ID: 932739367

View in Genome Browser
Species Human (GRCh38)
Location 2:74280087-74280109
Sequence CATGTTGCAGTGTTGGAACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 221}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932739367 Original CRISPR CATGTTGCAGTGTTGGAACT TGG (reversed) Intronic
900925445 1:5703353-5703375 CATATTCCAGTGGTGGACCTGGG + Intergenic
905720442 1:40195638-40195660 CATGATGCATTATTGGAATTTGG + Exonic
906629900 1:47357874-47357896 AATGTGGCAGTGTTGGGACGTGG - Intronic
907570364 1:55477658-55477680 CATGGTGCAGTGGAGGAACCAGG - Intergenic
908018494 1:59873897-59873919 GATGTTGCAGTGATGAAACAAGG + Exonic
908020325 1:59891926-59891948 AATGTTGCAGTGTTGGAACATGG + Intergenic
909577393 1:77189596-77189618 CAAGTTTCAGTTTTGGGACTTGG + Intronic
910266646 1:85344987-85345009 TATGTTACATTGTTGGAAGTAGG - Intronic
911653969 1:100422153-100422175 CATCTTGCAGTGTGAGAACATGG + Intronic
913719825 1:121581322-121581344 CCTGTTGCAGGGTGGGAGCTAGG - Intergenic
914406839 1:147383421-147383443 CATGTTGCTGTAGTGGAAATTGG - Intergenic
915407540 1:155672642-155672664 CAAGTTACAGGGTTGGAACAGGG + Exonic
915420233 1:155775084-155775106 CAAGTTACAGGGTTGGAACAGGG + Exonic
917251273 1:173063934-173063956 CATGTTTCTGTGGTGGAACCAGG - Intergenic
918102249 1:181386545-181386567 CTTTTTGCAGTGATGGAAATTGG + Intergenic
918414574 1:184293195-184293217 CATGTGGCAGCCTTGGGACTTGG + Intergenic
919823482 1:201487639-201487661 CATTTTGCAGCCTTGGAAATGGG + Intronic
921700903 1:218267451-218267473 CATGTGGCAGTGTTGGGAGATGG - Intergenic
924258372 1:242204651-242204673 CATGCTGCAGTGATGGCACTAGG + Intronic
1064017646 10:11785028-11785050 CATGTGGCTGTGTTGGAAAGGGG - Intergenic
1065105065 10:22375110-22375132 CATGGTGCATTGTTCAAACTTGG - Intronic
1065197975 10:23285183-23285205 CCTGTTCCATTTTTGGAACTAGG - Intronic
1065547580 10:26837421-26837443 CATGTGACTGTGTTGGAGCTAGG - Intronic
1065675917 10:28174272-28174294 CATGTTGAAATGTTGGAGGTGGG + Intronic
1066143741 10:32534981-32535003 CTTTTTGCAGTGTAGAAACTTGG + Intronic
1066349246 10:34621502-34621524 CATGTTCCAGTGTTAAAAGTTGG - Intronic
1068379187 10:56226931-56226953 TAATTTCCAGTGTTGGAACTGGG - Intergenic
1069753028 10:70757040-70757062 CATGCTCCAGTGTGGGAAGTGGG + Intronic
1074205612 10:111280491-111280513 CATGTAGCAGTGGTGGAGGTGGG + Intergenic
1074478065 10:113790798-113790820 CATCTTTCAATGTTGGAAATGGG + Intergenic
1077223354 11:1427021-1427043 CAGGTGGCAGTGTTGGCACTGGG - Intronic
1077470206 11:2754499-2754521 GATGTTGCAGTGTAGGCACAAGG + Intronic
1077988723 11:7382077-7382099 CATGTTGCAGTGTAGGCATGAGG + Intronic
1078457936 11:11490020-11490042 AATGTGACAGTGTTGGAACATGG + Intronic
1078840801 11:15074251-15074273 CATTTCTCAGTCTTGGAACTGGG - Intronic
1081855313 11:46299750-46299772 GGTGTTGCAATGTTGGTACTGGG + Intronic
1083009175 11:59379022-59379044 CATCTTGCAGTGATGCAACTGGG + Intergenic
1084060057 11:66666087-66666109 CATGTAGGTGTGTTGGAATTGGG - Intronic
1087557734 11:99744052-99744074 CATGTTGCCATATTGGAAATGGG + Intronic
1089425538 11:118370978-118371000 CATGTGGCACTGTTGGAGGTGGG - Intronic
1090862982 11:130671128-130671150 CATTTTTGAGTGTTGCAACTGGG - Intergenic
1091129992 11:133138021-133138043 AATGTGGCAGTGTTGGAAAGTGG + Intronic
1091141372 11:133237825-133237847 CCAGGTGCAGAGTTGGAACTAGG + Intronic
1091466371 12:688299-688321 CAAGTTGCAGTGCTTAAACTTGG - Intergenic
1091529394 12:1339827-1339849 CCTGTGGCAGTGTTGGCACAAGG + Intronic
1094016698 12:25872077-25872099 CATGTTGAAGTGTGTGATCTTGG - Intergenic
1094408401 12:30144050-30144072 CAGGTAGCACTGTTGAAACTGGG - Intergenic
1095199588 12:39367143-39367165 GATGATGCAGTGTTTGAAGTTGG - Exonic
1097992695 12:65852934-65852956 CATGATGTTCTGTTGGAACTTGG - Intronic
1098325450 12:69297602-69297624 CATGTTGAAATGTTGGAGGTGGG + Intergenic
1098354700 12:69601106-69601128 AATGTGGCAGTATTGGAAGTTGG - Intronic
1099484552 12:83212376-83212398 CATGTTTCAGTGTTAAAAGTGGG + Intergenic
1100068354 12:90679661-90679683 CATGTTGCAGGGTTGGGAGTAGG - Intergenic
1100416550 12:94383530-94383552 CAGATTACAGTGTTTGAACTTGG - Intronic
1101976833 12:109366849-109366871 CATTTTGCATTTTTGGATCTGGG - Intronic
1102389812 12:112540401-112540423 CATTTTACAGTTGTGGAACTTGG - Intergenic
1103083593 12:118044323-118044345 CATACTGCAGGTTTGGAACTAGG + Intronic
1103408144 12:120690310-120690332 CATGTTCCAGATTTGTAACTTGG + Intronic
1105625906 13:22112118-22112140 CATGTGGCGGTGTAGGCACTGGG + Intergenic
1108046013 13:46385953-46385975 CATGTGGCAGTGCAGAAACTGGG + Intronic
1108256998 13:48620502-48620524 CTTTTTCCATTGTTGGAACTTGG - Intergenic
1108802691 13:54118829-54118851 CATGTTACTCTGTGGGAACTGGG - Intergenic
1109390845 13:61690749-61690771 AATGTAGCAGTATTGGAACATGG + Intergenic
1110829448 13:80013339-80013361 AATGTGGCAGTGTTGGAAAGTGG + Intergenic
1111884347 13:94000567-94000589 CAAGTTGGACAGTTGGAACTGGG + Intronic
1112332603 13:98488050-98488072 CATTCTGCAGTGTTGGGAATTGG - Intronic
1114918415 14:27296054-27296076 CATGTTGAAATGTTGGAAAAGGG - Intergenic
1115587196 14:34826137-34826159 CAGGTTGCAGTGTAGGATTTTGG - Exonic
1118131160 14:62965237-62965259 AATGTGGTAGTGTTGGAACATGG + Intronic
1118979330 14:70703376-70703398 CATATTGAAGTGATGGTACTAGG - Intergenic
1120073729 14:80132669-80132691 GATGTGGCAGTGTTGGAAGGTGG + Intergenic
1120113091 14:80581451-80581473 CATGCTGGTGTGTTGTAACTGGG + Intronic
1123695611 15:22877105-22877127 AATGTAGCAGTGTTGGAAGGTGG + Intronic
1126839152 15:52699357-52699379 GATGTGGGAATGTTGGAACTTGG - Intronic
1128364052 15:66984424-66984446 CATGTAGCAGTGTTGGGAGGTGG - Intergenic
1129921566 15:79323576-79323598 CATGTTGCAGTGCTTAATCTAGG - Intronic
1130902027 15:88214510-88214532 AATGTGGCTGTGTTGGAAATAGG - Intronic
1135414730 16:22260412-22260434 CATGTTCCAGTAGTGGAACCAGG + Intronic
1135900293 16:26452358-26452380 CATGTTGCAGAGGTGGGTCTAGG + Intergenic
1141416421 16:83878976-83878998 CATTTTCCAGTGTTGGAATGTGG + Intergenic
1145876287 17:28320486-28320508 CAAGTTGCAGTCTGGGGACTTGG + Intronic
1146588605 17:34106815-34106837 CATATTCCAGGGCTGGAACTGGG - Intronic
1150900994 17:69276647-69276669 CCTGTTGGAGGGTTGGGACTGGG + Intronic
1151580921 17:74978178-74978200 CAAGGTGGAGTCTTGGAACTTGG + Intergenic
1155357492 18:24967442-24967464 CATGTAGCATTGTTGGATATGGG + Intergenic
1157186383 18:45543756-45543778 CCTGTTGCAGTGTTGGCCTTTGG + Intronic
1158279449 18:55805382-55805404 GAAGTTGCAGTGATAGAACTTGG - Intergenic
1158603794 18:58877234-58877256 CATGTAGCAGTGTTGGAAAACGG + Intronic
1161920880 19:7264867-7264889 CATGTTGGATGGTTGGAAATCGG - Intronic
925255051 2:2476192-2476214 TATTTTGCAGTGGTGAAACTGGG - Intergenic
925912960 2:8585012-8585034 CATGGTGCAGTGTTTCTACTTGG + Intergenic
926741412 2:16114480-16114502 CTTGTGGCAGCGTTGGAACCCGG - Intergenic
931471407 2:62541215-62541237 AATGTGGCAGTGTTGGGAGTGGG - Intergenic
931989430 2:67775109-67775131 CATTTTGCAATGATGGAAATGGG - Intergenic
932192560 2:69753255-69753277 CGAGTGGCAGTTTTGGAACTGGG + Intronic
932598680 2:73110032-73110054 CAGGTGGCAGTTTTGGGACTGGG + Intronic
932739367 2:74280087-74280109 CATGTTGCAGTGTTGGAACTTGG - Intronic
932941791 2:76175293-76175315 CATGATGGAGTGATGGAAATAGG - Intergenic
933039546 2:77445760-77445782 CAGCTTGCAGTCTTAGAACTAGG - Intronic
934914547 2:98290362-98290384 CAAGTTCCAGTGTTGGAGGTGGG - Intronic
937539653 2:122933502-122933524 CATGTTGCCTTATGGGAACTGGG + Intergenic
939234679 2:139476150-139476172 CATATTGCCCTGTGGGAACTGGG - Intergenic
939985959 2:148830130-148830152 CATGTTGAAATGTTGGAGGTGGG + Intergenic
940347919 2:152646462-152646484 CTTTTTGCTGTGTAGGAACTGGG + Intronic
940494682 2:154411006-154411028 CCTGCTGCAGTCTTGGAACATGG + Intronic
940901976 2:159134080-159134102 CATGACACAGTGGTGGAACTGGG + Intronic
945364609 2:208936327-208936349 CATTTTGGAGTGTTAAAACTTGG + Intergenic
947252370 2:228122208-228122230 GATGCTGCACTGCTGGAACTAGG - Intronic
947413755 2:229871358-229871380 CATGTTGAAATGTTGGAGATGGG + Intronic
948543288 2:238704940-238704962 CATGCTGCTGTGTTGGCCCTTGG - Intergenic
1169858911 20:10131860-10131882 AATGTTGCAGTGTGGTAAGTGGG + Intergenic
1170131609 20:13026677-13026699 CAAAGTGCAGTGTTGAAACTCGG + Intronic
1170451032 20:16483953-16483975 GATGCTGCATTGTAGGAACTTGG - Intronic
1170481499 20:16769496-16769518 AATGTGGCAGTGTTGGAAGGTGG - Intronic
1171488558 20:25500827-25500849 GATCTTGCAGGTTTGGAACTGGG - Exonic
1172510799 20:35499652-35499674 AGTGATGCACTGTTGGAACTAGG + Intronic
1172974327 20:38894887-38894909 CATGCTGCAGTGATGGCACGTGG - Intronic
1173137344 20:40450486-40450508 AAATCTGCAGTGTTGGAACTGGG - Intergenic
1173465225 20:43275560-43275582 CAGGTTTCAGGGTTGGAACATGG + Intergenic
1173710491 20:45151382-45151404 GATGTTGCATTGTTGGATCTAGG + Intergenic
1174366893 20:50061854-50061876 ATGGTTGCAGTGTGGGAACTTGG + Intergenic
1174799717 20:53553226-53553248 CTGGGTGCAGGGTTGGAACTTGG + Intergenic
1177115729 21:17083658-17083680 AATGTGGCAGTGTTGGAAGTGGG + Intergenic
1177626393 21:23666032-23666054 CTTGTTGCAGAGTTGGAAATTGG - Intergenic
1177733544 21:25060219-25060241 CATGTTGCCCTGTGGGAATTGGG - Intergenic
951514394 3:23542455-23542477 AAAGTTGCAGTATTGTAACTAGG + Intronic
951989417 3:28659440-28659462 CATTTTGCATTGGTGGCACTTGG + Intergenic
952985922 3:38783155-38783177 CATGTTGCTATGTTGGAGATTGG - Intronic
953034291 3:39198557-39198579 AATGTGGCAGTATTGAAACTCGG + Intergenic
955773777 3:62412586-62412608 CATTTTACAGAGTTGGAATTTGG - Intronic
955830224 3:62993449-62993471 ATTGTTGAAGGGTTGGAACTTGG + Intergenic
956199498 3:66691729-66691751 CATGGTGCAGTTTTAGAATTAGG - Intergenic
956725129 3:72150694-72150716 CATGTGTCATTGTTGGAAATGGG + Intergenic
958263483 3:91409274-91409296 CATGTTGCTCTGTGGGAAGTAGG + Intergenic
958464331 3:94440006-94440028 CAGGGGGCAGTGTTGGGACTTGG - Intergenic
959357107 3:105345573-105345595 TATGTTTCAGTGTTGGAGGTGGG - Intergenic
960522029 3:118666033-118666055 CATATTGCCCTGTTGGAGCTTGG - Intergenic
961587301 3:127943084-127943106 AATGTGGCAGTGTTGGAAGGTGG - Intronic
962094802 3:132282737-132282759 CAAGTTGCAGTCTTCAAACTTGG - Intronic
962334295 3:134512304-134512326 CTGGTTACAGTGTTGGCACTGGG + Intronic
962951492 3:140223766-140223788 CATGTTGCAGGGTGGGGACCAGG - Intronic
964074206 3:152673598-152673620 CATGTTGAAGTATTGGGAGTTGG - Intergenic
964280465 3:155058809-155058831 CATGAAGCAGTTTTGGAAATGGG - Intronic
967127921 3:186442414-186442436 CATGTGGCACTGTTCAAACTGGG + Intergenic
967380065 3:188847918-188847940 CATGAAGCAGAGCTGGAACTAGG + Intronic
969215880 4:5722065-5722087 CATGTGGCAGAGCTGGGACTGGG - Intronic
969958624 4:10919284-10919306 AATGTTGCAATGTTGGAAGGTGG + Intergenic
971575108 4:28263035-28263057 CGTGTGGCAGTGTTGGAATGGGG + Intergenic
973734245 4:53854852-53854874 CATGGTGTATTGTAGGAACTGGG - Intronic
974274634 4:59702523-59702545 AATGTTACAGTGCTGGAAATAGG + Intergenic
978333846 4:107644872-107644894 CATGCTGCAGTGTTGGAGGAAGG - Exonic
983029837 4:162785932-162785954 CAGTTTGCAGGGTTTGAACTGGG + Intergenic
984123151 4:175771165-175771187 CATATTGCAGGGTTGGTAATGGG - Intronic
984836569 4:184028012-184028034 TATGCTGCACTGTTAGAACTTGG + Intergenic
985326566 4:188776919-188776941 CATTTTGTAGTGTTGGACGTTGG + Intergenic
985357273 4:189135044-189135066 CTTGTTCCAGTGGTGGCACTAGG + Intergenic
986529159 5:8716521-8716543 CTGGCCGCAGTGTTGGAACTTGG + Intergenic
986933819 5:12858554-12858576 CTTTTTGCAGTCTTGGGACTTGG + Intergenic
988167174 5:27608685-27608707 CTTCTTGCAGTGTTTGAGCTAGG + Intergenic
988315825 5:29626550-29626572 TATGTTGCAGTGTTGGCTTTTGG + Intergenic
988950629 5:36255835-36255857 CTTGTTGCAGGGGTGGAAATTGG - Intronic
990232347 5:53727188-53727210 AATCTTTCAGTGTTGGAAGTGGG + Intergenic
990781509 5:59369674-59369696 AATGTTGGAGTGTTGCCACTGGG + Intronic
990914809 5:60892636-60892658 CATCTTGCAGTGCTGCAACCTGG - Intronic
990928008 5:61051576-61051598 CATATAGCAGTGTTTGACCTAGG + Intronic
991692630 5:69240110-69240132 CAAGTTCCAGTATTGGAACTTGG + Intronic
994286912 5:97980235-97980257 AATGTAGGAGTGTTGGAACATGG + Intergenic
994812048 5:104532414-104532436 TGTGTTGCAGTGTTAGAAATAGG - Intergenic
1001105253 5:168847924-168847946 CATGTTGCAGGGTAGGCAATGGG - Intronic
1001204724 5:169751805-169751827 CATGTTCCAGACATGGAACTGGG + Intronic
1002079975 5:176731982-176732004 CATCTTGCAGAGCTGAAACTCGG + Intergenic
1003619052 6:7681228-7681250 CATAAGGCAGTGTTGGAAATGGG + Intergenic
1005836132 6:29710921-29710943 CATCTTCCAGTGTAGGAAGTGGG - Intergenic
1007193020 6:40036119-40036141 AATGTGGCAGTGTTGGGAGTTGG - Intergenic
1007693504 6:43717704-43717726 CATTTTGCAGTGATGGTAGTGGG - Intergenic
1008069707 6:47087054-47087076 CATATTACAGTGTTGTAATTTGG + Intergenic
1008991951 6:57613703-57613725 CATGTTGCTCTGTGGGAAGTAGG - Intronic
1009180552 6:60512651-60512673 CATGTTGCTCTGTGGGAAGTAGG - Intergenic
1009575211 6:65447492-65447514 CATGTTACAATGTTTGATCTGGG - Intronic
1012128588 6:95462170-95462192 AATGTGGCAGTGTTGAAAGTTGG - Intergenic
1014205762 6:118653282-118653304 CATGTTGCTCTTTTGGCACTTGG + Intronic
1014802090 6:125789939-125789961 CATGTTGCAGTGCTGGTCATGGG + Intronic
1015116811 6:129659049-129659071 CATGTTGCAGTGATGATATTTGG - Intronic
1015614982 6:135065142-135065164 CATGGTGCAGTGTTGAGAGTTGG - Intronic
1016403141 6:143701997-143702019 TAAGTAGCAGAGTTGGAACTAGG + Intronic
1016516764 6:144901919-144901941 TTTCTTGCAGTGTTGGCACTTGG + Intergenic
1016727012 6:147383469-147383491 CATTTTGCAATGGTGGACCTAGG + Intronic
1016728362 6:147401112-147401134 CTTTGTGCAGTCTTGGAACTTGG - Intergenic
1021083529 7:16391689-16391711 CATTCTGCAGTGATGGAAATAGG - Intronic
1021252443 7:18347556-18347578 CATGTTGCAGTTTATCAACTTGG - Intronic
1023081871 7:36533920-36533942 CTTGTCGCTATGTTGGAACTGGG + Intronic
1023411175 7:39890715-39890737 GGTATTGCACTGTTGGAACTTGG + Intergenic
1027572112 7:79882639-79882661 CATAATGCCCTGTTGGAACTGGG + Intergenic
1028128428 7:87142436-87142458 TATGTTGCAGTGTTGTAAACTGG + Intergenic
1031961287 7:127992373-127992395 CCTGTTGCAGTTTTTGAAGTGGG + Intronic
1032800871 7:135316452-135316474 CACGTTGCTCTGCTGGAACTGGG - Intergenic
1033001921 7:137514834-137514856 CAGGTTGCAATGATGGAAATAGG - Intronic
1034906886 7:154956947-154956969 GAAGTTGCAGTGGTGGAAGTGGG - Intronic
1036101455 8:5790960-5790982 CCTCTTGCAGTGTTGGATCAAGG - Intergenic
1037403289 8:18515385-18515407 CATGTCGCAGTGGTGGAGGTGGG + Intergenic
1037495783 8:19439479-19439501 TATGTTGCAGAGTAGGAATTAGG - Intronic
1038081829 8:24146281-24146303 CATGTGGCAGTGTTGGGAGATGG - Intergenic
1038482389 8:27910582-27910604 CAGGCTGCAGTGTGGAAACTGGG + Intronic
1038543118 8:28405302-28405324 CATGATGCAGTGCTGGAATGGGG + Intronic
1039949878 8:42161810-42161832 TAAGTTTCAGTGTTGGAACTTGG + Intronic
1042018797 8:64347284-64347306 CATGTTGCAGTTTTGTTACATGG + Intergenic
1043415083 8:80039659-80039681 CACATTGCAGAGTTTGAACTTGG - Intronic
1044313820 8:90726763-90726785 CTTGTGGCAGTGTTGGTACAAGG - Intronic
1046406613 8:113780809-113780831 CTTCTTGCTGTGTTGGAAGTGGG + Intergenic
1047542698 8:125785580-125785602 CCTGTTTCAGTGTTGCAATTTGG + Intergenic
1048025703 8:130584651-130584673 CACATTGCCATGTTGGAACTGGG + Intergenic
1049690488 8:143956829-143956851 CATGGTGCAGCCTTGGAAGTGGG + Intronic
1051930641 9:22381099-22381121 CATTTTGCAGTCTTGGACATTGG - Intergenic
1052443666 9:28531369-28531391 AATGTTATAGTGTTGAAACTTGG - Intronic
1056576378 9:87858495-87858517 CAGGGAGCACTGTTGGAACTGGG + Intergenic
1057233272 9:93338416-93338438 CTTTTTGCAGTCTTGGGACTTGG + Intronic
1059761376 9:117340810-117340832 CATGAATCACTGTTGGAACTGGG - Intronic
1059862364 9:118478961-118478983 CCAGTTGCAGTCTTGGATCTGGG + Intergenic
1060946590 9:127573102-127573124 CCTGTTCCAGTGTTTGAACAAGG - Intronic
1186781481 X:12916388-12916410 AATCTAGCAATGTTGGAACTTGG + Intronic
1188220214 X:27532238-27532260 CAGATTGCAGGGCTGGAACTGGG + Intergenic
1188801428 X:34535977-34535999 TATGTGGCAGTATTGGAAGTGGG + Intergenic
1192388161 X:70695009-70695031 AATGTGGCAGTGTTAGGACTTGG - Intronic
1192721866 X:73707377-73707399 CTTGTTGCAGGGTGGGGACTGGG + Intergenic
1193981324 X:88185356-88185378 CTTTGTGCAGTCTTGGAACTTGG + Intergenic
1194933416 X:99917094-99917116 CATGCTTCAGTGTTGGAAGGAGG + Intergenic
1194947307 X:100084347-100084369 CATTATTCAGTGGTGGAACTGGG - Intergenic
1195436632 X:104852002-104852024 AATGTGGCAGTGTTGGAAAGTGG - Intronic
1196056744 X:111364055-111364077 CATAGTGCAGTGGTGGAAATAGG + Intronic
1196500430 X:116374600-116374622 CGTGTGGCAGTGTTGGAAGGTGG - Intergenic
1196836211 X:119816392-119816414 CATGTTTCAGTGTTGGCAAGAGG - Intergenic
1198872646 X:141192639-141192661 CATGCTCCAGGCTTGGAACTTGG - Intergenic
1198944873 X:141999799-141999821 CATGTTGCAAGGTTGGAAGCAGG - Intergenic