ID: 932744967

View in Genome Browser
Species Human (GRCh38)
Location 2:74326356-74326378
Sequence ATCTATGATCTAAAGATGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 163}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932744967_932744970 -3 Left 932744967 2:74326356-74326378 CCATCCATCTTTAGATCATAGAT 0: 1
1: 0
2: 2
3: 10
4: 163
Right 932744970 2:74326376-74326398 GATCGCCTTGGTGTTGAGCATGG 0: 1
1: 0
2: 0
3: 2
4: 54
932744967_932744973 11 Left 932744967 2:74326356-74326378 CCATCCATCTTTAGATCATAGAT 0: 1
1: 0
2: 2
3: 10
4: 163
Right 932744973 2:74326390-74326412 TGAGCATGGCTTTACAGTAAGGG 0: 1
1: 0
2: 0
3: 15
4: 138
932744967_932744972 10 Left 932744967 2:74326356-74326378 CCATCCATCTTTAGATCATAGAT 0: 1
1: 0
2: 2
3: 10
4: 163
Right 932744972 2:74326389-74326411 TTGAGCATGGCTTTACAGTAAGG 0: 1
1: 0
2: 0
3: 10
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932744967 Original CRISPR ATCTATGATCTAAAGATGGA TGG (reversed) Intronic
902498875 1:16894705-16894727 ATATTTGATGTAAAAATGGATGG - Intronic
904465114 1:30702974-30702996 ATGGATGATGTATAGATGGATGG + Intergenic
905483865 1:38282008-38282030 ATGCATGATCTCAAGATGGAAGG - Intergenic
911815879 1:102350218-102350240 ATTTATGATCAAAAGAGGGAAGG - Intergenic
911857605 1:102900633-102900655 ATCTATTGTCTAAAATTGGAAGG + Intronic
912011334 1:104967572-104967594 ATCAATAATTTAAAGATAGATGG - Intergenic
912019700 1:105091890-105091912 ATCAATAATTTAAAGATGGATGG + Intergenic
914005730 1:143730893-143730915 ATATGTGATGTAAAAATGGATGG + Intergenic
914098196 1:144562139-144562161 ATATGTGATGTAAAAATGGATGG + Intergenic
914300786 1:146375479-146375501 ATATGTGATGTAAAAATGGATGG - Intergenic
914517911 1:148389915-148389937 ATATTTGATGTAAAAATGGATGG + Intergenic
918380361 1:183947669-183947691 ATCTAGTTTCTTAAGATGGATGG - Intronic
919863641 1:201761544-201761566 ATCTGAGATCTGAAGATGAATGG + Intronic
920790572 1:209086181-209086203 ATCTATAAAATAAAGATAGATGG - Intergenic
1064992448 10:21267674-21267696 ATTTATGATCTAAAACTGCATGG + Intergenic
1068199648 10:53766517-53766539 ATCTATGATCCACAGAAGAAAGG + Intergenic
1073393245 10:103196362-103196384 ATCTATTATATATAGATAGATGG + Intergenic
1075602812 10:123783073-123783095 TTATATGGTCTAAAAATGGAGGG + Intronic
1077865767 11:6220173-6220195 ATCTATTATCTATGGATGAAGGG + Intronic
1080328576 11:31108775-31108797 ACCAATGACCTAAAGATGAAGGG - Intronic
1086390324 11:86356890-86356912 ATATATGGTCTAAAAATGGGAGG + Intergenic
1086562230 11:88180998-88181020 ATCTATGATTCAAAGATAAAAGG + Intergenic
1087685738 11:101262534-101262556 AACTAGGATCTAAAGAAAGAAGG - Intergenic
1088564932 11:111161055-111161077 ATCTAAGTTATAAAGATGAAAGG - Intergenic
1088829492 11:113523411-113523433 ACCTATTATCTAAAGAAGTAGGG + Intergenic
1090125289 11:124077847-124077869 AGTTATGATCAAAAGATGTATGG - Intergenic
1091111904 11:132977430-132977452 ATCTATGAGCTAAATCTAGAGGG - Intronic
1092583084 12:9868490-9868512 ATCTATGATTTAGAGATTTAGGG - Intronic
1092853385 12:12650893-12650915 ATATATGATCTAAAAAGGGGAGG + Intergenic
1093282905 12:17217845-17217867 GTCTATGATCACAAGATGGTAGG - Intergenic
1094164988 12:27434810-27434832 ATGTTTGCTCTAGAGATGGAAGG + Intergenic
1094714133 12:32994786-32994808 ATCTTTGATCTAAAGAAAGAAGG - Intergenic
1098219157 12:68250342-68250364 AACTATTATCTAGACATGGAGGG - Intronic
1099145546 12:79039528-79039550 ATCTATGCTCTGAATATGGATGG - Intronic
1100055028 12:90498570-90498592 ATCTATAAATTAGAGATGGAAGG - Intergenic
1100418244 12:94401674-94401696 ATCTTTGAACTAAAGATTTATGG - Intronic
1100602364 12:96122810-96122832 ATCTCTGATCCTAAGAAGGAAGG - Intergenic
1107577452 13:41742240-41742262 ATGGATGTTCCAAAGATGGATGG + Intronic
1110394736 13:75016137-75016159 ATCTATCATCTAAAAATGATAGG - Intergenic
1111443881 13:88319759-88319781 ATATATGATCTAAGGATGAGTGG + Intergenic
1112722825 13:102264658-102264680 ATCTGGGAGCTAAAGATGGTGGG + Intronic
1113270999 13:108674369-108674391 ATCTAGGGTATAAAGATAGAAGG + Intronic
1114497974 14:23147089-23147111 ATCTATGATGGATGGATGGATGG - Intronic
1116382144 14:44282951-44282973 ATTTCAGATATAAAGATGGAAGG + Intergenic
1121811825 14:96898128-96898150 ATCTATGTTCTGAAAATGGCAGG - Intronic
1124686521 15:31787433-31787455 ATCAAAGAGTTAAAGATGGAGGG + Intronic
1128518927 15:68362603-68362625 ATGAATGATGTATAGATGGATGG + Intronic
1129696882 15:77745722-77745744 TTCTATGAAATAAAGATGGCTGG - Intronic
1131760415 15:95616629-95616651 ATCTATTATTACAAGATGGAAGG + Intergenic
1135192089 16:20362701-20362723 ATATATGATTAAAAGAAGGAGGG - Intronic
1135580517 16:23622082-23622104 ATGTATCTTCTAAAAATGGAGGG - Intronic
1136105827 16:28029730-28029752 ATGGATGAATTAAAGATGGATGG + Intronic
1139152060 16:64394599-64394621 ATCTGGGATCTAAAGATGCTAGG + Intergenic
1139408947 16:66743254-66743276 GTCTATGAAGTAAAGATTGAGGG + Intronic
1141403403 16:83770664-83770686 CTCTATGATCTAAAAAGGGGAGG - Intronic
1142734101 17:1883849-1883871 ATCTCTGATCTAAAGAGCGGCGG + Exonic
1143767906 17:9149692-9149714 ATCTATCAGCAAAAGAAGGAAGG - Intronic
1144599238 17:16598305-16598327 ATCTTTGCTGTAGAGATGGAGGG - Intergenic
1146389403 17:32407626-32407648 ATCAATAATATAAACATGGAGGG + Intergenic
1146489234 17:33268326-33268348 ATGGATGATGGAAAGATGGATGG - Intronic
1148683249 17:49486555-49486577 ATCTGTGATAGAAAGAGGGAGGG + Intergenic
1154218387 18:12431990-12432012 AACTTTGATTTAAAGATGGTGGG - Exonic
1158754270 18:60303347-60303369 AGCTAAGATCTAAATATAGATGG - Intergenic
1158806387 18:60978600-60978622 ATGTACGATCTCAAGATTGATGG - Intergenic
1165530363 19:36394729-36394751 ATCTAAGATCTCAAGATGAAAGG - Intronic
1167634154 19:50644210-50644232 ATCTATGATGTATTGATGGATGG + Intronic
1168330874 19:55567737-55567759 ATCAATGATGGATAGATGGATGG + Intergenic
929728560 2:44460103-44460125 ATCTATGTCCTGAACATGGAGGG - Intronic
930780001 2:55215389-55215411 AGCTATTATAAAAAGATGGAAGG - Intronic
932744967 2:74326356-74326378 ATCTATGATCTAAAGATGGATGG - Intronic
933031963 2:77339710-77339732 ATATATGAAGAAAAGATGGAAGG + Intronic
934691621 2:96365089-96365111 AACCGTGATCTAAAGATGGGGGG - Intronic
935784003 2:106532657-106532679 CTATATGGTCTAAAAATGGAAGG - Intergenic
938787183 2:134640780-134640802 TTCTATGATCTGAAGGTGCATGG - Intronic
939483832 2:142783292-142783314 ATCTATCAACTGAAGATTGATGG - Intergenic
939711426 2:145525169-145525191 ATATATAATATAAAAATGGATGG - Intergenic
940868766 2:158842291-158842313 ATCTATGGTCTGAAGAAAGAGGG + Intronic
942918183 2:181337876-181337898 ATCTTTGATCTCATGATAGAAGG + Intergenic
944661379 2:201924463-201924485 ATCTATGAAAGATAGATGGATGG + Intergenic
944891275 2:204119797-204119819 TTATATGATCTAAAAAGGGAAGG - Intergenic
945338940 2:208628260-208628282 GTCTATTATCTAAAGATCTAGGG + Intronic
946987868 2:225293162-225293184 CTTTATGACCTACAGATGGAAGG + Intergenic
948968874 2:241408071-241408093 AGGAATGATCTAAAGATGGCAGG + Intronic
1169565801 20:6852346-6852368 CTATATGATCTAAAAAGGGAAGG - Intergenic
1171494277 20:25544313-25544335 GTCTTTGGTCTAAAGATAGATGG - Intronic
1173197247 20:40925801-40925823 ATATATGATAGAAAGAAGGAAGG + Intergenic
1175754109 20:61518472-61518494 ATCAATGATGGAAGGATGGATGG - Intronic
1176645244 21:9343245-9343267 ACCTATGATGGAAAGATTGAAGG - Intergenic
1179385888 21:40941602-40941624 ATAAATGACCTTAAGATGGAAGG + Intergenic
1182965493 22:34517744-34517766 ATATATGGTCTAAAAAGGGAAGG + Intergenic
949987300 3:9551432-9551454 ATCTCTGATCGAAAGGTGGGTGG + Intronic
950954565 3:17037749-17037771 ATCTGTGTTCTTAAGATGAAGGG + Intronic
951804453 3:26629275-26629297 ATCAATGACCTAAAATTGGAAGG - Intronic
952294454 3:32049026-32049048 CTATATGGTCTAAAGAGGGAAGG + Intronic
952971534 3:38653848-38653870 ATCTGTGAGCTCTAGATGGAGGG + Intergenic
956686394 3:71832459-71832481 ATCTATGTTGTGAAGATGCAGGG - Intergenic
957841089 3:85670683-85670705 ATGTATGATCTGAAGTTGTATGG + Intronic
957910095 3:86608933-86608955 GTCCATGACCTAAAGATGTATGG - Intergenic
958528810 3:95297029-95297051 ATCTATGATGTCAAGATTTAAGG + Intergenic
959786488 3:110304844-110304866 ATATAGGAAGTAAAGATGGAAGG - Intergenic
960006318 3:112784551-112784573 ATCTAAGATCTAAAGCAGGATGG + Intronic
962119981 3:132551201-132551223 AGCCATGATGTAAGGATGGAGGG - Intergenic
964337496 3:155671512-155671534 ATCTATGATCAAAACATAGGAGG + Intronic
965164970 3:165186344-165186366 ATTTATTATCTTAAGATGTATGG + Intergenic
965196944 3:165611454-165611476 ATCTATGTTTAAAAGATAGATGG - Intergenic
965473384 3:169123248-169123270 ATCTAGGATGGACAGATGGATGG + Intronic
966496582 3:180588442-180588464 TTTTATGATTTAAAGATGTAGGG - Intergenic
968172714 3:196523340-196523362 ATCGATAACCTAAAGATGCAGGG + Intergenic
1202741646 3_GL000221v1_random:61823-61845 ACCTATGATGGAAAGATTGAAGG + Intergenic
970851600 4:20610280-20610302 ATCAATCATTGAAAGATGGATGG + Intronic
970955664 4:21808204-21808226 AACTATGATCTAAGGAAGAAGGG - Intronic
972279368 4:37587537-37587559 ACCTATGATTGAAAGAAGGAAGG + Intronic
972525075 4:39901720-39901742 AATTCTGATCTGAAGATGGAAGG - Intronic
974422077 4:61689575-61689597 TTCTATACTCTAGAGATGGAAGG + Intronic
977078083 4:92484087-92484109 ATCTATGGTGGAAGGATGGAGGG + Intronic
977500898 4:97835290-97835312 CTATATGGTCTAAAAATGGAAGG + Intronic
979874854 4:125875406-125875428 AGCTATCATCTAAGGATGGTGGG - Intergenic
981186792 4:141813382-141813404 ATATATTATCTAAAGATGCTTGG + Intergenic
982079996 4:151779987-151780009 TTCTATCTTCTAAAAATGGAAGG + Intergenic
983132665 4:164041805-164041827 AGCATTGATCTAAAGATGCATGG + Intronic
983977042 4:173947785-173947807 ATCTAAGATGTAAAGCTGCAAGG - Intergenic
984347461 4:178547749-178547771 ATCTAACATGGAAAGATGGATGG + Intergenic
986363563 5:7006276-7006298 ATTTATAAGGTAAAGATGGAGGG + Intergenic
987505714 5:18768718-18768740 TTCACAGATCTAAAGATGGAGGG + Intergenic
993600231 5:89913923-89913945 ATTTATGATATAAAAATGGATGG - Intergenic
995988902 5:118211679-118211701 ATATTAGATCTAAAGATTGAAGG - Intergenic
996533204 5:124548065-124548087 ATCTGTGATGTAATGATGCATGG + Intergenic
998942437 5:147299212-147299234 CTATATGATCTAAAAAGGGAAGG - Intronic
1001189517 5:169615388-169615410 ATCTATCAATTAATGATGGAGGG - Intergenic
1001751457 5:174134641-174134663 ATGTATGATGAATAGATGGATGG - Intronic
1006585837 6:35111264-35111286 ATCAAAGATCTTGAGATGGAGGG + Intergenic
1008421698 6:51308455-51308477 ATATATAATATAAAGAGGGAAGG + Intergenic
1009301000 6:62020518-62020540 ATCTATAATTTACTGATGGAGGG + Intronic
1011797800 6:90976476-90976498 ATCTCACATCCAAAGATGGAAGG + Intergenic
1016048633 6:139506382-139506404 TGATATGATCTAAAGGTGGAAGG - Intergenic
1016430439 6:143978879-143978901 ATCTATTATCTATTGAAGGAAGG + Intronic
1018894856 6:168007089-168007111 ATGTGTCATCCAAAGATGGATGG - Intronic
1021073924 7:16277099-16277121 ATCTATGTTCTAAAGTTGCTGGG - Intronic
1021593562 7:22290973-22290995 ATCTATGATCTCATGAAGGGAGG + Intronic
1027657224 7:80945469-80945491 ATTTATGATATGAGGATGGAAGG + Intergenic
1029582467 7:101446419-101446441 AGCTGTGATCTAAACGTGGATGG - Intronic
1029976696 7:104841706-104841728 AGCTATGATATAAAACTGGACGG + Intronic
1030109724 7:106016633-106016655 ATCCATGATCTAAAGATGAACGG - Intronic
1030329068 7:108253749-108253771 ATCAATTATGTACAGATGGATGG + Intronic
1033145121 7:138864531-138864553 ATCTATAGTCTAAATATAGATGG - Intronic
1033615171 7:143007446-143007468 AACTATGATCTTAAGAAGAAAGG - Intergenic
1036614979 8:10381036-10381058 ATAAATGATGGAAAGATGGATGG + Intronic
1038300303 8:26339680-26339702 AACTCTGATCTACAAATGGAAGG - Intronic
1038363743 8:26909607-26909629 ATTTACCATCTCAAGATGGAAGG - Intergenic
1038630375 8:29237153-29237175 ATTTCTGTTTTAAAGATGGAGGG - Intronic
1039323763 8:36462727-36462749 ATCAGTGAATTAAAGATGGATGG + Intergenic
1039934677 8:42031586-42031608 ATCTATGAAATAAATATTGAAGG + Intronic
1040603734 8:48909837-48909859 ATCTAATCTCTGAAGATGGAGGG + Intergenic
1041269390 8:56096296-56096318 AACTATGATGGAAAGATGGAGGG - Intergenic
1042159105 8:65874128-65874150 CTCTATGGTCTAAAAAGGGAAGG + Intergenic
1045180898 8:99781117-99781139 ACTTATGACCTAAAGGTGGAAGG - Intronic
1045335480 8:101199732-101199754 ATCTCTGATCAAAGAATGGAAGG - Intronic
1047074906 8:121390188-121390210 AACTATCATCTTAAGATGCAGGG - Intergenic
1047228615 8:122977149-122977171 AGTTCTGATCTAGAGATGGAAGG - Intergenic
1048119721 8:131565637-131565659 ATCTATGAGATAAAGAAGGTGGG - Intergenic
1050291969 9:4164666-4164688 ATGTATGATCTAAAATTAGATGG + Intronic
1054962630 9:70985745-70985767 ATCTATGATTTAACAAGGGAAGG + Intronic
1055419047 9:76117187-76117209 ATCTATGAACAAAACATGCATGG + Intronic
1056240706 9:84643854-84643876 ATCTGTGATCTACAAATGGGAGG + Intergenic
1056696925 9:88866045-88866067 AACTATTATCTGAATATGGAAGG - Intergenic
1058499450 9:105595825-105595847 ATCTATAAGCTATAGATGGGAGG - Intronic
1058994781 9:110288914-110288936 GGCTAGGATCTAAAGATAGAGGG - Intergenic
1203710280 Un_KI270742v1:91747-91769 ACCTATGATGGAAAGATTGAAGG + Intergenic
1185613110 X:1403687-1403709 AGATTTGATCGAAAGATGGATGG + Intronic
1185971006 X:4663677-4663699 ATCTATGATCTAAAGGTGAATGG - Intergenic
1186144207 X:6608879-6608901 ATGTGTGATCTCAGGATGGAAGG + Intergenic
1187796926 X:23013965-23013987 ATCTATAATGAAAAGATGAAAGG + Intergenic
1191862476 X:65677223-65677245 ATCTATGGTATAGAGTTGGAGGG + Intronic
1192571558 X:72210459-72210481 ATCTATGTTCTAGAGCTTGAAGG + Intronic
1197453819 X:126652096-126652118 ATCTATCCTCTAAAGTTGGGAGG + Intergenic
1200454832 Y:3376967-3376989 AGCTATGTTATAAAGAAGGAAGG - Intergenic