ID: 932743891

View in Genome Browser
Species Human (GRCh38)
Location 2:74315093-74315115
Sequence GGTCAAATCCACAGTCATAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 1, 2: 2, 3: 42, 4: 177}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932743885_932743891 22 Left 932743885 2:74315048-74315070 CCTCAAAATGTATACATTAAAAA 0: 1
1: 2
2: 19
3: 194
4: 1986
Right 932743891 2:74315093-74315115 GGTCAAATCCACAGTCATAATGG 0: 1
1: 1
2: 2
3: 42
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932743891 Original CRISPR GGTCAAATCCACAGTCATAA TGG Intronic
900980258 1:6042264-6042286 GGTCAAACCCACAGGCAAAGGGG - Intronic
904426467 1:30426740-30426762 GGTTAAATCCCCAGTCAGACTGG - Intergenic
904894865 1:33808158-33808180 AGGCAAATCCACCATCATAATGG + Intronic
907752805 1:57279677-57279699 TGTGAAACCCACAGTCACAAAGG + Intronic
908451734 1:64262750-64262772 GGTCCTATCCACACTCAGAAAGG + Intronic
910157726 1:84239278-84239300 GGTCATAACAACAGGCATAAAGG - Intergenic
911063178 1:93764895-93764917 GGCCACATCCACAGTCCTAGGGG + Intronic
911108590 1:94159388-94159410 GGACAAGTCCATAATCATAAGGG - Intronic
911598312 1:99821690-99821712 GGACAAATCCACAGTCACAGTGG - Intergenic
912095405 1:106135314-106135336 GGATAAATCTACATTCATAATGG + Intergenic
914003075 1:143709107-143709129 GGTAAAATCCACAGGAAGAAGGG - Intergenic
918550812 1:185740135-185740157 AGTAAAAGCCAAAGTCATAATGG - Intronic
919054118 1:192547895-192547917 GGCCAAATCCAAAGTCAAGAGGG + Intergenic
923549428 1:234950656-234950678 AGACAAATCCACAATCATTATGG + Intergenic
1067340494 10:45398419-45398441 TGTCAAATCCAAAGTCATGAAGG - Intronic
1067573646 10:47390366-47390388 TATCAAATCCAATGTCATAAAGG + Intergenic
1067699715 10:48561414-48561436 TGTCTAATCCAAAGTCATAAAGG - Intronic
1071052700 10:81471333-81471355 AGTCATTTCCATAGTCATAATGG - Intergenic
1072532927 10:96336561-96336583 TGTTAAATCCACAGTTCTAAGGG + Intronic
1075008173 10:118845389-118845411 GTTCAATTTCACAGTCATGATGG - Intergenic
1075124488 10:119688803-119688825 AGACAAATCCACAATCATAGTGG + Intergenic
1075409145 10:122214577-122214599 GGTCACTTCCACAGTCAGAATGG - Intronic
1077398564 11:2340163-2340185 TGTCTAGTCCACAGACATAAAGG + Intergenic
1077694271 11:4379472-4379494 GGTCAAACACACTGTTATAAAGG - Intergenic
1078736453 11:14025003-14025025 GGGCAAAGCCACAGAGATAATGG + Intronic
1081167300 11:39821933-39821955 GGTAAAATGCAGAGTAATAAAGG - Intergenic
1082651622 11:55800835-55800857 GTTCAAGTCCATGGTCATAAGGG + Intergenic
1083089762 11:60187605-60187627 AGTCTAATCCACAGACATAAAGG + Intergenic
1083577546 11:63803116-63803138 GGTCACGTCCACAGTCACAAGGG + Intergenic
1085002319 11:73050466-73050488 GCTCAAATCCATTGTGATAAAGG - Intronic
1085239667 11:75042246-75042268 AGTCTAGTCCACAGACATAAAGG + Intergenic
1087778849 11:102282480-102282502 GAGCAACTCCACAGTCATCAGGG + Intergenic
1089401300 11:118166191-118166213 GGCCTCATCCACAGTCCTAAGGG + Exonic
1089434285 11:118450881-118450903 AGTCAAATACACAGACATCAAGG - Intronic
1089772294 11:120812234-120812256 GCTCAAAGCCACAGTCATCCTGG - Intronic
1090712864 11:129403538-129403560 CGTAAAATGGACAGTCATAAGGG - Intronic
1091789531 12:3263845-3263867 GGTCCAATCCAGAGCCATCAAGG - Intronic
1091814632 12:3427879-3427901 AGTCTAGTCCACAGACATAAAGG - Intronic
1092276371 12:7064188-7064210 GGTTAAATCCAAAACCATAAGGG - Intronic
1093594260 12:20942745-20942767 AGTCTAGTCCACAGACATAAAGG - Intergenic
1095258591 12:40071369-40071391 GGACAAATCCCAATTCATAATGG + Intronic
1098011728 12:66060540-66060562 AAACAAAACCACAGTCATAATGG - Intergenic
1098639554 12:72823100-72823122 AGTCTAGTCCACAGACATAAAGG - Intergenic
1102559314 12:113750830-113750852 GGTCACATTCACAGGCATCAGGG + Intergenic
1104963506 12:132498999-132499021 GGTCACATACACAGGCAGAAGGG - Intronic
1105626004 13:22113214-22113236 GGTCAAACCCGCATTCGTAAGGG + Intergenic
1109897795 13:68716330-68716352 GGTCAAATTCACAGGTATTATGG - Intergenic
1111715074 13:91869402-91869424 GGACAAAGCCAGAGTCCTAAAGG + Intronic
1119404371 14:74388189-74388211 TGGCAAATCTAAAGTCATAAAGG - Intergenic
1121062541 14:90927739-90927761 GGACAAATCCACAATCATCATGG + Intronic
1124375870 15:29128297-29128319 GGTCAAATCCCCAGACACAGAGG - Intronic
1124930060 15:34110984-34111006 AGCCAAATCCACAGTCCTAGTGG - Intergenic
1125935914 15:43635617-43635639 GGGCAAATCTACTGTCACAAAGG + Intronic
1125948682 15:43732093-43732115 GGGCAAATCTACTGTCACAAAGG + Intergenic
1126304357 15:47238376-47238398 GGTCAAATCAAAGGACATAAAGG - Intronic
1127037841 15:54938705-54938727 GTTCAAATCCACATTGTTAAAGG - Intergenic
1127350873 15:58150724-58150746 AGTCAAATCCGCATTCATAAGGG - Intronic
1128563499 15:68683767-68683789 GGTCAAGACCACTGTCATCATGG + Intronic
1129570055 15:76672035-76672057 GCTCATTTCCAGAGTCATAAGGG - Intronic
1133403808 16:5507589-5507611 GGTCACATTCACAGGCATGAAGG - Intergenic
1133992871 16:10723643-10723665 GATCAAATCCACATTCATAAGGG + Intergenic
1137429022 16:48403413-48403435 GGACAATTCCAAAGTCATAAAGG + Intronic
1138297863 16:55902052-55902074 AGCCAAATGCACAGTCAAAAAGG - Intronic
1140781539 16:78301474-78301496 AGTCAAAACCAGATTCATAAAGG - Intronic
1142883609 17:2899006-2899028 AGGCAAATCCACAGACAGAACGG - Intronic
1146764031 17:35502775-35502797 AGTCTAGTCCACAGACATAAAGG + Intronic
1150430722 17:65114261-65114283 TGACAAATCCACAATCATTATGG - Intergenic
1153060280 18:987730-987752 GGTCAAATCCAGTGTCATACTGG + Intergenic
1155898322 18:31356142-31356164 AGTCAAAACCACAGTGGTAAAGG - Exonic
1156053379 18:32967287-32967309 AGACAAATCCACAATCACAATGG - Intronic
1157103817 18:44754575-44754597 GGCCAAGACCACAGACATAAAGG - Intronic
1157601989 18:48899041-48899063 TGTCAAATCCAAGGTCATGAAGG - Intergenic
1159477469 18:68942048-68942070 TAACAAATACACAGTCATAATGG + Intronic
1163991676 19:21004468-21004490 AGTCTAGTCCACAGACATAAAGG + Intergenic
1164072081 19:21777717-21777739 GAATAAATCCACAGTCAGAATGG + Intergenic
1164130842 19:22360323-22360345 AGTCTAGTCCACAGACATAAAGG - Intergenic
1164804203 19:31103704-31103726 GGGCAGATACACAGACATAAAGG - Intergenic
1165263177 19:34638004-34638026 GGAGAAATCCCCAGTGATAAAGG + Intronic
1202644483 1_KI270706v1_random:128218-128240 GGTCAAATCTGCATTCATAAGGG - Intergenic
925247471 2:2397002-2397024 AGACAAATTCACAGTCACAATGG - Intergenic
927430745 2:23024578-23024600 GGTCAATACCACATTCATTATGG + Intergenic
931067982 2:58609045-58609067 GGTTAAATGCATAATCATAATGG - Intergenic
932436368 2:71704597-71704619 GGTCAGATCCACAGACCTAGAGG - Intergenic
932743891 2:74315093-74315115 GGTCAAATCCACAGTCATAATGG + Intronic
932974989 2:76589358-76589380 TGACAAATCCACCGTTATAATGG - Intergenic
936716534 2:115193355-115193377 AGTCTAGTCCACAGACATAAAGG - Intronic
937202449 2:120213039-120213061 GGTCAAATCCGCATTCATAGAGG - Intergenic
937892983 2:126954125-126954147 AGGCAAATCCACAATCATAATGG - Intergenic
939510490 2:143098702-143098724 GATCAAATCCACCTTCATGAGGG + Intronic
940151595 2:150608391-150608413 GGTGATTTCCACAGTCATGAGGG - Intergenic
940645405 2:156387511-156387533 GGTAATATTCACATTCATAATGG - Intergenic
943407971 2:187512697-187512719 AGTCTAGTCCACAGACATAAAGG + Intronic
944346187 2:198668760-198668782 GGTCATTTCCACAGTTTTAAAGG - Intergenic
944567461 2:201005204-201005226 GGTTAAGTACACAGTCATGAAGG - Intronic
944741518 2:202617388-202617410 GGTCAAATCCGCATTCATAGGGG - Intergenic
945900054 2:215527278-215527300 TGTCCACTGCACAGTCATAATGG - Intergenic
948097755 2:235350023-235350045 GGTCTAATCCACAGCCACAGCGG + Intergenic
1171405784 20:24911622-24911644 GCTTAATTACACAGTCATAATGG + Intergenic
1171894444 20:30747145-30747167 GGTCAAATCTGCATTCATAAGGG - Intergenic
1175405098 20:58720615-58720637 TGACAAATCCAAAGTCATGAAGG - Intergenic
1176607398 21:8844436-8844458 GGTCAAATCTGCATTCATAAGGG + Intergenic
1177851661 21:26356248-26356270 GCTCATATCCAAAGTCATGAAGG - Intergenic
1178489971 21:33043460-33043482 GTTCAGTTCCACAGTCATACTGG - Intergenic
1180357481 22:11854223-11854245 GGTCAAATCTGCATTCATAAGGG + Intergenic
1180380786 22:12138108-12138130 GGTCAAATCTGCATTCATAAGGG - Intergenic
1182694361 22:32186571-32186593 AGGCAAATCCACAGACAGAATGG - Intergenic
1184110781 22:42393189-42393211 AGACAAATCCACAATCATACTGG + Intronic
1185117702 22:48947260-48947282 GGTCAAATTCACACTATTAAAGG + Intergenic
950244409 3:11402530-11402552 GGTCAAATCCACAGCCATGTTGG - Intronic
951330071 3:21356266-21356288 GGTCAAGTCCAGAGTCAGTATGG - Intergenic
951461515 3:22956434-22956456 GGTCAAATTCTCATTCAAAAAGG + Intergenic
952552857 3:34498580-34498602 GCTCAAATTCAGAGTCATATTGG + Intergenic
953384170 3:42496553-42496575 TGTCAAATCTACAGTCCTAGTGG - Intronic
954052862 3:47995958-47995980 CCTCAAATCCACAGACACAAAGG + Intronic
956040235 3:65137726-65137748 GATCAAAACCACAGTCTAAATGG + Intergenic
959483052 3:106896695-106896717 GGTCAAAGCCGCATTCATAGGGG + Intergenic
959871728 3:111336745-111336767 AGTCAAAACCACAGTAAAAAAGG + Intronic
960102473 3:113759195-113759217 TGTCAAATCCAAGGTCACAAAGG + Intronic
960188844 3:114678489-114678511 GTTCAAAAGCACAGTCAAAATGG - Intronic
961223039 3:125214786-125214808 GGTCAAATCCACAGATATGAAGG + Intergenic
965238555 3:166160991-166161013 GGTCAAATCCGCATTCGTAGGGG + Intergenic
965503779 3:169488090-169488112 GGACAAATTCACAATTATAATGG + Intronic
966540324 3:181082740-181082762 AGACAAATCCACAATCATAGTGG - Intergenic
966900156 3:184477131-184477153 AGACAAATTCACAGTCATAGAGG - Intronic
967044765 3:185726454-185726476 GGTGAAATGCACATTCCTAAAGG + Intronic
968851283 4:3080671-3080693 TGTCTAATCCAAAGTCAAAAAGG + Intronic
971335536 4:25720317-25720339 GGTCAAATCCACATTCATAGGGG + Intergenic
971373165 4:26034538-26034560 GGTACAAACTACAGTCATAATGG + Intergenic
972991457 4:44826469-44826491 AGTCTAGTCCACAGACATAAAGG - Intergenic
973370720 4:49246777-49246799 GGTCAAATCTGCATTCATAAGGG - Intergenic
973390307 4:49548680-49548702 GGTCAAATCTGCATTCATAAGGG + Intergenic
973558261 4:52108010-52108032 GTTCAAATCCACAGTGTTCAAGG - Intergenic
974513834 4:62881573-62881595 TGTCTAACCCAAAGTCATAAAGG + Intergenic
974520342 4:62974417-62974439 GGTCTAGTCCACAGACACAAAGG + Intergenic
974639607 4:64611179-64611201 GATCAAACCCGCATTCATAAGGG + Intergenic
975145600 4:70964153-70964175 AGACAAATCCATGGTCATAATGG + Intronic
977972249 4:103225865-103225887 AGTCTAGTCCACAGACATAAAGG + Intergenic
981150415 4:141374097-141374119 GATCACATGCTCAGTCATAAAGG - Intergenic
981568652 4:146129199-146129221 TGTCAAAACCACAATCATAATGG - Intergenic
982091330 4:151882447-151882469 GGTCTAATCTATAGTCATAGGGG - Intergenic
982323705 4:154107874-154107896 GGTCACATTCACAGGTATAAGGG - Intergenic
983527595 4:168775282-168775304 GCTCAAATCATCAGTCATTAGGG - Intronic
984395368 4:179190995-179191017 AGTCAAAACCGCAGTCATAAAGG - Intergenic
985975792 5:3418242-3418264 GGACACATCCACACACATAAAGG + Intergenic
987027692 5:13944087-13944109 GGTCAAAAACACATTCATAGTGG - Intronic
987054451 5:14178160-14178182 TGGCAAATCCAAAGTAATAAAGG - Intronic
989096170 5:37783664-37783686 AGTCTAGTCCACAGACATAAAGG - Intergenic
989316703 5:40088792-40088814 AGTCAAGTCCACAGTCATTATGG + Intergenic
992718741 5:79537706-79537728 GGTCAAGTCCACTGTCATGATGG - Intergenic
993215233 5:85014214-85014236 GGTCAAATGAAAAATCATAAAGG + Intergenic
994459088 5:100050937-100050959 GGTCGAAGCCACATTCGTAAGGG + Intergenic
995324193 5:110872715-110872737 GGTCAGAACCACAGCCAAAAGGG + Intergenic
995493431 5:112716651-112716673 ACTCAAATCCACAATCATAATGG - Intronic
996762324 5:126998846-126998868 GGTAACATCCACAGACATATTGG - Intronic
1005024604 6:21450477-21450499 GGTCAAATTGAGAGTCAGAATGG - Intergenic
1005451723 6:25980272-25980294 GGACAAATCTACAATCATCATGG - Intronic
1008668266 6:53739067-53739089 AGACAAATCCATAATCATAAGGG + Intergenic
1011570238 6:88726930-88726952 GGTCTAGTCCACAGACATGAAGG + Intronic
1011924963 6:92631230-92631252 TGGCAAATCCACACTCATAGTGG + Intergenic
1013176817 6:107684929-107684951 TGTCAAATTCACAGTTCTAAAGG + Intergenic
1013557469 6:111271054-111271076 GGTTAAAGGCACAGTGATAAGGG - Exonic
1014919801 6:127200513-127200535 GGGCTAATCCACAGACATAAAGG - Intergenic
1016836975 6:148487350-148487372 AGTCAAATCAACAGGCAAAATGG - Intronic
1018448069 6:163876478-163876500 GGCCAAATCCACAAGCATAGTGG - Intergenic
1018899741 6:168045116-168045138 GGTCCCATCCACATTCATGAGGG - Intergenic
1022580009 7:31542563-31542585 AGTCTAGTCCACAGACATAAAGG - Intronic
1023515680 7:40998812-40998834 TGTAAAGTCCACAGTCATTAGGG - Intergenic
1025226442 7:57168830-57168852 GGTCAAATCCGCATTCGTAGGGG - Intergenic
1028174573 7:87639498-87639520 AGACAAATCTACAGTCATAGAGG - Intronic
1028793628 7:94880105-94880127 AGTCTAATCCACAGACCTAAAGG + Intergenic
1028996949 7:97111172-97111194 TGACAAATCCACAATCATACTGG + Intergenic
1030694040 7:112565046-112565068 GGTCATATCACCAGTCAGAATGG - Intergenic
1032292304 7:130599320-130599342 GGTCAAATCCAGTGCCATATTGG - Intronic
1033803855 7:144932513-144932535 AGACAAATCCACATTCATATTGG - Intergenic
1035272150 7:157726574-157726596 GGCCAAATCCAATGTCATAAAGG - Intronic
1035290273 7:157833522-157833544 GGACAAATTCACCGTCATACAGG - Intronic
1036272942 8:7324080-7324102 AGTCATATCCATAGTCATATCGG - Intergenic
1036348408 8:7986268-7986290 AGTCATATCCATAGTCATATCGG + Intergenic
1036843680 8:12146735-12146757 AGTCATATCCATAGTCATATCGG + Intergenic
1036865051 8:12389055-12389077 AGTCATATCCATAGTCATATCGG + Intergenic
1038089534 8:24237725-24237747 AGTCTAGTCCACAGACATAAAGG + Intergenic
1039876950 8:41594975-41594997 AGTCTAGTCCACAGACATAAAGG - Intronic
1042055965 8:64765287-64765309 AGTCTAGTCCACAGACATAAAGG + Intronic
1045750837 8:105482102-105482124 TGACAAATCCATTGTCATAATGG - Intronic
1047444081 8:124904083-124904105 AGTCTAGTCCACAGACATAAAGG - Intergenic
1047593557 8:126352805-126352827 GGCCACACCCACAGTCATAAAGG + Intergenic
1052404707 9:28044897-28044919 GGCCAAATCCAAAGTAATATAGG + Intronic
1052507956 9:29379315-29379337 AGTCTAATCCACAGACATAAAGG + Intergenic
1052667179 9:31509911-31509933 AGTCAAAGCCACAGTCTTATAGG - Intergenic
1052968090 9:34357098-34357120 GGTCAACTGCATATTCATAAAGG + Intergenic
1053523150 9:38802398-38802420 GGTCAAATAAAAAGTTATAAGGG - Intergenic
1054195377 9:62026816-62026838 GGTCAAATAAAAAGTTATAAGGG - Intergenic
1054354208 9:64045626-64045648 GGTCAAATCTGCATTCATAAGGG + Intergenic
1054643030 9:67561873-67561895 GGTCAAATAAAAAGTTATAAGGG + Intergenic
1056695745 9:88849812-88849834 TGTCAAATCCAAAGTCATGAAGG + Intergenic
1057072350 9:92110272-92110294 GATCAAATCTACATTCATAAAGG - Intronic
1057636147 9:96769526-96769548 TGCCAAATCCAAGGTCATAAAGG - Intronic
1058008394 9:99945212-99945234 AAACAAATCCACAATCATAAGGG - Intronic
1058037022 9:100263959-100263981 AGTCAAGTCCATAGTCATAGTGG - Intronic
1058180617 9:101793630-101793652 GGTCGAATCCGCATTCATAGGGG + Intergenic
1059573679 9:115467739-115467761 TGTCAAAAACACAGTCATGAGGG - Intergenic
1060620820 9:125064141-125064163 AGACAAATCCACAATCATAAGGG + Intronic
1061821719 9:133231823-133231845 GGTCAAATACACAGTTGGAAGGG + Intergenic
1061833093 9:133308811-133308833 GGTCAAATCCACAGTCAGAATGG - Intergenic
1062237533 9:135518274-135518296 GGTCAAATACACAGTCGGAACGG - Intergenic
1203695132 Un_GL000214v1:91578-91600 GGTCAAATCTGCATTCATAAGGG - Intergenic
1203742540 Un_GL000218v1:14738-14760 GGTCAAATCTGCATTCATAAGGG + Intergenic
1203702731 Un_KI270742v1:9325-9347 GGTCAAATCTGCATTCATAAGGG + Intergenic
1203567558 Un_KI270744v1:104681-104703 GGTCAAATCTGCATTCATAAGGG - Intergenic
1203641141 Un_KI270751v1:12485-12507 GGTCAAATCTGCATTCATAAGGG + Intergenic
1186073534 X:5850497-5850519 GATAAAAACCAAAGTCATAATGG - Intronic
1187157155 X:16731527-16731549 AGTCTAGTCCACAGACATAAAGG - Intronic
1188185281 X:27106455-27106477 GGACAAATTCAGAATCATAAAGG - Intergenic
1188707539 X:33354454-33354476 GGACAAATCAACAATCATATTGG - Intergenic
1189834014 X:45002900-45002922 AGTCTAGTCCACAGACATAAAGG - Intronic
1190771095 X:53514869-53514891 AGTCTAGTCCACAGACATAAAGG + Intergenic
1192915597 X:75648198-75648220 AGTCTAGTCCACAGACATAAAGG - Intergenic
1194564160 X:95462310-95462332 GGTCAAATCCAATGTCATGTCGG - Intergenic
1194910666 X:99639964-99639986 TGTCTACTCCAAAGTCATAAAGG - Intergenic
1196266197 X:113649790-113649812 TGTTAAGTCCACAGTCATACTGG - Intergenic
1197261429 X:124323227-124323249 AAACAAACCCACAGTCATAATGG + Intronic
1199263784 X:145806419-145806441 AGTCTAAGCCACAGTAATAATGG + Intergenic
1201156068 Y:11132215-11132237 GGTCAAATCTGCATTCATAAGGG + Intergenic