ID: 932739754

View in Genome Browser
Species Human (GRCh38)
Location 2:74282612-74282634
Sequence CACTGGGTCTGGAGTGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 648
Summary {0: 1, 1: 0, 2: 6, 3: 49, 4: 592}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932739748_932739754 3 Left 932739748 2:74282586-74282608 CCTCATCTACAGTTTCTTGGTTC 0: 1
1: 0
2: 1
3: 28
4: 282
Right 932739754 2:74282612-74282634 CACTGGGTCTGGAGTGCAGAGGG 0: 1
1: 0
2: 6
3: 49
4: 592
932739744_932739754 19 Left 932739744 2:74282570-74282592 CCCCTTCTAGAAACATCCTCATC 0: 1
1: 0
2: 3
3: 28
4: 311
Right 932739754 2:74282612-74282634 CACTGGGTCTGGAGTGCAGAGGG 0: 1
1: 0
2: 6
3: 49
4: 592
932739746_932739754 17 Left 932739746 2:74282572-74282594 CCTTCTAGAAACATCCTCATCTA 0: 1
1: 0
2: 0
3: 14
4: 199
Right 932739754 2:74282612-74282634 CACTGGGTCTGGAGTGCAGAGGG 0: 1
1: 0
2: 6
3: 49
4: 592
932739745_932739754 18 Left 932739745 2:74282571-74282593 CCCTTCTAGAAACATCCTCATCT 0: 1
1: 0
2: 0
3: 28
4: 245
Right 932739754 2:74282612-74282634 CACTGGGTCTGGAGTGCAGAGGG 0: 1
1: 0
2: 6
3: 49
4: 592
932739743_932739754 20 Left 932739743 2:74282569-74282591 CCCCCTTCTAGAAACATCCTCAT 0: 1
1: 0
2: 1
3: 26
4: 259
Right 932739754 2:74282612-74282634 CACTGGGTCTGGAGTGCAGAGGG 0: 1
1: 0
2: 6
3: 49
4: 592

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932739754 Original CRISPR CACTGGGTCTGGAGTGCAGA GGG Intronic
900752099 1:4404971-4404993 CACTGGGTGTTGAGTCCACAGGG - Intergenic
900760404 1:4466719-4466741 CACTGTGTCTGCAGGGCAGTAGG - Intergenic
901379268 1:8862217-8862239 CACTCAGGCTGGAGTGCAGTGGG - Intronic
901674162 1:10873221-10873243 CACTGGGTCTGGAGGGGATCAGG + Intergenic
901854063 1:12032855-12032877 CACTCAGGCTGGAGTGCAGTGGG + Intergenic
901886717 1:12228831-12228853 CACTCTGTCTGGAGTGCAGAGGG + Intergenic
902049378 1:13549726-13549748 CGCTGGGGCTGGACTGCAAAGGG + Intergenic
902334573 1:15747594-15747616 CTCTGGGACTGGGGTGCCGAGGG - Exonic
902351777 1:15861171-15861193 CACCTAGGCTGGAGTGCAGATGG + Intronic
902868255 1:19295456-19295478 CCCTTGGTCTGGAGAGCACATGG - Intergenic
904356344 1:29942565-29942587 CACAGGGTCTGGGGGGCAGAGGG + Intergenic
905361579 1:37424472-37424494 GACTGGAGCTGGAATGCAGAAGG + Intergenic
905576762 1:39050650-39050672 CACTCAGGCTGGAGTGCAGTGGG - Intergenic
906065407 1:42977009-42977031 CACTGGGGCCAGATTGCAGAGGG + Intergenic
906189529 1:43887425-43887447 AAGTGGGTTTGGAGTGTAGAAGG + Intronic
906461935 1:46041209-46041231 CACTGGGCCTGGTGTGTAGAGGG - Exonic
907135733 1:52138164-52138186 CTCTGAGGCTGGAGTGCAGTGGG + Intergenic
907221276 1:52908459-52908481 CACCGAGGCTGGAGTGCAGTTGG - Intronic
908543445 1:65143051-65143073 CACTCAGGCTGGAGTGCAGTGGG - Intergenic
910589793 1:88918543-88918565 CAGTGGGCCTGGTGTGTAGATGG + Intergenic
910740776 1:90513888-90513910 AACTGGGACTGGATTACAGATGG - Intergenic
912135895 1:106659824-106659846 CTCATGGTCTGGAGTGCTGATGG + Intergenic
913012548 1:114698506-114698528 CACCCAGTCTGGAGTGCAGTGGG + Intergenic
914243046 1:145865255-145865277 CACTCAGGCTGGAGTGCAGTAGG - Intergenic
914889953 1:151612992-151613014 TACTTGGTCTGGAGGGCAGAAGG - Intronic
914932756 1:151949515-151949537 CACTGGGGCAGGACAGCAGAGGG + Intergenic
915230260 1:154440693-154440715 CACCCAGTCTGGAGTGCAGTGGG + Intronic
915466658 1:156102328-156102350 CTCTGGGCCTGGGGTACAGAGGG + Intronic
915894256 1:159799137-159799159 CTCTGGGTCTGGCCTACAGAGGG - Intergenic
915940961 1:160117901-160117923 CTCTGGGTCTTGAATGCTGAAGG - Intronic
916087824 1:161283941-161283963 AACTGGGTCTGGAGTGTTGGGGG + Intronic
917081224 1:171258647-171258669 CCCTGAGTCTGTAATGCAGACGG - Intronic
917932549 1:179833141-179833163 CACCTGGGCTGGAGTGCAGTGGG - Intergenic
919536277 1:198791682-198791704 CACTGGGTCAGGAGCGAAGTGGG - Intergenic
920541254 1:206779786-206779808 CAATGAGGCTGGAGTGCAGAGGG - Intergenic
922487640 1:225988006-225988028 CACTGGGGCTGGACTGAATAAGG - Exonic
924031163 1:239887240-239887262 CACTCAGGCTGGAGTGCAGTGGG + Intronic
924200746 1:241655965-241655987 CACAGGGCCTGGTGTCCAGAAGG + Intronic
924710932 1:246529487-246529509 CCCTTGGTCTGGAGAGCACATGG + Intergenic
1063393811 10:5667721-5667743 CCTTCGGTCTGGACTGCAGATGG - Intergenic
1063568314 10:7192084-7192106 CACATGGTCTGGGGTGCTGAGGG - Intronic
1063633595 10:7758473-7758495 AACTGGGTCTACAGTGCAGAAGG + Intronic
1064198381 10:13263944-13263966 GACTGGATCAGAAGTGCAGAAGG + Intergenic
1064373895 10:14778294-14778316 CCCAGGCTCTGGAGTGCAGTGGG - Intergenic
1064919598 10:20502276-20502298 CACTCAGGCTGGAGTGCAGTGGG + Intergenic
1067049245 10:43002594-43002616 CTGTGGGCCTGGAGGGCAGATGG + Intergenic
1068496327 10:57789162-57789184 CCCTTGGTCTGGAGAGCATATGG + Intergenic
1068688585 10:59893563-59893585 CACCCGGGCTGGAGTGCAGTGGG - Intronic
1069238987 10:66114836-66114858 CGCTGAGGCTGGAGTGCAGTGGG - Intronic
1069719971 10:70543765-70543787 CACGGGGCCTGGTGTGAAGAAGG - Intronic
1070321172 10:75355776-75355798 CTATGGGTCTGGAATTCAGATGG + Intergenic
1070647570 10:78212389-78212411 CAGTGGAGCTGGAGAGCAGAAGG - Intergenic
1071373983 10:84983713-84983735 CACCCAGGCTGGAGTGCAGAGGG - Intergenic
1071461724 10:85903120-85903142 CTATGAGTCTGGAGTTCAGAGGG - Intronic
1072120800 10:92403997-92404019 CACTCAGGCTGGAGTGCAGTGGG - Intergenic
1072404077 10:95133262-95133284 CCCTTGGTCTGGAGAGCATATGG - Intergenic
1072528351 10:96294895-96294917 CACTAGCTCTGGTTTGCAGATGG - Intergenic
1073362000 10:102907282-102907304 CACCGAGGCTGGAGTGCAGTGGG + Intergenic
1073803187 10:107066166-107066188 CATTTGGTCTGGAATGGAGAGGG + Intronic
1073824175 10:107301468-107301490 CACAAGGTCTGGACTGCACATGG + Intergenic
1073932269 10:108589304-108589326 CACCCAGTCTGGAGTGCAGTGGG - Intergenic
1073948832 10:108784011-108784033 CAGTTGGTCTGGAGAGCACATGG + Intergenic
1074466821 10:113691114-113691136 CACTGGGTCAGGAGTGTGAATGG - Intronic
1074500771 10:114022029-114022051 AACTGGGTCTGGAAGGCAGGGGG + Intergenic
1075457307 10:122593155-122593177 CCCTGGGTCTGGTGTGGGGAGGG + Intronic
1075458889 10:122602685-122602707 CCCTGGGTCTGGTGTGGGGAGGG + Intronic
1075459520 10:122606744-122606766 CCCTGGGTCTGGTGTGGGGAGGG + Intronic
1075460152 10:122610803-122610825 CCCTGGGTCTGGTGTGGGGAGGG + Intronic
1075460784 10:122614862-122614884 CCCTGGGTCTGGTGTGGGGAGGG + Intronic
1075648559 10:124112410-124112432 GACTGGGCCTGCAGAGCAGAGGG + Intergenic
1075951418 10:126481006-126481028 CAGTGGGACTGCAGAGCAGAGGG - Intronic
1076057465 10:127387216-127387238 CAGTGTGGCTGGAATGCAGAGGG - Intronic
1076159786 10:128234897-128234919 CCCTGGGCCTGGAGGCCAGATGG + Intergenic
1076399922 10:130175837-130175859 CAGTGGGCCTGGGGTGCAGTGGG - Intronic
1077440323 11:2565873-2565895 CACTGGGTCTGGAGGAAGGAGGG + Intronic
1077461356 11:2712355-2712377 CGCTGGGGCTGGGGTGCAAATGG + Intronic
1077613279 11:3658377-3658399 CATTGGGTCTGGATTGGAGCAGG - Intronic
1078093693 11:8283668-8283690 CCCTCGATCTGGAGTGGAGAGGG + Intergenic
1078229282 11:9424699-9424721 CACTCAGGCTGGAGTGCAGTGGG - Intronic
1079046709 11:17110946-17110968 CACCCAGGCTGGAGTGCAGAGGG + Intronic
1079185819 11:18235596-18235618 CTCTTGGTGTAGAGTGCAGAAGG - Intronic
1079591800 11:22191945-22191967 CACTTAGGCTGGAGTGCAGCGGG + Intergenic
1079677048 11:23242325-23242347 CACTGGTTTTGAAGTGCTGATGG - Intergenic
1080619983 11:33979201-33979223 CACTCAGGCTGGAGTGCAGTTGG - Intergenic
1082015496 11:47483222-47483244 CACCTGGGCTGGAGTGCAGTGGG - Intronic
1082252304 11:49995723-49995745 CGCTTGGTCTGGAGAGCACATGG + Intergenic
1083760202 11:64811760-64811782 CACTCAGGCTGGAGTGCAGTGGG + Intergenic
1083851736 11:65371950-65371972 CACCTAGTCTGGAGTGCAGTGGG + Intergenic
1084032593 11:66489661-66489683 CTCTGGGTCAGGAATGCAGGTGG + Intronic
1084284790 11:68123899-68123921 CACTCAGGCTGGAGTGCAGTGGG - Intergenic
1084500078 11:69530231-69530253 CTCTGAGTCTGGAGTCCAGGAGG + Intergenic
1084892905 11:72245152-72245174 CACGAGGGCTGGAGCGCAGAGGG + Intronic
1085553748 11:77400498-77400520 CACTGAGTCCTCAGTGCAGATGG - Intronic
1087044224 11:93830791-93830813 TACTGAGGCTGGAGTGCAGTGGG + Intronic
1087169201 11:95033245-95033267 CATTGGCCCTGGAGTGCAGTAGG + Intergenic
1088269712 11:108021523-108021545 CACTCAGACTGGAGTGCAGTGGG + Intronic
1088817149 11:113429283-113429305 CACCCGGGCTGGAGTGCAGTGGG + Intronic
1088952654 11:114586991-114587013 CCCTTGGTCTGGAGAGCACATGG + Intronic
1089077016 11:115746321-115746343 CACTGGGTGTGAAGTGAGGATGG + Intergenic
1089231606 11:116982327-116982349 CACCCGGGCTGGAGTGCAGTGGG + Intronic
1089338751 11:117743586-117743608 AACTGGGCCTGGAGCCCAGAGGG - Intronic
1090292050 11:125554225-125554247 CCCTTGGTCTGGAGAGCACATGG - Intergenic
1090806036 11:130202928-130202950 CCCAGGGGCTGGAGTGCAGTTGG - Intronic
1091254269 11:134169988-134170010 CACTGGCTCTGGAGGGCATTGGG + Intronic
1091338798 11:134794582-134794604 AACTGAGTCTGGAGAGCAGAGGG + Intergenic
1092224275 12:6736788-6736810 CACTCAGGCTGGAGTGCAGTTGG - Intergenic
1092249034 12:6881664-6881686 CACTCAGGCTGGAGTGCAGTGGG - Intronic
1092310216 12:7344120-7344142 CACTTGGGCTGTAGTGCAGTGGG + Intergenic
1092625241 12:10319904-10319926 CACCTGGGCTGGAGTGCAGTGGG + Intergenic
1092655711 12:10682703-10682725 CACTGGGTCTGTATGTCAGAGGG + Intergenic
1093876440 12:24354353-24354375 CAGTGGGTCTGCTCTGCAGAAGG + Intergenic
1094085762 12:26589744-26589766 CACTCAGGCTGGAGTGCAGTGGG - Intronic
1094525225 12:31226879-31226901 CACAGGGTCTGGTGGGCAGGAGG + Intergenic
1095334846 12:41012134-41012156 CCCTTGGTCTGGAGAGCACATGG - Intronic
1095915689 12:47475488-47475510 GCCTGGGTGTGGAGTGTAGAGGG - Intergenic
1095942510 12:47736273-47736295 CCATGGGGCTGAAGTGCAGAGGG + Intronic
1096472900 12:51890089-51890111 CACTGGGTTTGGAGTGAAAAAGG + Intronic
1097825500 12:64171405-64171427 CACTGGGGATGGAGAGCTGATGG + Intergenic
1097860573 12:64514557-64514579 CATCAGGTCTGGACTGCAGAGGG + Intergenic
1097935026 12:65238232-65238254 CACTCAGGCTGGAGTGCAGTGGG - Intronic
1098872867 12:75836234-75836256 CACTGTGCCTGGTGTGGAGAGGG - Intergenic
1099203983 12:79707498-79707520 CACAGTGTCTGGAGTACAGCAGG + Intergenic
1100098325 12:91071833-91071855 CACCCAGGCTGGAGTGCAGAGGG + Intergenic
1100543374 12:95578892-95578914 CACAGTGTCTGGAGTACAAAAGG + Intergenic
1101046774 12:100814788-100814810 CACTTGGTTTGAAGTGAAGATGG - Intronic
1102496796 12:113325292-113325314 CACTCAGGCTGGAGTGCAGTGGG + Intronic
1102853121 12:116269614-116269636 CACTAAGGCTGGAGTGCAGTGGG - Intronic
1103351511 12:120286928-120286950 TAATGGGTCTGGAATGCAGCCGG + Intergenic
1103551768 12:121743133-121743155 GACTGTGTCTGGAGTGGGGAGGG + Intronic
1104113318 12:125724809-125724831 CACTCAGGCTGGAGTGCAGTGGG + Intergenic
1104375027 12:128258247-128258269 CACTGCTACTGGAATGCAGAGGG - Intergenic
1104509494 12:129364294-129364316 CTCTGGGTATAGTGTGCAGATGG + Intronic
1104678090 12:130729367-130729389 CACTGTGGCTGGAGTAGAGAAGG + Intergenic
1104714149 12:131005536-131005558 CTCTGCGTGTGGAGGGCAGACGG + Intronic
1104841835 12:131829294-131829316 TACTGGGTGTGGAGTGAGGAAGG - Intronic
1105609772 13:21957940-21957962 GACTGGGATTGGAGTGCTGATGG + Intergenic
1106719659 13:32425442-32425464 TCCTGGCTCTGGAGTGAAGAAGG - Intronic
1106797571 13:33222538-33222560 CACAGGTTCTGGAATTCAGAAGG - Intronic
1107139640 13:36984137-36984159 CACTGAGGCTGGAGTGCGGTGGG + Intronic
1107794961 13:44041902-44041924 TACTGGCTATGGAGCGCAGATGG - Intergenic
1108602614 13:52007728-52007750 CAGTTGGTCAGGAGTACAGATGG - Intronic
1108730442 13:53229866-53229888 CACTGGTGATAGAGTGCAGAGGG + Intergenic
1110321945 13:74170803-74170825 CACTCAGGCTGGAGTGCAGTGGG + Intergenic
1110710058 13:78640758-78640780 CACCCAGGCTGGAGTGCAGATGG - Intronic
1111013356 13:82342528-82342550 CACTCGGGCTGGAGTGCAGTGGG + Intergenic
1112681477 13:101771111-101771133 CATGGGGGCTGTAGTGCAGAAGG + Intronic
1113373332 13:109741950-109741972 CTCTGAGGCTGGAGTGCTGAGGG - Intergenic
1114284428 14:21226837-21226859 CACTCAGGCTGGAGTGCAGTGGG - Intronic
1114495911 14:23131957-23131979 CACTGGGACTGAACTGCATATGG + Intronic
1114832731 14:26164401-26164423 GCCTGGGTGTGGAGTGTAGACGG + Intergenic
1115267709 14:31518097-31518119 CACTCAGGCTGGAGTGCAGGGGG + Intronic
1115376372 14:32681412-32681434 CTCTGGGTCAAGAATGCAGAAGG + Intronic
1115659266 14:35475628-35475650 CACCTGGGCTGGAGTGCAGTGGG + Intergenic
1116843166 14:49840118-49840140 CCCTGAGGCTGGAGTGCAGTTGG - Intronic
1119531208 14:75362544-75362566 CACTCAGGCTGGAGTGCAGTGGG + Intergenic
1119709060 14:76808205-76808227 TACTGAGTCAGGAGTGGAGATGG - Intronic
1120183364 14:81367793-81367815 CTCTGGGCCTGGAGGGCAGATGG + Intronic
1120342716 14:83242806-83242828 CCCTGGTTTTGGATTGCAGATGG - Intergenic
1121122574 14:91385269-91385291 CCCTGGGTCTGGGGTAGAGATGG - Intronic
1121232053 14:92365294-92365316 GACTGGGTCTGCAGAGCAGCTGG + Intronic
1121555255 14:94831662-94831684 CAGTGGGAATGGAGGGCAGAAGG + Intergenic
1121660671 14:95632766-95632788 GACTGGGGCTGTAGAGCAGAGGG + Intergenic
1121997355 14:98613571-98613593 CACTGGCTCTGGAGCCCAGCTGG + Intergenic
1122027694 14:98889464-98889486 CAGTGGGGCTGGAGTGTAGAGGG + Intergenic
1123449900 15:20352969-20352991 CACCCGGGCTGGAGTGCAGTGGG + Intergenic
1123903232 15:24897110-24897132 CACTCAGGCTGGAGTGCAGAGGG - Intronic
1124169476 15:27360071-27360093 CACTGGGTCAGGAGTGCTGCAGG + Intronic
1124318274 15:28691857-28691879 CACTGAGGCTGGAGTACAGTGGG - Intergenic
1124565166 15:30805600-30805622 CACTGAGGCTGGAGTACAGTGGG + Intergenic
1125429868 15:39582907-39582929 CTCTGGGGCTGGGGTGCAGCAGG - Intronic
1125502579 15:40248654-40248676 CACTGGGTGTGAGGGGCAGAGGG - Intronic
1125595984 15:40886378-40886400 CACTGGGCCTGCAGTCCTGAGGG + Intergenic
1125683048 15:41544833-41544855 CACTGGCTGGTGAGTGCAGAGGG - Intergenic
1125790978 15:42365508-42365530 CACTGGATCTGGAGTTAAGTGGG - Intronic
1126148891 15:45504034-45504056 CAAATGGTCTGGAGTGAAGAAGG - Intronic
1127790113 15:62391535-62391557 CAGTGGGTCTTGACTGCGGAGGG + Intronic
1128393981 15:67204793-67204815 TAGTGGGCCTGGAGTGGAGAAGG - Intronic
1129194355 15:73955323-73955345 TGCTGGGTCAGGAGTGAAGATGG - Intergenic
1130036654 15:80367259-80367281 CCCTTGGTCTGGAGAGCACATGG + Intronic
1130936975 15:88478946-88478968 CACCTGGGCTGGAGTGCAGTAGG - Exonic
1130992020 15:88881308-88881330 CACTGGGACCTGAGAGCAGAGGG - Intronic
1131284399 15:91045121-91045143 CCCTGGGTTTGGAGAGCAGGAGG + Intergenic
1131823685 15:96298233-96298255 CACTGGGACTAGGGTACAGAAGG + Intergenic
1132056064 15:98650461-98650483 CACTGGGTCCCCAGTTCAGAGGG + Intronic
1132866927 16:2097667-2097689 CACTGTGTCTGGGGTGCCGGGGG - Intronic
1133287353 16:4696800-4696822 CACTGGGCCTGGGCTGCACATGG + Exonic
1133711129 16:8402033-8402055 CACGCAGTCTGGAGTGCAGTGGG - Intergenic
1133794161 16:9032928-9032950 CACCCGGGCTGGAGTGCAGTGGG - Intergenic
1133961402 16:10496616-10496638 CACCTGGGCTGGAGTGCAGTGGG - Intergenic
1133966784 16:10537514-10537536 CAGTGGGGCTGGAGTGCAGTGGG - Intronic
1134524838 16:14935436-14935458 CACTGTGTCTGGAGTGCCGGGGG + Intronic
1134548059 16:15125489-15125511 CACTGTGTCTGGAGTACCGGGGG - Intronic
1134608020 16:15586619-15586641 CAGTGGGGCTGGGCTGCAGATGG + Intronic
1134712427 16:16333923-16333945 CACTGTGTCTGGAGTACCGGGGG + Intergenic
1134720293 16:16377235-16377257 CACTGTGTCTGGAGTACCGGGGG + Intergenic
1134947134 16:18334650-18334672 CACTGTGTCTGGAGTACCGGGGG - Intronic
1134954400 16:18374771-18374793 CACTGTGTCTGGAGTACCGGGGG - Intergenic
1135209363 16:20510978-20511000 CACCTGGGCTGGAGTGCAGTGGG - Intergenic
1135242253 16:20818507-20818529 CGCTGAGGCTGGAGTGCAGTGGG + Intronic
1135547710 16:23377060-23377082 CACAGGGCCAGGAGAGCAGAGGG + Intronic
1136476482 16:30516905-30516927 CACAGGGTCTGGGGGGCAGCTGG + Intronic
1136537342 16:30907787-30907809 CAATGAGCCTGGAGTTCAGAGGG - Intergenic
1136547998 16:30966082-30966104 CACAGGGGCAGGAGGGCAGAGGG + Exonic
1136632300 16:31496122-31496144 CACCTGGGCTGGAGTGCAGTGGG + Intronic
1137991624 16:53162821-53162843 CACTCAGACTGGAGTGCAGTGGG + Intronic
1138420885 16:56898307-56898329 CACCCAGTCTGGAGTGCAGTCGG + Intronic
1138456391 16:57123495-57123517 CACTGGGATGGGGGTGCAGAGGG - Intronic
1138529532 16:57627607-57627629 CTCTGGAGCTGGAATGCAGACGG + Intronic
1138542875 16:57699058-57699080 GCCTGGGGCTGGAGAGCAGAGGG + Intronic
1138566822 16:57839497-57839519 CACCGAGGCTGGAGTGCAGTGGG - Intronic
1139342600 16:66278250-66278272 GACTGGGTTTGGAGTATAGAGGG - Intergenic
1139342618 16:66278346-66278368 GCCTGGGTGTGGAGTGGAGAGGG - Intergenic
1139431601 16:66913732-66913754 CCCTGGGCCTGGAGTCCAGGTGG + Intronic
1139601771 16:67991717-67991739 CACTGACTCTGGAGTGGGGAGGG - Intronic
1140901579 16:79372810-79372832 CAGTGGGTCTGGAGCTGAGAGGG - Intergenic
1140914413 16:79481772-79481794 TACTGGGTCTGGGATGCAGAAGG - Intergenic
1141102581 16:81208918-81208940 CAGTAGGTATGGAGTGCAGCTGG + Intergenic
1141852029 16:86652990-86653012 CAGAGGGTCTGGAGGGAAGAAGG - Intergenic
1142181520 16:88673264-88673286 CACTCAGGCTGGAGTGCAGTGGG + Intergenic
1142624747 17:1184700-1184722 CACCCAGTCTGGAGTGCAGTGGG + Intronic
1142723227 17:1791844-1791866 CACTTAGGCTGGAGTGCAGTGGG - Intronic
1143393578 17:6575104-6575126 CACTGGGGCTGCAGGGCAGATGG + Intergenic
1143393897 17:6576746-6576768 CAGTGGGTCTGAAAGGCAGAAGG - Intergenic
1143432727 17:6898894-6898916 GACTGAGACTGGACTGCAGAGGG + Intronic
1144743575 17:17598171-17598193 CAGTGTGGCTGGAGTACAGAGGG - Intergenic
1145237361 17:21217866-21217888 CAATGGCTTTGCAGTGCAGATGG + Intergenic
1145757022 17:27399928-27399950 CACTCAGGCTGGAGTGCAGTGGG + Intergenic
1146045673 17:29504068-29504090 CACCCAGGCTGGAGTGCAGAGGG - Intronic
1146584686 17:34071992-34072014 CACAGGGTGGGAAGTGCAGAAGG + Intronic
1146635613 17:34502103-34502125 GAATGGATCTGGAGGGCAGATGG + Intergenic
1146963294 17:37003514-37003536 CACCAGGGCTGGAGTGCAGTGGG + Intronic
1147262064 17:39214503-39214525 CACTGGGACGGGAATGGAGAGGG + Intronic
1147644875 17:42027568-42027590 GACTGGGTCAGGAGGGGAGAGGG - Intronic
1147961318 17:44169349-44169371 CACCCAGTCTGGAGTGCAGTGGG - Intergenic
1149808300 17:59640435-59640457 CACTCAGGCTGGAGTGCAGTAGG + Intronic
1150552050 17:66219867-66219889 CACTCAGGCTGGAGTGCAGTGGG - Intronic
1150583317 17:66495059-66495081 CACCGAGGCTGGAGTGCAGTGGG - Intronic
1151641691 17:75400035-75400057 CACCCAGTCTGGAGTGCAGTGGG + Intronic
1151906933 17:77054845-77054867 CTCAGGGGCTGGAGAGCAGAGGG + Intergenic
1151953546 17:77369191-77369213 CACCCGGTCTGGAGTGCAGTGGG - Intronic
1152040410 17:77899230-77899252 CACTGGGTCGGGTATGCCGAGGG - Intergenic
1152598490 17:81249663-81249685 CACGGGGACTGGGCTGCAGAAGG + Intronic
1152830339 17:82493455-82493477 CACCGGGCCTGGAGTGGGGAAGG - Intergenic
1153210807 18:2761775-2761797 CACCCAGGCTGGAGTGCAGAGGG - Intronic
1153238025 18:3006957-3006979 CACTGAGGCTGGAGTGCAGTGGG - Intronic
1153556234 18:6316727-6316749 CATTGGGTCAGGAGTGCATCTGG + Intronic
1153576899 18:6531323-6531345 CACCGAGGCTGGAGTGCAGTGGG - Intronic
1153840748 18:9005782-9005804 CATGGGGTCTGCAGTGCAGCAGG - Intergenic
1156073070 18:33237171-33237193 CACTGGGCTTGGAATGAAGATGG - Intronic
1156084270 18:33380063-33380085 ATCTGGGGGTGGAGTGCAGAGGG + Intronic
1156310561 18:35918489-35918511 CTGGGGGTCAGGAGTGCAGAGGG + Intergenic
1157153741 18:45244583-45244605 CACTCAGGCTGGAGTGCAGTAGG - Intronic
1157497822 18:48169059-48169081 CACAGGGTCTGCTGTCCAGATGG + Intronic
1157661369 18:49447926-49447948 CCCTTGGTCTGGAGAGCACATGG + Intronic
1157726261 18:49966366-49966388 TGCTTGGTCTGGAGTGCACAGGG - Intronic
1158155075 18:54416696-54416718 CCCAGTGTCTGGAATGCAGAAGG - Intergenic
1158326606 18:56319826-56319848 CTCTGGTTCTGGAGTTCAGAAGG - Intergenic
1158467623 18:57705032-57705054 CACTCAGGCTGGAGTGCAGTGGG - Intronic
1159775891 18:72602313-72602335 CTCTGGGTCTGGTGAGGAGAAGG + Intronic
1160153969 18:76418898-76418920 CAGAGGGTCTGCAGGGCAGATGG + Intronic
1160178852 18:76617485-76617507 CACTGTGTCCTGAGGGCAGAGGG + Intergenic
1160298896 18:77660986-77661008 CACTAAGCCTGGAGTGCAGTGGG - Intergenic
1160440286 18:78884334-78884356 GCCTGGGTGTGGAGTGGAGAGGG - Intergenic
1160694960 19:479155-479177 AACTGCGTCTGCCGTGCAGAAGG + Intergenic
1160807266 19:997615-997637 CACCTGGGCTGGAGTGCAGGGGG - Intronic
1161503267 19:4629477-4629499 CACTCAGGCTGGAGTGCAGTGGG + Intergenic
1161820339 19:6526893-6526915 CACCGAGGCTGGAGTGCAGTGGG - Intergenic
1161822969 19:6542346-6542368 CACTCAGGCTGGAGTGCAGTGGG + Intergenic
1161918807 19:7250851-7250873 CTCTGAGTCTGGAGCTCAGAGGG + Intronic
1162135583 19:8553263-8553285 GACTGAGGCAGGAGTGCAGATGG + Intronic
1162200886 19:9019114-9019136 CACCCAGTCTGGAGTGCAGTGGG - Intergenic
1162725164 19:12685896-12685918 CACCAGGGCTGGAGTGCAGTGGG + Intergenic
1163194300 19:15703892-15703914 CACTGGGTCAGGAGTGTATCTGG + Intergenic
1163239772 19:16053642-16053664 CACCCAGTCTGGAGTGCAGTGGG + Intergenic
1163994929 19:21035702-21035724 CTCTGGGTTTGTAGTGGAGAGGG + Intronic
1164001230 19:21101311-21101333 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164007994 19:21169514-21169536 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164027237 19:21363846-21363868 CACCCAGTCTGGAGTGCAGTGGG - Intronic
1164253284 19:23503658-23503680 CTCTGGGTTTGTAGTGAAGAGGG - Intergenic
1164269638 19:23660196-23660218 CTCTGGGTTTGTAGTGGAGAGGG - Intronic
1164279102 19:23752696-23752718 CTCTGGGTTTGTAGTGGAGAGGG - Intronic
1164297140 19:23922048-23922070 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164317628 19:24107842-24107864 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164593388 19:29518315-29518337 CCATGGGTCTGGAGAGCACAAGG + Intergenic
1164710232 19:30351878-30351900 TGCTGGGTCTGGATTGCAAAGGG + Intronic
1165171810 19:33897731-33897753 CACTCAGGCTGGAGTGCAGTGGG - Intergenic
1165312036 19:35034280-35034302 CCCCGGGGCAGGAGTGCAGAGGG - Intronic
1165333442 19:35154109-35154131 CCCTGGGTCTGGGGTGCAGACGG - Exonic
1165756488 19:38296208-38296230 TGCTGGGTCTGGAGGCCAGAGGG - Intronic
1165984467 19:39755925-39755947 CACTGTGTCTGGAGTAGAGGGGG - Intergenic
1166089511 19:40499066-40499088 CACTCAGACTGGAGTGCAGTGGG + Intronic
1166351129 19:42198907-42198929 CACTGGAGCTGGGGTGCACATGG - Exonic
1166521484 19:43483314-43483336 CACTGAAGCTGGAGTGCAGTGGG + Intronic
1167118960 19:47505415-47505437 CACTGAATCCGCAGTGCAGAGGG - Intronic
1167710763 19:51109079-51109101 CCCTGTGTCTAGGGTGCAGACGG - Intergenic
1167811740 19:51839351-51839373 CACCCAGGCTGGAGTGCAGAGGG - Intergenic
1167936226 19:52910919-52910941 CACCCGGGCTGGAGTGCAGTGGG + Intergenic
1168021371 19:53611306-53611328 CACTCAGGCTGGAGTGCAGCAGG + Intergenic
1168113819 19:54209683-54209705 CACAGAGCCTGGAGGGCAGATGG + Intronic
925583016 2:5433262-5433284 CACTCAGGCTGGAGTGCAGTGGG + Intergenic
926213864 2:10891489-10891511 CACTTGGTGTGGTGTGCAGATGG + Intergenic
926332625 2:11837978-11838000 GACTGGCTCTGAAGTGCAGCAGG + Intergenic
926369595 2:12166544-12166566 CACCCAGGCTGGAGTGCAGACGG - Intergenic
926551792 2:14310097-14310119 CACTGTGCCTGGCCTGCAGAGGG - Intergenic
926776423 2:16427986-16428008 CACAGGGCCAGGGGTGCAGAAGG + Intergenic
927966533 2:27273438-27273460 CACTGGGTAGAGAGAGCAGAAGG - Intronic
927966573 2:27273804-27273826 CACTGGGTAGAGAGAGCAGAAGG - Intronic
928626420 2:33144153-33144175 CACTGTCTCTGGGGTGCACAGGG - Intronic
929099769 2:38300689-38300711 CACTGAGGCTGGAGTGCAGTGGG + Intronic
929774219 2:44918145-44918167 CAGTGGGTCTGGAGGTGAGATGG + Intergenic
931228416 2:60353263-60353285 CACCGGCTCTGGTGTGGAGAGGG + Intergenic
931463802 2:62469937-62469959 CCCTGGGACTGGAGTGGGGATGG - Intergenic
931557298 2:63519245-63519267 CAGTGGCTCTGCAGGGCAGAGGG - Intronic
931894830 2:66717117-66717139 CACTGCTTCTGGAGCACAGAAGG - Intergenic
932081865 2:68722928-68722950 CGCTAGGTCTGGAGTTCAGCTGG + Intronic
932182290 2:69658357-69658379 CACCGAGGCTGGAGTGCAGTGGG - Intronic
932320536 2:70819321-70819343 CAGTGGGGGTGGGGTGCAGAGGG - Intronic
932739754 2:74282612-74282634 CACTGGGTCTGGAGTGCAGAGGG + Intronic
933040005 2:77452593-77452615 CACAGGGTCCTGACTGCAGAAGG + Intronic
933301393 2:80545114-80545136 CACAAGGGCTGGAGTGGAGAAGG - Intronic
933697116 2:85227949-85227971 CACTCAGGCTGGAGTGCAGTAGG - Intronic
933842022 2:86295363-86295385 CACAGGGTCTGTATTGCACATGG - Intronic
934638677 2:96012883-96012905 CACTGTGCCTGGTGTACAGAAGG - Intergenic
934716864 2:96549589-96549611 CACTGGGCCAGGGGTGCACAGGG + Intronic
936193719 2:110349100-110349122 CACTGGGTCGGGTGTGTGGATGG + Intergenic
936611082 2:114002630-114002652 CAATAGGTCTGGAGTGTAGTTGG + Intergenic
936732902 2:115405492-115405514 CTGTGGGTCTGGAGTCCAGAGGG + Intronic
937247808 2:120504708-120504730 CAGTCGGTCTGGCGAGCAGACGG + Intergenic
937296758 2:120814131-120814153 CAACAGGTCTGGAGTGCAAAAGG - Intronic
938057128 2:128224395-128224417 CACTGAGGCTGGAGTGCAATGGG + Intergenic
938399035 2:130973446-130973468 CACTCAGGCTGGAGTGCAGTGGG - Intronic
938732815 2:134159735-134159757 CTCTGGGGCGGGAGTGGAGAGGG - Intronic
939389201 2:141544704-141544726 CACTGAGGCTGGAGTGCAGTGGG + Intronic
940910038 2:159202426-159202448 TACTGGTTTTGGAGAGCAGAGGG + Intronic
940990206 2:160088573-160088595 CCCTTGGTCTGGAGAGCACATGG - Intergenic
942275173 2:174316370-174316392 CACTCAGGCTGGAGTGCAGTGGG + Intergenic
942494846 2:176529209-176529231 CACTGGGTCTAGATTCCAGGAGG - Intergenic
943176776 2:184486011-184486033 CACTGGCATTGGAGTGAAGAAGG + Intergenic
943984641 2:194603906-194603928 CCCTTGGTCTGGAGAGCATATGG + Intergenic
944239815 2:197475496-197475518 CACTGGGTATAGAGTGATGAAGG + Intergenic
944702500 2:202258626-202258648 CACTCAGCCTGGAGTGCAGTGGG + Intergenic
944731496 2:202522116-202522138 CACTCAGGCTGGAGTGCAGTGGG - Intronic
945306279 2:208261921-208261943 CACCCGGGCTGGAGTGCAGTGGG - Intronic
945494934 2:210498785-210498807 GCCTGGGTGTGGAGTGTAGAGGG + Intronic
945689809 2:213019700-213019722 CACTGGGTAGGTAGAGCAGAGGG - Intronic
945954024 2:216068183-216068205 CACTCAGGCTGGAGTGCAGTGGG - Intronic
946013605 2:216586469-216586491 CACCCAGGCTGGAGTGCAGAGGG - Intergenic
946305367 2:218854000-218854022 AAATGGGTCTGGAGCTCAGAGGG - Intergenic
946570026 2:221014270-221014292 CAGTGAGTCAGGAGTGCTGATGG - Intergenic
946770709 2:223085769-223085791 CACTCAGACTGGAGTGCAGTGGG + Intronic
946838302 2:223794966-223794988 CACTGCGCCTGGCCTGCAGATGG - Intronic
947763444 2:232620789-232620811 CACTGGGTCTGGAGATGAGCGGG - Intronic
947866341 2:233400411-233400433 CACTGGGTGTGAAGGGCAAAGGG - Intronic
947995951 2:234528023-234528045 CACTCAGGCTGGAGTGCAGTGGG + Intergenic
948222996 2:236288200-236288222 CACTGGTTCAGGAGGGAAGAAGG + Intergenic
948447087 2:238041089-238041111 CACTGTGTCTTGCGTGCAGTAGG + Intronic
948454131 2:238096924-238096946 CACTGGGTGTGGTGGGCAGGCGG + Intronic
948512265 2:238476488-238476510 CAGTGAGGCTGGAGTGCAGAGGG + Intergenic
948627224 2:239276590-239276612 GCCTGTGTCTGGAGAGCAGATGG - Intronic
949046322 2:241874131-241874153 CACTGAGGCTGGAGGGAAGAGGG - Intergenic
1170316289 20:15044470-15044492 GAGTGGGTCTGGAGGGCAAATGG - Intronic
1171257494 20:23701197-23701219 ACCTGGGTGTGGAGTACAGAGGG - Intergenic
1171264908 20:23763356-23763378 ACCTGGGTATGGAGTACAGAGGG - Intergenic
1171274554 20:23845047-23845069 ACCTGGGTATGGAGTACAGAAGG - Intergenic
1172183388 20:33016979-33017001 CCCTGGGGCTGGAGGGCACAAGG - Intronic
1172490804 20:35336182-35336204 CACAGGCTCTAGAGTCCAGAAGG + Intronic
1172587463 20:36094584-36094606 CACAGGATTTGGAGTGCAAAGGG + Intronic
1172654109 20:36526395-36526417 CACTGGTTCTGGTTTGCAGAAGG - Intronic
1172739496 20:37154550-37154572 CACTCAGGCTGGAGTGCAGTGGG - Intronic
1172740630 20:37163824-37163846 CACTGGGTAAGGACTTCAGATGG - Intronic
1172767555 20:37358842-37358864 CAGTGGGGCTGGGGTGGAGACGG - Intronic
1173769903 20:45647480-45647502 CACTGGGCCTTGGGTGCACATGG + Intergenic
1175180808 20:57145779-57145801 CACTGGGGTAGGAGTGAAGAGGG - Intergenic
1176636129 21:9246422-9246444 CACACAGTCTGGAGTGCAGTGGG - Intergenic
1177164137 21:17580789-17580811 CACCCAGGCTGGAGTGCAGAGGG + Intronic
1177773145 21:25539450-25539472 CACTGCTTGTGGAGGGCAGAGGG - Intergenic
1178472774 21:32908743-32908765 CCCTGGGCCTGAAGTGCAGAGGG + Intergenic
1178803824 21:35821868-35821890 CACTCAGGCTGGAGTGCAGTGGG - Intronic
1178838641 21:36120473-36120495 CACAGGGTCTGAAGAACAGAAGG - Intergenic
1179233044 21:39522760-39522782 CACTGGGACAGGAGTGAAGCTGG - Intergenic
1180239651 21:46492897-46492919 CACTCAGGCTGGAGTGCAGTGGG - Intronic
1180868465 22:19133118-19133140 CACTGGGTGGGGAGGGCACACGG - Exonic
1181097125 22:20513110-20513132 CACTTGGGCTGGAGTGCAGTTGG + Intronic
1181446134 22:22976320-22976342 CCCTTGGTCTGGAGAGCACATGG + Intergenic
1181446141 22:22976363-22976385 CCCTTGGTCTGGAGAGCACATGG + Intergenic
1181467402 22:23117595-23117617 CAGTGGGTGTGGCGTGGAGAGGG + Intronic
1181533687 22:23531112-23531134 CACTGGGTCCTGAGGGCAGGTGG + Intergenic
1182073756 22:27480783-27480805 CGCTGGGTCTGCAGAGCAGCTGG + Intergenic
1182101614 22:27661723-27661745 CACTCAGACTGGAGTGCAGTGGG - Intergenic
1182219814 22:28749245-28749267 CATTGTGGCTGGAGTGGAGAAGG - Intronic
1182386331 22:29945051-29945073 CACCCAGGCTGGAGTGCAGAGGG + Intronic
1182438323 22:30345742-30345764 CCATGGTTCAGGAGTGCAGAAGG + Intronic
1182454499 22:30441243-30441265 CAGTGAGTCAGGAGTGCTGATGG + Intergenic
1183371462 22:37434914-37434936 CTCAGGGTCTGGCATGCAGATGG + Intergenic
1185255895 22:49831064-49831086 CACTCAGGCTGGAGTGCAGTGGG - Intergenic
1185338781 22:50282559-50282581 AAGTGGATCTGGAGTGCAGTGGG + Intronic
949877390 3:8635176-8635198 CAGTAGGTCTGGGGTGCAGACGG + Intronic
949878385 3:8641935-8641957 CACTGGGTCAGGGGTGGTGATGG + Intronic
950214071 3:11145448-11145470 CACTGTGTGTGGGGTGCAGTAGG - Intronic
950406512 3:12808411-12808433 CACAGGGCCTGGTGTGCAGTAGG - Intronic
950713532 3:14831182-14831204 CAGTGTGGGTGGAGTGCAGAAGG + Intronic
950899396 3:16483515-16483537 TAATGGGTCTGGTGTGCAGCTGG + Intronic
951031077 3:17882301-17882323 CACTGAGGCTGGAGTGCAGTGGG + Intronic
953050950 3:39342726-39342748 CACCCGGGCTGGAGTGCAGTGGG - Intergenic
954419553 3:50411453-50411475 CACTGTGTCTGGAATGGAGCTGG - Intronic
954432124 3:50476359-50476381 CACTGGGTCTGGACTTCAAAGGG - Intronic
954527010 3:51280671-51280693 CTCTGGGTCTGGAGCACTGAGGG + Intronic
954588833 3:51762614-51762636 CACTGGGTCTGGGATGCCCAGGG + Intergenic
954710002 3:52500955-52500977 CAGTGGGAATGCAGTGCAGATGG - Intronic
954972530 3:54663348-54663370 CACTGCCCCTGGAGTCCAGAAGG - Intronic
956760465 3:72438909-72438931 CGCTGTGTATGGAGGGCAGACGG + Intronic
956775564 3:72562632-72562654 CACAGGATTTGGAGTCCAGACGG + Intergenic
957151888 3:76497066-76497088 CATTGTGGCTGGAGTGCAGTGGG - Intronic
958673978 3:97242283-97242305 CACTGTGGCTAGACTGCAGAGGG - Intronic
958949276 3:100399884-100399906 CAAGGGGTCCGGAGTGCAAAAGG + Intronic
959836642 3:110925578-110925600 CATTGGGTCTTGAATGGAGAAGG - Intergenic
960628285 3:119702820-119702842 CGCTGGCTCTGGAGTATAGAGGG + Intergenic
961402911 3:126659627-126659649 CACTCAGGCTGGAGTGCAGTGGG - Intergenic
961871027 3:129988410-129988432 GAATGGGTCTGGAGGGCAAATGG - Intergenic
961871278 3:129990085-129990107 AAATGGGTCTGGAGGGCAAATGG + Intergenic
962565594 3:136655721-136655743 CACCCAGGCTGGAGTGCAGATGG - Intronic
962678032 3:137770586-137770608 CACTGGGTCTGGGTTGAGGAAGG + Intergenic
963180358 3:142348991-142349013 CACTGAGGCTGCAGTGCAGTGGG + Intronic
964311462 3:155398095-155398117 CACTCAGGCTGGAGTGCAGTGGG - Intronic
965175786 3:165330464-165330486 CACTTAGGCTGGAGTGCAGTGGG + Intergenic
965619570 3:170629405-170629427 CACTGGGACTGTGGTGCAGGGGG + Intronic
966519377 3:180855948-180855970 CACTGAGGCTGGAGTGCAGTGGG - Intronic
966891429 3:184410147-184410169 CACTGTGGCTGGAGTGCAGTGGG - Intronic
968609178 4:1549366-1549388 CACTGGGTCTGCAGTAGGGAAGG - Intergenic
968798050 4:2722276-2722298 CACTGTGTCTCGGGTGCAGGTGG + Intronic
969118900 4:4892465-4892487 TACTGAGACTGGAGTGCAGTGGG + Intergenic
969240587 4:5894456-5894478 GACTGGGTGGGGACTGCAGAGGG + Intergenic
970689811 4:18609944-18609966 CAGTGGGCCTGGAGAGCAAATGG + Intergenic
972150012 4:36077677-36077699 CATTGAGTCTGCAGTGTAGAGGG - Intronic
972337711 4:38122396-38122418 CACTGGTTGTGCAGGGCAGAAGG - Intronic
972445582 4:39140186-39140208 CACTGAGGCTGGAGTGCAGTGGG - Intergenic
972449743 4:39184367-39184389 CCCAGGCTCTGGAGTGCAGTGGG - Intronic
973146681 4:46834259-46834281 CATTGATTCTGGAGTTCAGATGG + Intronic
973980325 4:56303303-56303325 CACCGAGTCTGGAGTGCCAATGG - Intronic
975142395 4:70931769-70931791 CTCTGAGGCTGGAGTGCAGTGGG + Intronic
975276328 4:72505909-72505931 GCCTGGGTGTGGAGTGGAGATGG + Intronic
975668033 4:76753438-76753460 GAGTGGATCTGGAGTGCAGATGG - Intronic
975704670 4:77099843-77099865 CACTCAGGCTGGAGTGCAGTGGG - Intergenic
975863299 4:78700756-78700778 CACTCAGGCTGGAGTGCAGTGGG - Intergenic
976243263 4:82981984-82982006 CACCCAGTCTGGAGTGCAGTGGG - Intronic
976928219 4:90529253-90529275 CACTGGGGCTGGAGTGCAGTGGG + Intronic
977155410 4:93566727-93566749 CACTCAGGCTGGAGGGCAGAGGG - Intronic
978019087 4:103786202-103786224 CCCTTGGTCTGGAGAGCATATGG + Intergenic
978027626 4:103896916-103896938 CACTGGGTCAGGAGTGTGAATGG + Intergenic
978328388 4:107585175-107585197 CACTGGGTCTGTTGGGCAGGGGG + Intergenic
979536158 4:121823284-121823306 GCCAGGGTCTGGAGTGCAGTTGG - Intronic
979722206 4:123914195-123914217 AACTGGGGTTGGAGTGAAGAAGG + Intergenic
979979934 4:127242549-127242571 CACTCAGGCTGGAGTGCAGTGGG + Intergenic
980099333 4:128525388-128525410 CACCCAGGCTGGAGTGCAGAGGG - Intergenic
980642272 4:135596229-135596251 CTCTTGGTCTGGAGAGCACATGG + Intergenic
980971731 4:139573475-139573497 CACTGGGTCTTGATTTCAAATGG + Intronic
981144124 4:141305089-141305111 CACTGTGGCTGGAGTAGAGAAGG + Intergenic
981197945 4:141942653-141942675 CACTTGCTCTGGAGTGGAGTAGG + Intergenic
982068785 4:151676803-151676825 CCCTGGCTCTGGGGTGCTGAAGG + Intronic
982263458 4:153516864-153516886 CACTTAGGCTGGAGTGCAGTGGG + Intronic
982843733 4:160223945-160223967 GCCTGGGTGTGGAGTGGAGAGGG + Intergenic
983071712 4:163275624-163275646 CACTCAGGCTGGAGTGCAGTGGG + Intergenic
983362097 4:166739279-166739301 CACTCAGGCTGGAGTGCAGTGGG + Intronic
984747639 4:183238550-183238572 CACTGTGGCTGGATTACAGAGGG - Intronic
985282145 4:188298341-188298363 CACCGAGCCTGGAGTGCAGTGGG + Intergenic
1202751025 4_GL000008v2_random:4892-4914 CACACAGTCTGGAGTGCAGTGGG - Intergenic
987111800 5:14694360-14694382 CAAGGGGTGTGGACTGCAGATGG + Exonic
987853716 5:23390557-23390579 CACCCAGGCTGGAGTGCAGAAGG - Intergenic
987951987 5:24687501-24687523 CACGGGGTCTAAAGTCCAGAGGG + Intergenic
988918489 5:35919858-35919880 CAGTGGGTATGGGGTGAAGATGG + Intronic
989412775 5:41139793-41139815 CACTGGCACTGGAGGGAAGAAGG - Intergenic
992786811 5:80177796-80177818 CACAGTGTCTGGTGGGCAGATGG + Intronic
992853223 5:80832576-80832598 CACCGAGGCTGGAGTGCAGTGGG - Intronic
996381101 5:122863374-122863396 CAGTGGGTTTGGAATGCAGTAGG + Intronic
996477434 5:123937400-123937422 CCCTTGGTCTGGAGAGCACATGG - Intergenic
997988613 5:138525196-138525218 CACCCGGGCTGGAGTGCAGTGGG + Intronic
1001804266 5:174570053-174570075 GACTGGGTCTGGCCTGCTGAGGG + Intergenic
1002131063 5:177082027-177082049 CACTGGGGCTCTTGTGCAGAAGG - Intergenic
1002258632 5:177978587-177978609 CTGTGGGACTGGAGAGCAGACGG + Intergenic
1002426076 5:179176683-179176705 CACTGGCTCCTGTGTGCAGAAGG - Intronic
1002501229 5:179648959-179648981 CTGTGGGACTGGAGAGCAGACGG - Intergenic
1002515427 5:179754547-179754569 CACTCAGGCTGGAGTGCAGTGGG - Intronic
1002978315 6:2109180-2109202 CACTGGGACTGAAGTGAAGGAGG + Intronic
1003618231 6:7674203-7674225 CACGAGGTCTGGAGGGTAGAAGG + Intergenic
1003944051 6:11057533-11057555 CACCCGGGCTGGAGTGCAGTGGG + Intergenic
1004630558 6:17417314-17417336 CACTCAGGCTGGAGTGCAGTGGG + Intronic
1005336873 6:24805988-24806010 CACCCAGTCTGGAGTGCAGTGGG + Exonic
1005389687 6:25320709-25320731 CAGTTGCTCTGGAGTGCAGGTGG + Intronic
1006061384 6:31422782-31422804 CCCTTGGTCTGGAGTGCACATGG - Intergenic
1006116219 6:31777409-31777431 CCCTGGTTCTGGAGGGCAGAGGG - Intergenic
1006244098 6:32715100-32715122 CACTGTGTATTGAGTGCTGATGG + Intergenic
1007556204 6:42768661-42768683 CACTGGGCATGGAGGGGAGAAGG - Intronic
1010307077 6:74337632-74337654 CACTCAGGCTGGAGTGCAGTGGG + Intergenic
1010574330 6:77512801-77512823 CCCTTGGTCTGGAGAGCACATGG - Intergenic
1011035502 6:82969565-82969587 CACTCGGTCTGGAGTGCAGTGGG - Intronic
1011605604 6:89102182-89102204 CACTCAGGCTGGAGTGCAGTGGG + Intronic
1012669874 6:102030854-102030876 CATTAAGTCTGGAGTTCAGAGGG - Intronic
1013306458 6:108851228-108851250 CACTGGAGCTGGAGTAGAGAAGG - Intronic
1013798034 6:113907589-113907611 CACTGGGTCTGGGCTGCACTTGG + Intergenic
1014198042 6:118580929-118580951 CCCTTGGTCTGGAGAGCACACGG + Intronic
1015092620 6:129376590-129376612 CAGTATGGCTGGAGTGCAGATGG - Intronic
1015234632 6:130956446-130956468 CTCTGTGTCTGAAGTGAAGAAGG - Exonic
1015340756 6:132097796-132097818 CACTCAGGCTGGAGTGCAGTGGG + Intergenic
1015473636 6:133634920-133634942 AACTGGCTGTGGAGTGCTGATGG + Intergenic
1015572490 6:134636053-134636075 CACAGGGGCTGGAGTGGGGAAGG - Intergenic
1015952024 6:138562815-138562837 CTCTGGTTATGGCGTGCAGAAGG - Intronic
1016029156 6:139319722-139319744 CACCCAGGCTGGAGTGCAGATGG - Intergenic
1018169340 6:161132093-161132115 CTCCGGTTTTGGAGTGCAGAGGG + Exonic
1018555780 6:165049471-165049493 CCCTTGGTCTGGAGAGCACATGG + Intergenic
1018776400 6:167020866-167020888 CACTCAGGCTGGAGTGCAGTGGG - Intronic
1019176446 6:170161681-170161703 CACCTGGGCTGGAGTGCAGTGGG + Intergenic
1019422800 7:958847-958869 GATGGGGTCTGGAGTGGAGAAGG + Intronic
1019841574 7:3451295-3451317 CACTGAGTCTGGAGAGAGGAAGG + Intronic
1019928708 7:4209500-4209522 CCCTGGGTCTGGAGCGGGGAGGG - Intronic
1020512884 7:9081911-9081933 CACTTAGGCTGGAGTGCAGTGGG + Intergenic
1022209457 7:28194638-28194660 CACCCCGTCTGGAGTGGAGAGGG + Intergenic
1022213412 7:28234112-28234134 CACTCAGGCTGGAGTGCAGTGGG + Intergenic
1022259446 7:28690294-28690316 CTCTGTGTCTGGTGGGCAGAGGG - Intronic
1022407345 7:30103026-30103048 CACTCAGGCTGAAGTGCAGAGGG - Intronic
1023433196 7:40115562-40115584 CACTGGGTTTGGAGTCTAGCTGG + Intergenic
1023585330 7:41724219-41724241 CACCCAGGCTGGAGTGCAGAGGG + Intergenic
1023976127 7:45031418-45031440 CACTTAGGCTGGAGTGCAGCGGG + Intronic
1024113913 7:46174077-46174099 CCCTGGCTCTGGAGTGAGGATGG + Intergenic
1024261327 7:47576265-47576287 CACTGGGCCTGGAGCCCAAAAGG + Intronic
1024524054 7:50333121-50333143 CATTTGTTCTGGAGTCCAGAGGG - Intronic
1024584258 7:50827445-50827467 CACTGGGGGTGGTGTGCTGATGG - Intergenic
1025076578 7:55949103-55949125 CACTGAGGCTGGAGTGCAGTGGG - Intergenic
1025198306 7:56948216-56948238 CACGGGGCCTGAAGTGCACAGGG + Intergenic
1025673643 7:63628717-63628739 CACGGGGCCTGAAGTGCACAGGG - Intergenic
1025774010 7:64542182-64542204 CTCTGGGTTTGTAGTGGAGAGGG - Intronic
1025791649 7:64693508-64693530 CTCTGGGTTTGTAGTGGAGAGGG + Intronic
1025816693 7:64920105-64920127 CTCTGGGTTTGTAGTGGAGAGGG + Intronic
1025866854 7:65390463-65390485 CTCTGGGTTTGTAGTGGAGAGGG + Intronic
1026301109 7:69098777-69098799 CAATGGGTGGGGAGTTCAGAAGG + Intergenic
1026331598 7:69356788-69356810 CACTCAGGCTGGAGTGCAGTGGG - Intergenic
1026902122 7:74043182-74043204 CCCTGGGGCTGGAGGACAGAGGG + Intronic
1027023958 7:74837234-74837256 CACTCAGGCTGGAGTGCAGTGGG + Intronic
1027063972 7:75108087-75108109 CACTCAGGCTGGAGTGCAGTGGG - Intronic
1027122944 7:75535286-75535308 CACTCAGGCTGGAGTGCAGTGGG + Exonic
1027385919 7:77659688-77659710 CACTCAGACTGGAGTGCAGTGGG + Intergenic
1027934805 7:84589029-84589051 GCCTGGGTGTGGAGTGTAGAGGG - Intergenic
1027934848 7:84589275-84589297 GCCTGGGTGTGGAGTGAAGAGGG - Intergenic
1028333259 7:89622630-89622652 GACTGGGTGTGGAGTGGAAAGGG - Intergenic
1028351651 7:89857197-89857219 CCCTTGGTCTGGAGAGCACATGG + Intergenic
1028351657 7:89857240-89857262 CCCTTGGTCTGGAGAGCACATGG + Intergenic
1028351671 7:89857326-89857348 CCCTTGGTCTGGAGAGCACATGG + Intergenic
1028431215 7:90749292-90749314 GACTGGGCATGGAGTGAAGAAGG - Intronic
1028855734 7:95590976-95590998 CACTTGGGCTGGAGTGCAGTGGG + Intronic
1029407474 7:100384325-100384347 CTCTGAGTCTAGAGTGCAGGGGG + Intronic
1029495096 7:100892317-100892339 CACAGGGTCAGCAGTGCAGAGGG - Exonic
1030316780 7:108123975-108123997 CAGTGGGTCTGGAGAAAAGAAGG + Intronic
1031479984 7:122266875-122266897 CACCCAGTCTGGAGTGCAGTGGG + Intergenic
1031492662 7:122408463-122408485 CACTTGGGCTGGAGTGCAGTGGG + Intronic
1032828153 7:135592844-135592866 CACCCAGGCTGGAGTGCAGAGGG - Intronic
1033198776 7:139350560-139350582 CACTGGGTTTGGTGTCCTGAAGG - Intronic
1033562698 7:142547601-142547623 CACCCAGTCTGGAGTGCAGGGGG - Intergenic
1035458562 7:159025037-159025059 CAATGGGTGTGGTCTGCAGAGGG - Intergenic
1036293721 8:7518136-7518158 CACTGGGTGGGGAGGGGAGAGGG - Intergenic
1036328840 8:7802859-7802881 CACTGGGTGGGGAGGGGAGAGGG + Intergenic
1036795218 8:11750904-11750926 CACTCAGGCTGGAGTGCAGTGGG - Intronic
1037747551 8:21659043-21659065 CAGTGGAGCTGGAGTGGAGAGGG - Intergenic
1038960060 8:32508774-32508796 CACTCAGGCTGGAGTGCAGTGGG + Intronic
1039022178 8:33219976-33219998 CACCCAGGCTGGAGTGCAGAGGG + Intergenic
1039102933 8:33959741-33959763 AACAGGGTTAGGAGTGCAGAGGG - Intergenic
1039183413 8:34891293-34891315 CCCTTGGTCTGGAGAGCACATGG + Intergenic
1039474662 8:37833368-37833390 CAGTGGGTCTGAATAGCAGAGGG - Intronic
1039845316 8:41321612-41321634 CGGTGGGGCTGGAGAGCAGAGGG + Intergenic
1039975810 8:42363965-42363987 CACCCGGGCTGGAGTGCAGGAGG + Intronic
1040489512 8:47906590-47906612 CACTGTGTCTGGAGTGCAGTGGG - Intronic
1042128109 8:65559304-65559326 CACAGCCTCTGCAGTGCAGAGGG + Intergenic
1042542024 8:69916852-69916874 CACTGAGGCTGGAGTGCAGTGGG - Intergenic
1044991008 8:97795794-97795816 CGCTGAGGCTGGAGTGCAGTGGG - Intronic
1045343643 8:101275165-101275187 CAAAGGGTGTGGAGAGCAGATGG - Intergenic
1046509593 8:115185183-115185205 CACTGGGACAGAAGAGCAGATGG + Intergenic
1046845269 8:118908434-118908456 CACTGATTCTGGAGGCCAGAAGG - Intergenic
1047343919 8:124009216-124009238 CACCCAGGCTGGAGTGCAGAAGG - Intronic
1048052161 8:130828407-130828429 CCCTTGGTCTGGAGAGCACATGG + Intronic
1048266044 8:132987975-132987997 CAGTGGGGATGGTGTGCAGATGG - Intronic
1048928847 8:139294687-139294709 CGCTCGGGCTGGAGTGCAGTGGG - Intergenic
1048975695 8:139671936-139671958 CATGGGGTCTGCAGTGCAGTGGG + Intronic
1049254125 8:141604908-141604930 CAGAGGGTCTGGAGTGAGGAGGG + Intergenic
1049363757 8:142226627-142226649 CACTGGCTCTGGAGTCCTGGGGG + Intronic
1049594213 8:143475996-143476018 CCCTGGGGCTGCAGGGCAGAGGG + Intronic
1049702447 8:144021316-144021338 AACTGGGTCATGAGGGCAGAGGG - Intronic
1050295920 9:4205133-4205155 CCCAGGGACTGGAGTGCAGTGGG - Intronic
1050436194 9:5613311-5613333 CACTTAGGCTGGAGTGCAGTGGG + Intergenic
1052215804 9:25964463-25964485 CTCTTGGTCTGGAGAGCACATGG - Intergenic
1052296391 9:26900277-26900299 CACTGGCTTTGGAGTTCAAAAGG - Intergenic
1052984769 9:34478862-34478884 CTCTGGGTCTGGTCTACAGAAGG - Intronic
1053083122 9:35194064-35194086 CCCTTGGTCTGGAGAGCAAACGG - Intronic
1053173484 9:35906829-35906851 CACTGGGTCTGCAGTGCTGAAGG + Exonic
1054729295 9:68684640-68684662 GAGTGAGTCTGGAGTTCAGAGGG + Intergenic
1055121673 9:72667037-72667059 CACCCGGGCTGGAGTGCAGTGGG - Intronic
1055699111 9:78922780-78922802 CACCCAGTCTGGAGTGCAGTGGG + Intergenic
1055722113 9:79186749-79186771 CACTCAGCCTGGAGTGCAGTGGG + Intergenic
1057206678 9:93177766-93177788 ATGGGGGTCTGGAGTGCAGAGGG - Intergenic
1057363694 9:94398852-94398874 CACTGAGGCTGGAGTGCAGTGGG + Intronic
1057472989 9:95374570-95374592 CACTCAGGCTGGAGTGCAGTGGG + Intergenic
1057488143 9:95502173-95502195 CACAGGGGCTGGAGGGGAGAGGG - Intronic
1057659641 9:96989235-96989257 CACTGAGGCTGGAGTGCAGTGGG - Intronic
1057782408 9:98060628-98060650 CACCCAGGCTGGAGTGCAGAAGG - Intronic
1058310926 9:103501496-103501518 CACCTAGTCTGGAGTGCAGTGGG - Intergenic
1059012021 9:110471383-110471405 CACTGAGCCTGGTCTGCAGAAGG + Exonic
1059059023 9:111015394-111015416 CAGTGGGTTTGGAGGGAAGAAGG - Intronic
1059159232 9:112018449-112018471 CACTCAGGCTGGAGTGCAGTGGG + Intergenic
1060036849 9:120263148-120263170 CACTGGGGCTGGTGTTCAGATGG - Intergenic
1060804627 9:126566895-126566917 CACTCAGGCTGGAGTGCAGTGGG + Intergenic
1060830668 9:126713427-126713449 CACCCAGGCTGGAGTGCAGAGGG + Intergenic
1060877737 9:127095355-127095377 CACTCAGGCTGGAGTGCAGTGGG - Intronic
1060973344 9:127751490-127751512 CACAGGGCCTGGAATGCAGCTGG - Intronic
1061152044 9:128834315-128834337 CCCTGGGTATAGAGGGCAGAGGG + Intronic
1061246779 9:129404727-129404749 CACTGGGTCCTGAGGGCAGGTGG - Intergenic
1187297346 X:18014797-18014819 CACTGAAGCTGGAGTCCAGAAGG + Intergenic
1187969024 X:24640972-24640994 CACTCAGGCTGGAGTGCAGAGGG + Intronic
1189066555 X:37815942-37815964 CACTGGGTAAGGAATGCAGCAGG - Intronic
1189665571 X:43351153-43351175 CCCTGGGTCACGAGGGCAGAGGG + Intergenic
1189922841 X:45920326-45920348 CACTCAGGCTGGAGTGCAGCTGG + Intergenic
1190476643 X:50834603-50834625 CATGGGGTGTGGAGTACAGAGGG - Intergenic
1190640736 X:52481427-52481449 CATTGGGTAGGGACTGCAGAGGG + Intergenic
1190646936 X:52531438-52531460 CATTGGGTAGGGACTGCAGAGGG - Intergenic
1192219021 X:69184443-69184465 CACTGGGAGTGGAGTGGAGAAGG - Intergenic
1192315803 X:70050374-70050396 CAATGGGATTGGAGGGCAGAGGG + Intergenic
1192473858 X:71422361-71422383 CACCTGGGCTGGAGTGCAGTGGG + Intronic
1192917281 X:75666224-75666246 CTCTGGGCATGGAGTGGAGAGGG + Intergenic
1193790777 X:85813167-85813189 CCCTTGGTCTGGAGAGCACATGG + Intergenic
1193981975 X:88192260-88192282 CACCCAGGCTGGAGTGCAGATGG - Intergenic
1193987922 X:88269388-88269410 CACTCAGGCTGGAGTGCAGTGGG - Intergenic
1194476307 X:94363952-94363974 CACTCAGGCTGGAGTGCAGTGGG + Intergenic
1195397016 X:104422076-104422098 CACTCAGGCTGGAGTGCAGTGGG - Intergenic
1195416168 X:104621617-104621639 GTCTGGGTGTGGAGTGGAGAGGG - Intronic
1195553727 X:106197517-106197539 CACTGGTTCTGGTATGCAGAAGG - Intronic
1195734821 X:108001242-108001264 GCCTGGGTGTGGAGTGCAGAGGG - Intergenic
1195735357 X:108007386-108007408 CACTCAGGCTGGAGTGCAGTGGG - Intergenic
1196613616 X:117742646-117742668 CACTAACTCTGGAGTGCAGTAGG + Intergenic
1196613775 X:117743675-117743697 GCCTGGGTGTGGAGTCCAGAGGG - Intergenic
1196782989 X:119399572-119399594 CACCGGGTGTGGCGGGCAGAGGG + Exonic
1197356190 X:125439423-125439445 CTCTTGGTCTGGAGAGCATATGG - Intergenic
1198089043 X:133309554-133309576 CATTGGGAATGGAATGCAGAAGG - Intronic
1198968233 X:142250425-142250447 GCCTGTGTGTGGAGTGCAGAGGG + Intergenic
1199875126 X:151922584-151922606 CACTGTGTCTGTAGACCAGATGG - Intronic
1200069350 X:153520055-153520077 CCCTGGATCTGGAATGGAGAAGG - Intronic
1200088521 X:153623628-153623650 CTCTGGCTCTGGAGAGCTGAGGG - Intergenic
1200252446 X:154560772-154560794 AACGTGGTCTGGAGAGCAGATGG - Intronic
1200265321 X:154643644-154643666 AACGTGGTCTGGAGAGCAGATGG + Intergenic
1201101835 Y:10683954-10683976 CGCTTGGACTGGAATGCAGAGGG + Intergenic
1201463836 Y:14257813-14257835 CACTGAGGCTGGAGTGCAGTGGG - Intergenic
1201851285 Y:18484007-18484029 CACCCGGGCTGGAGTGCAGGAGG + Intergenic
1201882034 Y:18836372-18836394 CACCCGGGCTGGAGTGCAGGAGG - Intergenic