGACAGAGCAGGG - Intronic
1045055847 8:98367767-98367789 AATGGGAAGCACATTGATGAAGG + Intergenic
1046872448 8:119218549-119218571 ATTCAGGAGCAGATTGCGGTGGG - Intronic
1047834073 8:128669191-128669213 ATTGAGACTCACATTGATGATGG + Intergenic
1048039210 8:130709173-130709195 ATGGAGAATTAGAATGAGGAGGG + Intergenic
1048184293 8:132225366-132225388 AGTGAGAAGGAGATTGTGGCTGG + Intronic
1048433382 8:134391470-134391492 ATAGGGAAGTAGATGGAGGAAGG - Intergenic
1050538467 9:6649984-6650006 AGCCAAAAGCAGATTGAGGAGGG + Intergenic
1051339624 9:16099586-16099608 TCTGAGAAGCAGCTTGTGGAAGG + Intergenic
1053474458 9:38372066-38372088 TTTGAGACGCAGAGTGATGAAGG - Intergenic
1054864671 9:69987852-69987874 ATTGATATGCATATTGGGGAGGG - Intergenic
1056298941 9:85221983-85222005 ATTGGGAAGCAGAGTGAGATTGG - Intergenic
1057185543 9:93055642-93055664 ATGGAGAAGGAGGGTGAGGAAGG + Intergenic
1057767992 9:97940365-97940387 ATCTAGAAGCAGAGTGTGGAGGG + Intronic
1057961552 9:99462272-99462294 ACAGAGAAGCAGATAGAAGAGGG - Intergenic
1058076896 9:100660568-100660590 TTTGAGAAGCACATTCAGGAGGG + Intergenic
1058987907 9:110225797-110225819 AGAGAGAAGGAGAGTGAGGAGGG - Intergenic
1059037937 9:110779268-110779290 ATTGAGAAATAAATTCAGGAGGG - Intronic
1059612039 9:115908895-115908917 ATGGAGAGGCAGATTGGAGAGGG + Intergenic
1186311818 X:8328260-8328282 TTTGAAAAGCAGATTAATGATGG - Intergenic
1186344033 X:8672656-8672678 AGTGAGGAGCAGAGTGCGGAGGG - Intronic
1186554344 X:10541802-10541824 ATTAAGAAACAAATAGAGGAAGG + Intronic
1186852122 X:13590926-13590948 ATTGAGAACCAGACTGACGTGGG + Intronic
1187371972 X:18716854-18716876 ATTGAGGAGGAAAATGAGGACGG - Intronic
1187520678 X:20011264-20011286 ACAGGGAAGCAGATTGAGCAGGG + Intronic
1188314824 X:28660065-28660087 AAGCAGAAGCAGAGTGAGGATGG + Intronic
1188372532 X:29386409-29386431 ATTGAGAGGCAAACTGGGGAAGG - Intronic
1188864076 X:35292908-35292930 ATTGAGAGGCAGATTGTGGTTGG - Intergenic
1189590464 X:42505768-42505790 ATTTGGAAGCAGAATGAGGATGG + Intergenic
1190026415 X:46927708-46927730 TTTGAGAAACACATTGAGGTCGG + Intronic
1193219347 X:78904176-78904198 CTTGAGATGGAGATTGATGATGG - Intergenic
1193431108 X:81407020-81407042 ATTTAGAAGCAGTTTAGGGAGGG + Intergenic
1194440097 X:93921530-93921552 ATAGAGAAGCAGTGTGAAGAAGG - Intergenic
1195900380 X:109791300-109791322 CTTGAGAAGCAGGTTGAGAGAGG + Intergenic
1197554512 X:127937494-127937516 TTTGTGAAGCAGATTTATGAGGG - Intergenic
1199178729 X:144825815-144825837 ATTGAAAAGCAGAAAGAAGATGG - Intergenic
1201504709 Y:14685422-14685444 ATTGAGAGTCAGAGAGAGGAAGG - Intronic
1201593641 Y:15641935-15641957 ATTGAGATGGAGAGTGGGGAGGG + Intergenic