ID: 932740222

View in Genome Browser
Species Human (GRCh38)
Location 2:74285488-74285510
Sequence CTATGGATATGGAGGGACAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 0, 3: 32, 4: 237}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932740213_932740222 7 Left 932740213 2:74285458-74285480 CCATCAGCAGGCGGTCCTGGAAC 0: 1
1: 0
2: 0
3: 18
4: 112
Right 932740222 2:74285488-74285510 CTATGGATATGGAGGGACAATGG 0: 1
1: 0
2: 0
3: 32
4: 237
932740215_932740222 -8 Left 932740215 2:74285473-74285495 CCTGGAACCAGTGCCCTATGGAT 0: 1
1: 3
2: 52
3: 346
4: 850
Right 932740222 2:74285488-74285510 CTATGGATATGGAGGGACAATGG 0: 1
1: 0
2: 0
3: 32
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932740222 Original CRISPR CTATGGATATGGAGGGACAA TGG Intronic
902309852 1:15573806-15573828 CTCTGGAAAAGGAGGCACAAGGG - Intronic
903763486 1:25716229-25716251 CTATGGAAATTGAAGGAGAATGG + Intronic
905618503 1:39419246-39419268 CTATGGATTGACAGGGACAATGG - Intronic
905805474 1:40873954-40873976 CTGTGGGTAGGGAGGGACAACGG + Intergenic
906162388 1:43659935-43659957 CTGTGGATATGTAGGGACCTTGG + Intronic
911069662 1:93822646-93822668 CTTTGGATATGGCTGGAGAAAGG + Intronic
911299905 1:96159135-96159157 CTATGAAAATGGAGGAAAAATGG + Intergenic
911471345 1:98322606-98322628 CTATGCATATGTGGGGGCAAAGG + Intergenic
912024781 1:105156149-105156171 CTATGCATATGGAAAGCCAAAGG - Intergenic
912149304 1:106837576-106837598 CTATGTATGTGTAGGGACAGAGG + Intergenic
913245828 1:116869250-116869272 CTATGGATTTGGAGGGGGAAAGG + Intergenic
913512352 1:119573335-119573357 CTAAGGATATGGAAGAATAAAGG - Intergenic
913516631 1:119610843-119610865 CTAAGGATATGGAAGAATAAAGG - Intergenic
916402644 1:164465792-164465814 TTGTGGAGATGGAGGGACAGAGG + Intergenic
916873378 1:168941311-168941333 CTAAGAATAAGGAGGGACCAAGG - Intergenic
917310185 1:173670347-173670369 CGATGGAGGTGGAGGGACAAGGG + Intergenic
919345909 1:196378096-196378118 CCATGAATATGAATGGACAAAGG + Intronic
919939805 1:202278436-202278458 CTGAGGACAAGGAGGGACAAGGG + Intronic
920441630 1:205984800-205984822 CTTTGCAAATGAAGGGACAATGG - Intronic
920457128 1:206109924-206109946 CTATGAATATGGCAGGACCAGGG + Exonic
920713288 1:208316073-208316095 CCATGGATGTGGAGGAGCAAAGG + Intergenic
922571543 1:226637427-226637449 CTCTGGAGCTGGAAGGACAAGGG + Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
1063332028 10:5169287-5169309 CTATAGTTATGAAAGGACAAAGG + Intergenic
1065413260 10:25454441-25454463 TTATGGATTAGGAGGGATAAGGG + Intronic
1066366077 10:34778021-34778043 TTACGGATATGGAGGGACAGTGG - Intronic
1068619552 10:59165850-59165872 CTATGGATACCAAGAGACAATGG - Intergenic
1068857576 10:61812964-61812986 CTATTGAGATGGGGGGAAAATGG + Intergenic
1069307569 10:66990238-66990260 CTGTGGATATTGGGAGACAATGG - Intronic
1069717218 10:70529080-70529102 GAGTGGATATTGAGGGACAATGG + Intronic
1070127158 10:73631811-73631833 TTATGGGAATGGAGGGAAAAAGG - Exonic
1070553710 10:77512277-77512299 CTATGGATAAGGGGGGACTGTGG - Intronic
1071129353 10:82373388-82373410 ATGTGGATGTGGAGAGACAAAGG + Intronic
1071249461 10:83802417-83802439 CTATGGACAGCGAGAGACAATGG - Intergenic
1072471769 10:95719982-95720004 AGCTGGGTATGGAGGGACAATGG + Intronic
1072822241 10:98569526-98569548 ATATGGATTTGGAGGGATAGAGG - Intronic
1075190802 10:120306669-120306691 CCATGGATATGGAAGGCCAATGG - Intergenic
1077077480 11:708099-708121 CTGTTGGTATGGAGGGTCAAGGG - Intronic
1077358241 11:2128413-2128435 CTGTGGGGATGGAGGGACAGGGG - Intergenic
1080041522 11:27764205-27764227 CTCTGGACATGGAGGGAATAAGG - Intergenic
1080502868 11:32887069-32887091 CTACGGATATGGAGGGACTTTGG - Intergenic
1080703637 11:34667678-34667700 CTGTGAATATGGGGGGACCATGG - Intergenic
1085109781 11:73877180-73877202 CGAGGGATATGGAGGGAACAGGG + Intronic
1085861747 11:80243662-80243684 ATAGTGATATGGATGGACAATGG + Intergenic
1087632153 11:100662520-100662542 CCGTGGATAAGGAGGGACTACGG - Intergenic
1087971473 11:104490363-104490385 CTATGGGTATGCAGCCACAAGGG - Intergenic
1090229860 11:125093866-125093888 CGAAGGAAAAGGAGGGACAAGGG - Intergenic
1091796911 12:3302756-3302778 CTGTGGATATGGAGGGCTGATGG + Intergenic
1094252834 12:28385797-28385819 CTGTGGATTTGTTGGGACAATGG + Intronic
1094601073 12:31909403-31909425 CTATAGTTATAGAAGGACAAGGG - Intergenic
1095621970 12:44267668-44267690 CTAGGGACTTGGAGGGAGAAAGG - Intronic
1095739735 12:45593617-45593639 CTATGGATATGTGGGGACATGGG + Intergenic
1096438889 12:51621618-51621640 CTCTGGATGTGGAGAGACTAGGG + Intronic
1097034524 12:56114487-56114509 CTATGGATTTGGGGTGATAATGG + Intergenic
1099244614 12:80180138-80180160 ATCTGGATATGGAGGGTCATAGG + Intergenic
1099244627 12:80180218-80180240 ATCTGGATATGGAGGGTCATAGG + Intergenic
1100700564 12:97143417-97143439 ATATGGAACTGGAGAGACAAAGG - Intergenic
1105686881 13:22792912-22792934 CTCGGGATGTGGAGGGAGAAAGG + Intergenic
1106926067 13:34614469-34614491 CTATGCATATGTAGGGACAGGGG - Intergenic
1107617741 13:42188795-42188817 CTTTTGATTTAGAGGGACAATGG - Intronic
1108457695 13:50633097-50633119 CTACAGATATGTAGGGAAAATGG + Intronic
1108742571 13:53353767-53353789 CCATGGATAAGGAGTGACTATGG + Intergenic
1108891459 13:55265875-55265897 CTATGGATAAGTGGGGACTACGG - Intergenic
1109889516 13:68590442-68590464 TTATGTATCTGGAGGGACAGTGG - Intergenic
1111291541 13:86177508-86177530 CTGTGGATATGGAGGGCCACTGG + Intergenic
1111477383 13:88769423-88769445 CTAGGGATTTGGAGGTACAAAGG + Intergenic
1111993627 13:95140777-95140799 ATATGGATTTGGAGGAAAAAGGG - Intronic
1112170145 13:96963088-96963110 ATATGTATATGGAGAGCCAAAGG + Intergenic
1114868567 14:26628537-26628559 CCATGGATTTCGAGGGACAAGGG - Intergenic
1116992379 14:51290033-51290055 GAATGGATTTGGAGGGGCAAAGG + Intergenic
1120226850 14:81800428-81800450 CTATCTATCTGGAGGGAGAAAGG + Intergenic
1121088795 14:91167204-91167226 CTCTGGGTATGGTGGGAGAAGGG - Exonic
1121331006 14:93049816-93049838 ATGTGGATGTGGAGGGACAGAGG + Intronic
1121851105 14:97221807-97221829 CTATGAATATGGAGGAGCGATGG + Intergenic
1124460384 15:29884916-29884938 CAACAGATATGGATGGACAAGGG + Intronic
1124642907 15:31408366-31408388 CCATGGATGGTGAGGGACAAGGG - Intronic
1125091193 15:35794906-35794928 TTAAGGATAAGGAGGGACACTGG - Intergenic
1125710632 15:41782906-41782928 GTAAGGATATAGATGGACAAGGG - Intronic
1125796788 15:42409286-42409308 CTGTGGCTGTGGAGGCACAAAGG - Exonic
1126330987 15:47531353-47531375 TTATGCATATGGAGGCAAAAGGG - Intronic
1126931734 15:53660893-53660915 ATACAGATATGGAGGGAAAAGGG + Intronic
1127210591 15:56770862-56770884 ACATGGACATGCAGGGACAATGG - Intronic
1127275906 15:57443688-57443710 CTATGTATATGCAAGGACTATGG - Intronic
1128747351 15:70123873-70123895 CTAAGGATAAGGAGGGGCAAAGG - Intergenic
1129112810 15:73347805-73347827 CTCTGGATTTGGAGAGACTAGGG - Intronic
1130016728 15:80193208-80193230 GAATAGATCTGGAGGGACAAAGG - Intergenic
1131732029 15:95292121-95292143 ATATGGAAAAGGAGGGAAAAAGG - Intergenic
1136024249 16:27459898-27459920 TTCTGGATGAGGAGGGACAAAGG - Intronic
1136181124 16:28553193-28553215 CTAAGGATATGGACGTGCAATGG - Intergenic
1136682359 16:31975783-31975805 CTATGCATGTGGAAGGAGAAAGG - Intergenic
1136782617 16:32916951-32916973 CTATGCATGTGGAAGGAGAAAGG - Intergenic
1136887177 16:33936899-33936921 CTATGCATGTGGAAGGAGAAAGG + Intergenic
1139195733 16:64916816-64916838 ATCTGGAAGTGGAGGGACAAAGG - Intergenic
1139278798 16:65751916-65751938 CTATGACTATGGAGGGAGATGGG - Intergenic
1139960933 16:70716873-70716895 CTGTGGATCTGGAGGGTCACTGG + Intronic
1203085275 16_KI270728v1_random:1180939-1180961 CTATGCATGTGGAAGGAGAAAGG - Intergenic
1144447817 17:15347386-15347408 CTATAGATATGGAGGGCTGATGG + Intergenic
1146427402 17:32754683-32754705 CTATGGATGTGAAGGAGCAAGGG + Intronic
1146609184 17:34289516-34289538 CCATTGATCTGGAGGGCCAATGG + Intergenic
1147142879 17:38469121-38469143 CTATGCATGTGGAAGGAGAAAGG - Intronic
1153545983 18:6205222-6205244 CTTTGAATATGGATGGAGAAAGG + Intronic
1154175868 18:12087058-12087080 CCAGGGATATGGAAGGACCAGGG - Intergenic
1154308915 18:13252780-13252802 CTGTGGATGTGGAGGGCCGACGG - Intronic
1154528259 18:15314764-15314786 CTTTAGATGTGGAGGGAAAAGGG + Intergenic
1157526869 18:48390028-48390050 CCATCCATATGAAGGGACAAGGG + Intronic
1159122519 18:64187295-64187317 CCATGGCTCTGGAGGGACGAGGG - Intergenic
1161237290 19:3204380-3204402 CAGTGGGTAAGGAGGGACAAGGG - Intronic
1162160876 19:8714864-8714886 CTATTGATAGGGAAGGACTAGGG + Intergenic
1163369162 19:16892475-16892497 CCAGGGATAAGGTGGGACAATGG + Exonic
1163744654 19:19038313-19038335 CCATGGATATGGTGGGGCTAGGG - Intronic
1164745868 19:30612459-30612481 CTCTGGATATGGAGATACCATGG + Intronic
926114982 2:10207265-10207287 CCATGGAGATGGAGAGAAAAGGG - Intronic
927059271 2:19399369-19399391 CAATGAATATGGAGGAAAAAAGG + Intergenic
927343168 2:22005898-22005920 CAATGGACATGAAGAGACAAAGG - Intergenic
928218808 2:29385329-29385351 CTATGGTTATTGCTGGACAATGG - Intronic
930932597 2:56905392-56905414 CCTTGGATATGAAGGGCCAATGG + Intergenic
931225277 2:60324073-60324095 CTAGGGATATTGAGGGAAAGGGG - Intergenic
932026684 2:68140768-68140790 CCATGGATAGGGAGGGCCAACGG - Intronic
932084551 2:68746651-68746673 AAATGGAGATGGAGGGAGAAGGG + Intronic
932740222 2:74285488-74285510 CTATGGATATGGAGGGACAATGG + Intronic
932764461 2:74461215-74461237 CTCTGGCTCTGAAGGGACAAAGG - Exonic
933592842 2:84251633-84251655 ATATGGAGAGGGAGGGAGAAAGG + Intergenic
934720942 2:96576294-96576316 GGATGGTTATGGAGGGACAAGGG + Intergenic
934959934 2:98663880-98663902 CTATGGTCATGTAGGGACACTGG + Intronic
935581558 2:104760134-104760156 TTATGGTTAGGTAGGGACAAGGG + Intergenic
938990918 2:136628934-136628956 CTATTAAAATGGAAGGACAAAGG + Intergenic
940907902 2:159185220-159185242 CTATGGACATGGAGGGCAAATGG + Intronic
941561855 2:167056801-167056823 ATATGGATATGGAGGGAAGGAGG - Intronic
941712746 2:168731596-168731618 CCATGGGAAGGGAGGGACAAAGG + Intronic
943600793 2:189918931-189918953 CTGTGGATAAGGGGGGACTATGG - Intronic
944191787 2:197010770-197010792 TTATGGATGTGGAGAGAGAAGGG + Intronic
945694065 2:213080347-213080369 TTTGGGATATGGAGGCACAAAGG + Intronic
947061255 2:226168863-226168885 CTAAGGATATGGAATGAAAAAGG + Intergenic
948168802 2:235884199-235884221 CCATAGATACTGAGGGACAATGG - Intronic
948559480 2:238842039-238842061 CTAGGGATATGTAGGGAAATGGG - Intergenic
1169347188 20:4838113-4838135 CAGTGGATGTGGAGAGACAAGGG + Intergenic
1169583749 20:7057517-7057539 CCCTAGATATGAAGGGACAAAGG - Intergenic
1169927896 20:10802123-10802145 CTATCAATATGGATGGGCAATGG + Intergenic
1170117276 20:12873680-12873702 GAATGGATCTGAAGGGACAAAGG + Intergenic
1170784242 20:19453677-19453699 CTATGGCAATGGAAGGACATTGG - Intronic
1172430394 20:34885918-34885940 TTATGGATATGGGGGTAAAAAGG + Intronic
1174580720 20:51569616-51569638 CCATAGACATGTAGGGACAAAGG - Intergenic
1176688020 21:9871596-9871618 TTCTGGAAGTGGAGGGACAAGGG - Intergenic
1176857865 21:13985895-13985917 CCAGGGATATGGCAGGACAAAGG - Intergenic
1178498300 21:33105226-33105248 TTATGGAAATGGAGGGACCCAGG - Intergenic
1179236713 21:39553982-39554004 CTGTGGATATGGAGTGACCTGGG - Intergenic
1180742083 22:18060847-18060869 CAATGAATATGGAGGGGCAGAGG + Intergenic
1181114279 22:20621389-20621411 ATATGGACATGGAGAGACACAGG + Intergenic
1183234393 22:36606382-36606404 ATATGGAAGTGGAGGGACAGAGG + Intronic
1183563812 22:38598166-38598188 ATATGGAAATGGAGGCACAGAGG - Intronic
1184824522 22:46939353-46939375 CTAAGGATATGAAGGGAATATGG + Intronic
1184924165 22:47625835-47625857 TGGTGGGTATGGAGGGACAAGGG - Intergenic
949160758 3:879121-879143 CTAAGGATAGGGATGGAGAAAGG + Intergenic
949226043 3:1697578-1697600 CTCTGGATATGAAGGGAAAGAGG + Intergenic
950483857 3:13261284-13261306 CGGTCGATGTGGAGGGACAAAGG + Intergenic
955862832 3:63350800-63350822 CTATTAATTGGGAGGGACAAGGG - Intronic
956127331 3:66023231-66023253 ATATGGAAATGGAGGGGGAAAGG + Intronic
958029921 3:88096277-88096299 CTCTAGAAATGGAGGGACAAAGG + Intronic
958816971 3:98927644-98927666 CTAGGGAGCTGGTGGGACAATGG + Intergenic
959233385 3:103688291-103688313 ATATAGATATGGAGGGAAAGGGG + Intergenic
959383285 3:105669189-105669211 ATATGGATTTGCAGGGAAAAGGG - Intronic
959633047 3:108530657-108530679 CTATGCATGTGTAGGGACAGGGG + Intergenic
960168354 3:114429648-114429670 CCATGGATACGGAGGGCCAGAGG - Intronic
960988861 3:123297507-123297529 CGTTGGATATGGAGGGTGAATGG - Intronic
962418132 3:135202311-135202333 CTACTGAGATGGAGGGACTAGGG - Intronic
962690586 3:137893670-137893692 CTAGGTACATGGAGGCACAAAGG - Intergenic
962931442 3:140041383-140041405 TCCTGGATATGGAGAGACAAGGG - Intronic
962962182 3:140321238-140321260 CTATGGATATGGAGAGTCCAGGG - Intronic
963510752 3:146245174-146245196 CTATGGATAAGGAAAGAAAATGG + Intronic
963758247 3:149258763-149258785 CTAGGGATGTGGAGATACAAGGG - Intergenic
963829613 3:149992844-149992866 CTATGGATATGGAGATGAAAGGG - Intronic
965231087 3:166053767-166053789 CTATGAATATGTAGGTGCAAGGG - Intergenic
965641516 3:170833718-170833740 CTATGCATTTGTAGGGGCAATGG - Intronic
965711870 3:171563628-171563650 CTATGGCTCTGGAGGGCCAGTGG - Intergenic
966877553 3:184331820-184331842 CCAGGGAGATGGAGGGGCAAGGG + Intronic
966979875 3:185122319-185122341 CCACGGATATGGAGGGCCAATGG - Intronic
970500413 4:16671468-16671490 GTAGGGACCTGGAGGGACAAAGG - Intronic
971144238 4:23959682-23959704 CTATGAAGATGGAAGGAGAAAGG + Intergenic
971527545 4:27639860-27639882 CTGTGGATACAGAGGGACAGAGG - Intergenic
972386005 4:38566165-38566187 GTATGGATATGGCTGGAAAAAGG - Intergenic
973550845 4:52034621-52034643 CCATAGATATTGAGGGACAACGG + Intronic
974910064 4:68107253-68107275 CTATGGATATGGCCGTACTAAGG + Intronic
982956915 4:161781727-161781749 CTATGGATCTGGAGTGATAATGG - Intronic
983082236 4:163400584-163400606 CTTTGGAAATGAAGGCACAAAGG - Intergenic
983993986 4:174158954-174158976 CTATGGAAAAGCAGGGAGAAGGG + Intergenic
986038473 5:3963249-3963271 CTTTGGATTTTGAGGGAGAAGGG + Intergenic
986598795 5:9450500-9450522 CTATGATTATGGAGGGAGAATGG - Intronic
989814939 5:45724470-45724492 GTATGGAGATGGAGGGAGAGAGG - Intergenic
991037950 5:62146661-62146683 CAATGGATGTGGAGGGGCAGGGG + Intergenic
992222165 5:74583810-74583832 CTATGCATGTGTGGGGACAAGGG - Intergenic
992295236 5:75320988-75321010 CTATGGATAAAGAGTTACAAGGG - Intergenic
993123642 5:83805604-83805626 CTGTGTATATGGAGGAACAGTGG + Intergenic
996546999 5:124690454-124690476 CTATGCATGTGTAGGGGCAAGGG + Intronic
997154473 5:131538644-131538666 CCATGGATACTGAGGGACCATGG + Intronic
999691502 5:154149904-154149926 CTGTGGATACAGAGGGACAGAGG + Intronic
1000287847 5:159843080-159843102 CTGAGGATATTGAGGGACAACGG + Intergenic
1000484186 5:161819111-161819133 CTAAGGAAATGGAGGCACAGTGG - Intergenic
1000894950 5:166844472-166844494 ATATGGATATGGGAGGAAAAAGG - Intergenic
1001923200 5:175616917-175616939 CAGTGGTGATGGAGGGACAAGGG + Intergenic
1001946378 5:175781839-175781861 CTATGGTTAAGGGGGGAAAATGG - Intergenic
1001951451 5:175819562-175819584 CTCTGGACAGGGAGGGTCAAGGG + Intronic
1004792664 6:19044671-19044693 CTATGCATGTGAAGGGGCAAGGG - Intergenic
1004878727 6:19984076-19984098 CTGTGGATAGAGAGGGTCAAAGG - Intergenic
1007040122 6:38714163-38714185 CTATTAATATGGATGGACCATGG + Intergenic
1007212560 6:40206974-40206996 CTAGGGAGATGGAGTGGCAAAGG + Intergenic
1007825413 6:44596191-44596213 CTAAGGATATGGAGGGAGGAAGG - Intergenic
1008844332 6:55943842-55943864 CTAGGAATATACAGGGACAATGG - Intergenic
1010843676 6:80678700-80678722 CTAGGGACATGGTGGGACACAGG + Intergenic
1011195307 6:84774272-84774294 CTTTGGCTATGGAGGTACAGTGG + Intergenic
1011551541 6:88535245-88535267 CTATGAATATGGATAGGCAATGG + Intergenic
1011955165 6:93016851-93016873 CTATGGACCTGGAGGTTCAATGG + Intergenic
1012376141 6:98563874-98563896 CTAAGGAGAGGGAAGGACAAAGG - Intergenic
1012546798 6:100428997-100429019 CTGTGGATAAGGGGGGACTATGG + Intronic
1012683518 6:102212880-102212902 CTATGCATGGGTAGGGACAAAGG - Intergenic
1012897189 6:104963643-104963665 CTATGCATTTGAAGGGGCAAGGG - Intronic
1013740514 6:113278450-113278472 CTATGGCTTTGGAAGGAGAAGGG + Intergenic
1017846945 6:158266826-158266848 CCATCGATATTGAGGGACAACGG + Intronic
1019106640 6:169673119-169673141 CAATGGATATGGAGGGATGGAGG + Intronic
1019498734 7:1353697-1353719 CTCGGGATATGGTGGGATAAAGG + Intergenic
1019576282 7:1739197-1739219 CTCTGGCTGTGGAGGGAGAATGG + Intronic
1019906115 7:4066516-4066538 CTATGGCTATAGAGAGACCATGG + Intronic
1020948264 7:14643472-14643494 CTATGGATGTGGAGATACAGGGG - Intronic
1023177877 7:37451073-37451095 CCATGGATATGGGGAGACACTGG - Intergenic
1024389318 7:48788699-48788721 CTATGGATATGGCGGCACAGGGG + Intergenic
1025213064 7:57032210-57032232 CTTTGCATATGGAGGGAAATTGG + Intergenic
1025658888 7:63544614-63544636 CTTTGGATATGGAGGGAAATTGG - Intergenic
1029704387 7:102268394-102268416 CAATGAATATGGAGGGTCAGGGG - Intronic
1030961116 7:115924380-115924402 CTAAGAATCTGGAGAGACAAAGG + Intergenic
1032695582 7:134333490-134333512 AAATGAATCTGGAGGGACAATGG - Intergenic
1033482854 7:141759429-141759451 CTGTGGATACGGAGGGCCAGTGG - Intronic
1034326819 7:150243543-150243565 CCATGGATACCAAGGGACAATGG - Intergenic
1034766386 7:153725719-153725741 CCATGGATACCAAGGGACAATGG + Intergenic
1036742821 8:11380484-11380506 CTATGGATTTTGAGTGATAATGG - Intergenic
1037414178 8:18631005-18631027 CTACAGATATTAAGGGACAACGG + Intronic
1037541557 8:19876735-19876757 CTTTGGAAATGGAGGGAGACAGG - Intergenic
1038759407 8:30372878-30372900 ACATGAATTTGGAGGGACAATGG - Intergenic
1038803925 8:30773522-30773544 AAACGGATGTGGAGGGACAATGG - Intergenic
1039934506 8:42030059-42030081 CTACGGATATGGAGATTCAAGGG + Intronic
1040757882 8:50802933-50802955 CCATGGATCTTGGGGGACAAAGG - Intergenic
1042399023 8:68324544-68324566 CTAGGAATATGAAGGGTCAAGGG + Intronic
1042684333 8:71421312-71421334 CTATGGAGATGAAAGGACACTGG + Intronic
1042725048 8:71865474-71865496 CTATTGATAGTGAGGGAAAAAGG - Intronic
1044493416 8:92847454-92847476 CTATGGAAATGGAAAGACAGAGG + Intergenic
1045424379 8:102049308-102049330 CCATGGATATCGAGGGACAGTGG + Intronic
1046212293 8:111092706-111092728 CTGTGGATATGGAAGCAAAAGGG - Intergenic
1047076076 8:121405007-121405029 ATATGTATAGTGAGGGACAATGG - Intergenic
1047085574 8:121511998-121512020 AGCTGGATATGGAGGGTCAAAGG - Intergenic
1047161270 8:122382870-122382892 CTATGCTGATGGAGGGGCAAGGG - Intergenic
1047649834 8:126908706-126908728 CTATGGATGTTGTGGGAGAATGG + Intergenic
1047744483 8:127834034-127834056 CTATGGGCAGGGAGGAACAATGG - Intergenic
1049360252 8:142209407-142209429 CTAGGGATATGTAGGGCCAAAGG + Intergenic
1050360804 9:4829290-4829312 TTATGGAGATGGAAGGAGAACGG + Intronic
1050416887 9:5427790-5427812 TTCTGGAAAAGGAGGGACAAGGG + Intronic
1052170810 9:25394222-25394244 CTGTGGATATGGAGAGCCAACGG + Intergenic
1053270466 9:36746050-36746072 CTCTGGATACAGAGGGACACCGG + Intergenic
1055712041 9:79073916-79073938 CTGTGGATGTGAAGGGACAGGGG + Intergenic
1057893494 9:98887680-98887702 CCATGGATACTGAGGGACAAAGG - Intergenic
1058935163 9:109763306-109763328 CTATGGAGATGGAGAGAAAAGGG - Intronic
1059779839 9:117514811-117514833 ATATGAATAAGGAGGCACAAAGG + Intergenic
1190061860 X:47216754-47216776 CAAAGGATAGGGTGGGACAAAGG + Intergenic
1191151223 X:57222368-57222390 CTGTCGATATAGAGGGAGAAAGG - Intergenic
1191166934 X:57401483-57401505 AGCTGGATATAGAGGGACAACGG + Intronic
1192436192 X:71145181-71145203 CTGTGGAAATAGAGGGACCATGG - Intronic
1193046572 X:77060667-77060689 CCAGGGATTTGGAGGGAAAAAGG - Intergenic
1194706052 X:97177126-97177148 CCATGGATATGGAGGGTGGAGGG + Intronic
1199749374 X:150800331-150800353 CTATGGATATGGAGGATCATCGG - Intronic
1200790066 Y:7291727-7291749 ATATGGAGATGGAGGGTTAATGG - Intergenic
1200876677 Y:8163488-8163510 CTTTGGCCATGGAGGAACAAAGG + Intergenic
1201057038 Y:10004435-10004457 CTTTGGCCATGGAGGAACAAAGG - Intergenic
1201893119 Y:18964421-18964443 GTATGGATGGGGAGGGACTATGG - Intergenic