ID: 932739573

View in Genome Browser
Species Human (GRCh38)
Location 2:74281376-74281398
Sequence CTCCACTTGCAGTCAGGCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 235}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932739561_932739573 23 Left 932739561 2:74281330-74281352 CCACACTTGGGTGGGTTCCAACC 0: 1
1: 0
2: 2
3: 11
4: 82
Right 932739573 2:74281376-74281398 CTCCACTTGCAGTCAGGCAGAGG 0: 1
1: 0
2: 0
3: 13
4: 235
932739559_932739573 27 Left 932739559 2:74281326-74281348 CCCTCCACACTTGGGTGGGTTCC 0: 1
1: 0
2: 2
3: 7
4: 156
Right 932739573 2:74281376-74281398 CTCCACTTGCAGTCAGGCAGAGG 0: 1
1: 0
2: 0
3: 13
4: 235
932739565_932739573 1 Left 932739565 2:74281352-74281374 CCAGGTCATTCTCCTTCCCAGCC 0: 1
1: 0
2: 2
3: 52
4: 461
Right 932739573 2:74281376-74281398 CTCCACTTGCAGTCAGGCAGAGG 0: 1
1: 0
2: 0
3: 13
4: 235
932739560_932739573 26 Left 932739560 2:74281327-74281349 CCTCCACACTTGGGTGGGTTCCA 0: 1
1: 0
2: 3
3: 12
4: 179
Right 932739573 2:74281376-74281398 CTCCACTTGCAGTCAGGCAGAGG 0: 1
1: 0
2: 0
3: 13
4: 235
932739564_932739573 2 Left 932739564 2:74281351-74281373 CCCAGGTCATTCTCCTTCCCAGC 0: 1
1: 0
2: 3
3: 41
4: 349
Right 932739573 2:74281376-74281398 CTCCACTTGCAGTCAGGCAGAGG 0: 1
1: 0
2: 0
3: 13
4: 235
932739563_932739573 6 Left 932739563 2:74281347-74281369 CCAACCCAGGTCATTCTCCTTCC 0: 1
1: 0
2: 1
3: 41
4: 396
Right 932739573 2:74281376-74281398 CTCCACTTGCAGTCAGGCAGAGG 0: 1
1: 0
2: 0
3: 13
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932739573 Original CRISPR CTCCACTTGCAGTCAGGCAG AGG Intronic
901780425 1:11590592-11590614 CTCCCCTTGCAGCCAGGGTGGGG + Intergenic
902458481 1:16553618-16553640 CTCCAATTGCACACAGCCAGTGG - Intergenic
902493679 1:16854298-16854320 CTCCAATTGCACACAGCCAGTGG + Intronic
903151666 1:21414377-21414399 CTCCAATTGCACACAGCCAGTGG - Intergenic
903183199 1:21615305-21615327 CCCCACCTGGAGTCAGGAAGGGG + Intronic
905247271 1:36623862-36623884 CACCACCTGCAGCCAGGCCGTGG - Intergenic
907308582 1:53526979-53527001 CTCCAAGTGCAGACGGGCAGGGG - Intronic
908442917 1:64172818-64172840 CTCCACTTGAGGTCAAGCAGAGG + Intronic
908892760 1:68864316-68864338 CTGCCCTTGCAATAAGGCAGAGG - Intergenic
909381311 1:75001961-75001983 CTCCACTTGAATCCAGGAAGTGG + Intergenic
910477435 1:87622169-87622191 CTGCACTTGCAGGGATGCAGTGG + Intergenic
913607162 1:120476742-120476764 CTCCAATTGCACACAGCCAGTGG + Intergenic
914209271 1:145563403-145563425 CTCCAATTGCACACAGCCAGTGG - Intergenic
914268189 1:146055771-146055793 CTCCAATTGCACACAGCCAGTGG - Intergenic
914368905 1:147005091-147005113 CTCCAATTGCACACAGCCAGTGG + Intergenic
914584031 1:149045096-149045118 CTCCAATTGCACACAGCCAGTGG - Intronic
915472969 1:156136821-156136843 CCTCAATTGCAGGCAGGCAGAGG + Intronic
917196390 1:172470286-172470308 CTTCAGATACAGTCAGGCAGAGG - Intergenic
920720319 1:208381123-208381145 CTGCTCTTGCAGTGAGGCTGGGG - Intergenic
923366338 1:233265382-233265404 CTTCTCTTGCAGTGAGGCTGAGG + Intronic
1064705637 10:18069860-18069882 CTGCCCTTGCAATAAGGCAGAGG + Intergenic
1068403823 10:56564331-56564353 CTGCACTTGCAAAAAGGCAGAGG + Intergenic
1069420082 10:68239237-68239259 CTCCACTGGCAGGCAGGGATAGG - Intergenic
1070520997 10:77253499-77253521 CTCCACTTGGAGTCAGTGATGGG + Intronic
1071329651 10:84546859-84546881 CACCACTTGCAGCCATGCTGTGG + Intergenic
1073977571 10:109118213-109118235 CTGCCCTTGCAATAAGGCAGAGG + Intergenic
1075182554 10:120225039-120225061 CTGCCCTTGCAATCAGGCAGAGG - Intergenic
1075716864 10:124560835-124560857 CTCCTCTTGCAGCCAGGGTGGGG - Intronic
1075809429 10:125214248-125214270 CTCACATTGCAGTCAGGCTGGGG - Intergenic
1077373252 11:2193499-2193521 CTCCACTGGGAGGTAGGCAGAGG + Intergenic
1077471109 11:2760999-2761021 CTGCCCTTGCCGTAAGGCAGGGG - Intronic
1080502687 11:32885630-32885652 CTGCTCTTGCAGAAAGGCAGAGG + Intergenic
1081062885 11:38503030-38503052 CTGCCCTTGCAGAAAGGCAGAGG - Intergenic
1081217328 11:40417571-40417593 GATCACTTGAAGTCAGGCAGAGG - Intronic
1081279232 11:41187649-41187671 CTGTCCTTGCAGTAAGGCAGGGG + Intronic
1081312559 11:41591976-41591998 CTGCCCTTGCAGAAAGGCAGAGG - Intergenic
1084480002 11:69414723-69414745 CTGCACTGGCAGGCAGGTAGAGG - Intergenic
1085397330 11:76213299-76213321 GGCCAATGGCAGTCAGGCAGGGG - Intergenic
1085483171 11:76839331-76839353 CTCATTTTGCAGTCAGGCAGTGG + Intergenic
1086579117 11:88376460-88376482 ATCCCCTTGGAGTAAGGCAGTGG + Intergenic
1088484151 11:110325094-110325116 CTGTCCTTGCAGTAAGGCAGGGG - Intergenic
1089504508 11:118954557-118954579 CTTCTCATGCAGTCATGCAGTGG - Intronic
1089602898 11:119626069-119626091 CTCCACATGCGCTCATGCAGAGG + Intronic
1090426242 11:126608707-126608729 CTCCTCCTGGAGGCAGGCAGGGG + Intronic
1093242280 12:16691928-16691950 AGCCACATGAAGTCAGGCAGTGG + Intergenic
1093712220 12:22340123-22340145 CTGCCCTTGCAATAAGGCAGAGG + Intronic
1094475854 12:30840044-30840066 CTCTGCTGGCAGTCAGGCTGCGG + Intergenic
1098585262 12:72146760-72146782 CTGCCCTTGCAATAAGGCAGAGG - Intronic
1099055362 12:77833651-77833673 CTGCCCTTGCAATAAGGCAGAGG - Intronic
1099981708 12:89611871-89611893 CTCCTCTTACAGTGAGGTAGGGG - Intronic
1100385752 12:94103219-94103241 CTCTGCTGGCTGTCAGGCAGGGG - Intergenic
1100672991 12:96836209-96836231 CTACTGTTGAAGTCAGGCAGCGG + Intronic
1101295553 12:103419835-103419857 CTCCAGTTTCAGTCAAGCAGGGG + Intronic
1104270660 12:127279917-127279939 GTCCACTAACAGTCATGCAGGGG + Intergenic
1104372334 12:128234952-128234974 CTCTCTCTGCAGTCAGGCAGTGG + Intergenic
1105539794 13:21306540-21306562 CTCACCTTGCAGGCAGGCACTGG + Intergenic
1106120716 13:26858125-26858147 CTCCCCTTACATGCAGGCAGGGG + Intergenic
1107125324 13:36840006-36840028 CTGCCCTTGCAATAAGGCAGAGG - Intergenic
1109190319 13:59315356-59315378 CTACTCTTGCAGGCATGCAGTGG + Intergenic
1109958709 13:69603173-69603195 CTACCCTTGCAGAAAGGCAGAGG + Intergenic
1113465050 13:110506942-110506964 GTAGACTTGGAGTCAGGCAGGGG + Intronic
1114460956 14:22886007-22886029 ATCCCCCTGCAGACAGGCAGAGG - Exonic
1115556228 14:34546872-34546894 TTCAACTTCCAGTAAGGCAGGGG - Intergenic
1115557680 14:34556209-34556231 TTCAACTTCCAGTAAGGCAGGGG + Intergenic
1115999474 14:39227644-39227666 CTCCACTTGCACTCCAGCATGGG - Intergenic
1118820757 14:69344114-69344136 CTACACTTGCAAACAGTCAGTGG + Intronic
1119532910 14:75375613-75375635 CTCCTCTTCCACTCAGGCATTGG - Intergenic
1121096339 14:91220431-91220453 CTTTACTTTCAGTCAGGCTGGGG + Intronic
1128682665 15:69662993-69663015 CCCCACGTTCAGTCAGGAAGGGG + Intergenic
1129174611 15:73830939-73830961 CTCCTCTTGCAGTGTGCCAGAGG + Intergenic
1129852870 15:78804594-78804616 CTCTACGTGCAGTTCGGCAGAGG - Intronic
1130250096 15:82294451-82294473 CTCTACATGCAGTTTGGCAGGGG + Intergenic
1131659835 15:94502085-94502107 CTCCACTTGGACACAGGAAGGGG + Intergenic
1132912822 16:2324278-2324300 ATTGACTTGCAGGCAGGCAGAGG + Intronic
1133380777 16:5328618-5328640 TTCCACGTGCAGACAGGCATGGG - Intergenic
1133448125 16:5879835-5879857 CTCCACTATCACTCTGGCAGGGG + Intergenic
1133841669 16:9415782-9415804 CGCCACCTGCAGACAGGCAGAGG - Intergenic
1134098578 16:11435874-11435896 CTGCACCTGCAGGGAGGCAGGGG + Exonic
1134514985 16:14879846-14879868 CACCACTCACAGTCAGGTAGTGG - Intronic
1134702662 16:16278493-16278515 CACCACTCACAGTCAGGTAGTGG - Intronic
1134825315 16:17279828-17279850 GTCCTCAAGCAGTCAGGCAGAGG + Intronic
1134964881 16:18433622-18433644 CACCACTCACAGTCAGGTAGTGG + Intronic
1134969168 16:18516157-18516179 CACCACTCACAGTCAGGTAGTGG + Intronic
1139969797 16:70766688-70766710 CTCCACCTCCAGCCAGGCAAGGG - Intronic
1140843190 16:78861250-78861272 CCCAGCTTGAAGTCAGGCAGAGG - Intronic
1142024153 16:87803533-87803555 ATGCACTTGCAGTCAGGTGGTGG - Intergenic
1143688812 17:8542749-8542771 CTCCACTGTCACTCAGGCTGTGG + Intronic
1144037207 17:11377749-11377771 CTCCATTTACACTAAGGCAGTGG + Intronic
1144371384 17:14594805-14594827 CTGCCCTTGCAGAAAGGCAGAGG + Intergenic
1147718413 17:42522982-42523004 CTCCACTTACACTAAGGCCGGGG - Intergenic
1148785955 17:50146334-50146356 CACCACTTGGAGCCAGGCGGGGG + Intronic
1151959939 17:77400556-77400578 CTCCAAATGCACTCAGGCACTGG - Intronic
1152028674 17:77827790-77827812 CTCCACCTGCAGTGATGCCGGGG - Intergenic
1153050784 18:901536-901558 CTGCACTTGAAGCCAGGCTGGGG + Intergenic
1154492693 18:14933619-14933641 CTCCAGGTGCAGACAGGGAGGGG + Intergenic
1155314491 18:24558158-24558180 CTACCCTTGCAGAAAGGCAGAGG - Intergenic
1155808779 18:30206181-30206203 CTGCCCTTGCAGTAAGACAGAGG - Intergenic
1157607196 18:48933309-48933331 CTCTACCTGGAGGCAGGCAGGGG - Intronic
1160068910 18:75607272-75607294 CTCTACATGCAGACATGCAGAGG - Intergenic
1160392763 18:78547655-78547677 GTCCCGTTGCAGTCAAGCAGGGG + Intergenic
1160719806 19:592145-592167 CCCCACTTCCAGTCGGGCAGTGG + Intronic
1161713684 19:5863872-5863894 CCTGACTTGCAGCCAGGCAGTGG + Intergenic
1163090085 19:15013297-15013319 CTCCACCTGTAGCCAGGGAGAGG + Intronic
1168038631 19:53740244-53740266 CTTCACTTGGGGTCAGGTAGAGG + Intergenic
1168261405 19:55197086-55197108 CACCACTTGAAGGCAGGAAGGGG + Intronic
1168402074 19:56091007-56091029 CTCCAGGTGAAGTCAGGAAGGGG + Intronic
1202709051 1_KI270714v1_random:6487-6509 CTCCAATTGCATACAGCCAGTGG + Intergenic
925333194 2:3074631-3074653 CTGCCCTTGCAATAAGGCAGAGG - Intergenic
925381158 2:3427211-3427233 CTCAGGCTGCAGTCAGGCAGAGG - Intronic
925864163 2:8211415-8211437 TGCCACTTGCATTCTGGCAGTGG - Intergenic
926247828 2:11133625-11133647 CCCAACTTGCAGTCAGGCTGCGG - Intronic
927081688 2:19636614-19636636 CTCTGCTTAGAGTCAGGCAGGGG + Intergenic
929827347 2:45319532-45319554 CACCATTTGCAGTCATACAGAGG + Intergenic
929886047 2:45879454-45879476 CTCCCCTTGCAAAAAGGCAGAGG + Intronic
929992879 2:46804281-46804303 CTCCAAGAGCAGTCAGGCCGGGG + Intergenic
932739573 2:74281376-74281398 CTCCACTTGCAGTCAGGCAGAGG + Intronic
933352885 2:81178210-81178232 CTGCTCTTGCAGAAAGGCAGAGG - Intergenic
936611824 2:114009059-114009081 CTCCCCCTGCAGTCACACAGGGG - Intergenic
936920954 2:117687745-117687767 CTCCACTTGCACTGTGACAGTGG - Intergenic
936998758 2:118442231-118442253 TTCCACTTGCAGAGAAGCAGTGG + Intergenic
937055084 2:118927797-118927819 CCTCACTTGCAGACAGGCATGGG - Intergenic
937839087 2:126507614-126507636 CTTCACTTCCCGTCAGTCAGTGG - Intergenic
939256188 2:139747281-139747303 CTGCCCTTGCAGAAAGGCAGAGG + Intergenic
940046414 2:149415348-149415370 CTCCTTTTTCAGCCAGGCAGAGG - Intronic
941106817 2:161363946-161363968 CTGTCCTTGCAGTAAGGCAGGGG - Intronic
942705796 2:178770413-178770435 CTCCACGTGCAGTCTGGCACTGG + Exonic
943096737 2:183438322-183438344 CTACAATTGCTGTCAGCCAGGGG - Intergenic
944553059 2:200863513-200863535 CGCCACTTGCACTCCGGCCGGGG + Intronic
945912065 2:215660850-215660872 GTCCACAGGCAGCCAGGCAGTGG - Intergenic
945962230 2:216147405-216147427 GACCACTTCCAGTCAGACAGTGG + Intronic
946185276 2:217977377-217977399 CTCCCCTTGCAGAGATGCAGAGG - Intronic
946451576 2:219784607-219784629 CTGCCCTTGCAGAAAGGCAGAGG - Intergenic
947984627 2:234437812-234437834 CTCCACTTGCTTTCTTGCAGTGG + Intergenic
1168794955 20:605292-605314 CTAGGCATGCAGTCAGGCAGGGG - Intronic
1172596624 20:36154820-36154842 CTCCTCTGGCAGGCAGGCCGCGG - Exonic
1173939729 20:46900164-46900186 ATCTACTTGCAGTCATTCAGAGG + Intronic
1174265101 20:49325552-49325574 CTCTACTGGCAGCCAGGGAGAGG + Intergenic
1174926669 20:54767844-54767866 CTCCACTGGAAGATAGGCAGAGG + Intergenic
1177630013 21:23714614-23714636 CTGCCCTTGCAGAAAGGCAGAGG - Intergenic
1178426563 21:32483499-32483521 CTCCACTCCCAGGCAGTCAGGGG + Intronic
1178724334 21:35037571-35037593 CTCCACGGGCAGACAGACAGTGG + Intronic
1179107331 21:38414184-38414206 CTCCATGTGAAGACAGGCAGAGG - Intronic
1180025496 21:45158916-45158938 TTCCACATGCAGTCTGGAAGGGG - Intronic
1180958878 22:19753790-19753812 CCCCAGGTGCAGCCAGGCAGAGG - Intergenic
1181122819 22:20683554-20683576 GTCCACCTGCAGACAGTCAGGGG + Intergenic
1181179606 22:21057535-21057557 GTCCACCTGCAGACAGTCAGGGG - Intronic
1182230162 22:28831771-28831793 CTCCCCTTGGAATCAGGCTGTGG + Intergenic
1182452022 22:30427327-30427349 GTCCACTTGCGGACAGCCAGGGG - Exonic
1182853902 22:33500588-33500610 CTGCAGTTAGAGTCAGGCAGAGG - Intronic
1183409235 22:37645304-37645326 CACCCCGAGCAGTCAGGCAGGGG - Intronic
949444155 3:4115394-4115416 CTGCCCTTGCAATAAGGCAGAGG + Intronic
949464788 3:4333181-4333203 CTGCCCTTGCAGAAAGGCAGAGG + Intronic
950490181 3:13299808-13299830 CTCAACTGGGAGCCAGGCAGAGG - Intergenic
951583052 3:24186039-24186061 CCCCACGTGCAGTCAGGGAAGGG + Intronic
951637810 3:24798803-24798825 CTGCCCTTGCAGAAAGGCAGAGG + Intergenic
954835410 3:53462730-53462752 ATGTACTTGCAGTCAGGCAATGG + Intergenic
955609203 3:60739265-60739287 CTGCCCTTGCAGAAAGGCAGAGG + Intronic
956181113 3:66518993-66519015 CTGCCCTTGCGGTAAGGCAGAGG - Intergenic
956748144 3:72325703-72325725 ATGCAGTTGTAGTCAGGCAGGGG + Intergenic
959164360 3:102758577-102758599 CTGCCCTTGCAGAAAGGCAGAGG - Intergenic
959338510 3:105097517-105097539 TTTCATTTGCAGTCAGGTAGAGG - Intergenic
959857328 3:111174851-111174873 CTGCCCTTGCAGAAAGGCAGAGG - Intronic
962403759 3:135083019-135083041 CTCCTCAGGCAGCCAGGCAGAGG + Intronic
964802822 3:160573937-160573959 CTCCACCTGCAGCCAGGGTGCGG - Intergenic
965065141 3:163839086-163839108 CTGCCCTTGCAATAAGGCAGAGG - Intergenic
965420824 3:168456188-168456210 CTGCCCTTGCAATAAGGCAGAGG - Intergenic
967473091 3:189885862-189885884 CTCATCTTGCTGTCATGCAGAGG - Intronic
968177224 3:196561415-196561437 CTTTACTTGCATTCAGGCAGAGG + Exonic
970720945 4:18987787-18987809 CTGCCCTTGCAGAAAGGCAGAGG + Intergenic
971852178 4:31996830-31996852 CTCCACCTGCAGTCCGGTGGGGG + Intergenic
972563703 4:40250876-40250898 TTCCACTTGAATTCAGCCAGTGG + Intergenic
975868722 4:78753871-78753893 CTCCCATTGCAGTGTGGCAGGGG + Intergenic
979430550 4:120624500-120624522 CTCAACTAGGAGTCAGGGAGGGG - Intergenic
980734515 4:136867561-136867583 CTGTCCTTGCAGTAAGGCAGAGG + Intergenic
984790077 4:183607286-183607308 CTGCCCTTGCAGTAAGGCAGAGG - Intergenic
985940407 5:3131293-3131315 CTCCACCCGCTGGCAGGCAGGGG - Intergenic
986337369 5:6765760-6765782 CTCCACGTGGAGTCTGGCTGAGG + Intergenic
986457273 5:7931923-7931945 CTGCCCTTGCAGAAAGGCAGAGG + Intergenic
986543353 5:8870281-8870303 CTGCCCTTGCAATAAGGCAGAGG - Intergenic
990666934 5:58083021-58083043 CCCCATATGCAGTCAGGCAATGG + Intergenic
991527643 5:67579603-67579625 CACTAATTGCAGTGAGGCAGAGG + Intergenic
992421705 5:76612967-76612989 CTCCACCTTCAATGAGGCAGTGG - Intronic
994175283 5:96703584-96703606 CTCCACTTACACACAGGCAGGGG + Intronic
995979037 5:118078981-118079003 CTGTCCTTGCAGTAAGGCAGGGG + Intergenic
997424877 5:133796358-133796380 CTGCCCTTGCAGAAAGGCAGAGG - Intergenic
997794987 5:136800189-136800211 CTCCTCTTGCTGTCAGGAGGTGG - Intergenic
999810937 5:155126642-155126664 CTGCCCTTGCAGAAAGGCAGAGG - Intergenic
1000398857 5:160803989-160804011 CTCCAGTTCCAGTCAGGAACTGG - Intronic
1002501930 5:179652299-179652321 CCCCACATGCAGGCAGGCGGAGG + Intergenic
1003593166 6:7452867-7452889 CTGCCCTTGCAGAAAGGCAGAGG + Intergenic
1009468444 6:64002395-64002417 CTGCCCTTGCAGTAAAGCAGAGG + Intronic
1010342448 6:74770283-74770305 CTCCACTGGCATTTAGCCAGTGG - Intergenic
1011907686 6:92392463-92392485 CTGCCCTTGCAGAAAGGCAGAGG + Intergenic
1013552005 6:111217094-111217116 CTCCAATAGCAGTCAGGCTAGGG - Intronic
1015605132 6:134946329-134946351 CTCCTCTTGCTGGCTGGCAGTGG - Intronic
1018271612 6:162085080-162085102 CTCCTCATGCAGTGAGACAGTGG + Intronic
1019102226 6:169640814-169640836 GGCCTCTTGCAGCCAGGCAGTGG - Intronic
1019572579 7:1719863-1719885 AGCCACTGGCACTCAGGCAGGGG + Intronic
1022331469 7:29383374-29383396 CTGCTCTAGCAGTCAGGAAGAGG + Intronic
1022993952 7:35734420-35734442 CACTGCTTTCAGTCAGGCAGAGG + Intergenic
1024363027 7:48488464-48488486 CTTAACTTGCTGTGAGGCAGCGG + Intronic
1024530855 7:50391569-50391591 CAACACTTCCAGACAGGCAGAGG - Intronic
1024794415 7:53004344-53004366 CTCCACCTGCGGCCAGGCTGTGG + Intergenic
1029544167 7:101201750-101201772 CCCCACCTGCAGTCACCCAGCGG + Intergenic
1031130598 7:117829088-117829110 CTCCACTTTCAGTGAGAAAGTGG - Intronic
1031275985 7:119724291-119724313 CTGCCCTTGCAGAAAGGCAGAGG - Intergenic
1031734083 7:125334326-125334348 CTCCTCTTCCACTCAGGCATTGG + Intergenic
1032017532 7:128389411-128389433 CTCCAGTGCCAGTCAGGAAGTGG - Intergenic
1033970591 7:147034552-147034574 CTGTCCTTGCAGTAAGGCAGGGG - Intronic
1034119227 7:148611680-148611702 CTGCCCTTGCAATAAGGCAGAGG + Intronic
1034549624 7:151812158-151812180 CTCCTAATGCAGTCAGGTAGGGG - Intronic
1036375394 8:8195084-8195106 CTCTCCTTGCAATAAGGCAGGGG + Intergenic
1036854140 8:12228064-12228086 CTCTCCTTGCAATAAGGCAGGGG - Intergenic
1036875510 8:12470564-12470586 CTCTCCTTGCAATAAGGCAGGGG - Intergenic
1037175912 8:15945578-15945600 CTGCCCTTGCAATAAGGCAGAGG + Intergenic
1037658800 8:20909761-20909783 CACCACTGGCATACAGGCAGAGG - Intergenic
1037911386 8:22745684-22745706 CTCACCTTGCTCTCAGGCAGAGG - Intronic
1039254893 8:35708197-35708219 CTCCATGAGCAGGCAGGCAGAGG + Intronic
1039849327 8:41348744-41348766 CTGCAGTTGGAGTAAGGCAGAGG + Intergenic
1040483553 8:47849372-47849394 CTCCTCTTGCAGACAGGTATGGG - Exonic
1043346530 8:79303907-79303929 CTCCACCTGCAGCCCGGGAGCGG + Intergenic
1047199355 8:122751733-122751755 CTTCACTTGGAGCAAGGCAGGGG + Intergenic
1047435168 8:124830008-124830030 CTCCCTTTACAGACAGGCAGTGG - Intergenic
1049535634 8:143179812-143179834 CTCGGCCTGCAGTCAGTCAGAGG + Intergenic
1050041873 9:1504253-1504275 CTGCCCTTGCAGAAAGGCAGAGG + Intergenic
1051487789 9:17626985-17627007 CTCCACTTTCTGTCAGGCCCTGG + Intronic
1055231147 9:74067272-74067294 TTCCACTTGCACTTAGGAAGAGG + Intergenic
1056840593 9:89995703-89995725 CTCCTCTTTCCCTCAGGCAGGGG + Intergenic
1058533061 9:105926029-105926051 CTGCTCTTGCAGTCAGCCTGAGG + Intergenic
1060010543 9:120039745-120039767 GACCATTTGCAGTCAGGCTGTGG - Intergenic
1061804576 9:133130980-133131002 CTCCACTTGCAGCCAGGGACTGG - Intronic
1061857201 9:133448873-133448895 CTGCACTTGGAGTGAGGCAGGGG - Intronic
1062108270 9:134767382-134767404 ATCCACCTGCAGGCGGGCAGTGG - Intronic
1186286202 X:8046576-8046598 CTGCCCTTGCAATAAGGCAGGGG - Intergenic
1186463652 X:9767538-9767560 CTCCACTGCCAGACAGGAAGCGG + Intronic
1186463653 X:9767540-9767562 CTCCGCTTCCTGTCTGGCAGTGG - Intronic
1187255079 X:17635159-17635181 CTCCAATTGCAGTTGGCCAGGGG - Intronic
1189665684 X:43352190-43352212 CGCCAGTAGGAGTCAGGCAGGGG - Intergenic
1190048031 X:47128173-47128195 GACCATTTGCAGTCTGGCAGTGG - Intergenic
1190483049 X:50896995-50897017 CTGCCCTTGCAGAAAGGCAGAGG - Intergenic
1192113933 X:68392995-68393017 CTGCCCTTGCAGAAAGGCAGAGG + Intronic
1193508562 X:82372200-82372222 GACTACTTGCAGACAGGCAGCGG - Intergenic
1193934421 X:87599269-87599291 ATCAGCTTGCAGTCTGGCAGTGG - Intronic
1194106033 X:89768187-89768209 CTGCCCTTGCAATAAGGCAGAGG + Intergenic
1195002943 X:100659715-100659737 CTCCAGTTGCACTCAGAAAGAGG + Intronic
1195924517 X:110012421-110012443 CTCCACTGGGCGTCAGGGAGAGG + Intronic
1197747909 X:129945262-129945284 CTCCACTGGCAATTAGGTAGTGG + Intergenic
1200247189 X:154532491-154532513 CTCCACATGGTGGCAGGCAGTGG - Intronic
1200457989 Y:3416046-3416068 CTGCCCTTGCAATAAGGCAGAGG + Intergenic