ID: 932746861

View in Genome Browser
Species Human (GRCh38)
Location 2:74341002-74341024
Sequence CCACCGAATAAATGTAAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 104}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932746857_932746861 13 Left 932746857 2:74340966-74340988 CCTAAATTCCATTCAGGGGCAAA 0: 1
1: 0
2: 0
3: 30
4: 240
Right 932746861 2:74341002-74341024 CCACCGAATAAATGTAAAAGAGG 0: 1
1: 0
2: 1
3: 14
4: 104
932746858_932746861 5 Left 932746858 2:74340974-74340996 CCATTCAGGGGCAAAGCAAGAGC 0: 1
1: 0
2: 1
3: 7
4: 183
Right 932746861 2:74341002-74341024 CCACCGAATAAATGTAAAAGAGG 0: 1
1: 0
2: 1
3: 14
4: 104
932746853_932746861 25 Left 932746853 2:74340954-74340976 CCTTGTGACTTGCCTAAATTCCA 0: 1
1: 0
2: 0
3: 15
4: 192
Right 932746861 2:74341002-74341024 CCACCGAATAAATGTAAAAGAGG 0: 1
1: 0
2: 1
3: 14
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932746861 Original CRISPR CCACCGAATAAATGTAAAAG AGG Intronic
908983667 1:69989691-69989713 GAACAGAATAAATGGAAAAGAGG + Intronic
911562698 1:99425798-99425820 CCTCCCAAAAAATGTAACAGTGG + Intergenic
912647524 1:111408350-111408372 CCAGTTAATAAATGTAAAAGTGG - Intergenic
916439338 1:164807482-164807504 ACACCAAATAAATATAAAATGGG - Intronic
916814162 1:168335074-168335096 CCTAAGAATAAATGTACAAGTGG + Intergenic
917544711 1:175951822-175951844 CAACCTAATAAATGTATAATTGG + Intronic
919966700 1:202534019-202534041 CCTACTAATAAATGTAGAAGGGG - Intronic
920760798 1:208782053-208782075 CCACTGAATAGAAGTGAAAGGGG + Intergenic
924594073 1:245430088-245430110 ACAGTGAATAAAAGTAAAAGGGG + Intronic
1065664248 10:28040940-28040962 CCACTGAATAAAGGGATAAGAGG - Intergenic
1065808141 10:29414080-29414102 CCACAGAATCAAAGTAAAACAGG - Intergenic
1066053011 10:31653625-31653647 CCACTGAAAAAATGGCAAAGAGG + Intergenic
1068342666 10:55728285-55728307 CAACTGAATAAAAGTAAAACTGG - Intergenic
1068692978 10:59936812-59936834 CCAACTAATAAATGTAGAAGAGG + Intergenic
1074332932 10:112537510-112537532 CCATCAGATAAATATAAAAGAGG + Intronic
1074912184 10:117921491-117921513 ACACCGGATACATCTAAAAGTGG - Intergenic
1079927996 11:26520358-26520380 CCAAGGAAAAAATGAAAAAGGGG + Intronic
1080085923 11:28281910-28281932 CCACTGAATAAATTTTAAAAGGG + Intronic
1097487948 12:60229796-60229818 TTACCAAATAAATGTAATAGAGG + Intergenic
1098162760 12:67661988-67662010 CCACCCATTAAGTTTAAAAGTGG - Exonic
1099972059 12:89510661-89510683 CAACCTAATAATTGTAAAACTGG - Intronic
1104588332 12:130064849-130064871 CCAGGGAATAAATGCAGAAGTGG + Intergenic
1109163288 13:59002890-59002912 ACACCGATTAAATGTAAACTTGG + Intergenic
1109591234 13:64485777-64485799 CTTCCAAATAAATGTAAAACTGG + Intergenic
1110153289 13:72281915-72281937 CCAAAGCATAAATGTAAAAGTGG + Intergenic
1110588635 13:77226479-77226501 ACACAGAATAAATGTAAATCTGG + Intronic
1111549765 13:89791650-89791672 ACACAAAATAAATGCAAAAGAGG + Intergenic
1113486637 13:110657635-110657657 CCAACTAATAAATGTAAAAGAGG + Intronic
1115010937 14:28543883-28543905 GCACAAAATAAATGTAAAAGTGG - Intergenic
1116516263 14:45810245-45810267 TCACAGGATAAATGTAAAACTGG + Intergenic
1122253319 14:100456762-100456784 TCACCCAATATATGTGAAAGTGG + Intronic
1124321885 15:28719240-28719262 CCTCTGAATAAATTGAAAAGAGG - Intronic
1125399443 15:39284782-39284804 TCACCAAATAAAGATAAAAGAGG + Intergenic
1126342265 15:47654156-47654178 CCACTGAATTAAACTAAAAGAGG - Intronic
1130311052 15:82754763-82754785 CCACTGAAGTAATCTAAAAGAGG + Intergenic
1131749253 15:95488918-95488940 CCACTGCAGAAATGGAAAAGGGG - Intergenic
1132298170 15:100759614-100759636 CCCCAGAAAAAATGTAAAAGAGG - Intergenic
1134364469 16:13564002-13564024 TCACCGAAAAAATGTAAAAATGG - Intergenic
1136467352 16:30454096-30454118 CCTCAGAATAAAGGCAAAAGGGG - Intergenic
1143832861 17:9666287-9666309 CCACCCAATAAATATACGAGAGG + Intronic
1153747178 18:8191446-8191468 CCAGCTAATAAATGTGGAAGAGG + Intronic
1154982791 18:21517675-21517697 CCACCAAAAAAATGGCAAAGAGG - Intronic
1157100538 18:44725109-44725131 CCATCAGATAAATGTAAAAGGGG + Intronic
1162171727 19:8795061-8795083 TCACTGAACAAATGGAAAAGGGG + Intergenic
1162672886 19:12272894-12272916 CAACCCTATAAATGTAAATGTGG - Exonic
932746861 2:74341002-74341024 CCACCGAATAAATGTAAAAGAGG + Intronic
933411570 2:81931799-81931821 CTCCAGAATAAATGTAAAAGTGG + Intergenic
933583423 2:84152970-84152992 CCAGCAAATAAATGTGAAAGTGG - Intergenic
934220917 2:90081945-90081967 TCACTGATAAAATGTAAAAGCGG + Intergenic
934233555 2:90209184-90209206 TCACTGATAAAATGTAAAAGAGG + Intergenic
937423812 2:121780518-121780540 CCACCAGCTATATGTAAAAGTGG + Intergenic
938703717 2:133901462-133901484 CCATCAAATAAATGTAACAGAGG - Intergenic
943780441 2:191817528-191817550 CCACTCATTAAATGAAAAAGTGG - Intergenic
944253909 2:197605177-197605199 CAAAAGAATAAATGTAAAGGGGG - Intronic
947332187 2:229041480-229041502 CAAACTAATAAAGGTAAAAGAGG + Intronic
947637356 2:231686796-231686818 GCACTGAATAAATGTCACAGTGG + Intergenic
948460081 2:238125015-238125037 CCACCCAATAGAGGTGAAAGTGG + Intronic
1168973666 20:1948030-1948052 CAAGACAATAAATGTAAAAGTGG + Intergenic
1170159916 20:13300396-13300418 CCAATAAATAAATATAAAAGGGG + Exonic
1170262440 20:14425119-14425141 CCAAAGAGTAAATGAAAAAGAGG - Intronic
1179306672 21:40159943-40159965 TCTCCCAATAAATGTAAATGTGG - Intronic
1181134515 22:20755145-20755167 CTACCGAATAAATAAAAAATGGG - Intronic
1182849959 22:33465223-33465245 CCACTGTATAAAGCTAAAAGAGG + Intronic
949618655 3:5785241-5785263 CCACCTTATAAAGGTATAAGAGG - Intergenic
950375133 3:12565273-12565295 CAACCAAATAAATACAAAAGAGG - Intronic
952044928 3:29306980-29307002 CTAACGAATAAATTTAAATGTGG - Intronic
954535121 3:51354227-51354249 CCACCAAATAATTTTAAATGGGG - Intronic
954982134 3:54755761-54755783 CCACAGAATAAAGGAAAAAATGG - Intronic
957903052 3:86522052-86522074 TCACTGATTAAATATAAAAGGGG + Intergenic
959591534 3:108087342-108087364 CCCCCTAATGAATTTAAAAGTGG + Intronic
965775027 3:172220010-172220032 CAACCTAATACAAGTAAAAGTGG + Intronic
968723768 4:2228966-2228988 GCACTGAATGAGTGTAAAAGGGG + Exonic
969946597 4:10789652-10789674 CCACCTACTAAAAGAAAAAGAGG - Intergenic
970139745 4:12968914-12968936 CCAAAGAAGAAATGTGAAAGGGG + Intergenic
970408948 4:15789432-15789454 GCACCGAGTACATTTAAAAGTGG + Intronic
971223561 4:24731071-24731093 CCACTGACTAAATGCAACAGCGG + Intergenic
974815042 4:66993495-66993517 TTACCGTAGAAATGTAAAAGGGG + Intergenic
982689707 4:158534129-158534151 CCCCAGAATAAATTTAAAAGTGG - Intronic
988308144 5:29520959-29520981 CTACCCAATAAATATAACAGTGG - Intergenic
989283430 5:39671173-39671195 TCACCAAATAAATATAAAACAGG - Intergenic
989754068 5:44930921-44930943 CCAGGGAATAAATGTAAAGGAGG - Intergenic
993649185 5:90497685-90497707 CCAAGAAATAAATGTAAAAAAGG + Exonic
994314437 5:98316172-98316194 TTACAGAAGAAATGTAAAAGGGG - Intergenic
996309099 5:122082827-122082849 CCACCTAAGGAATGGAAAAGTGG + Intergenic
997556076 5:134799950-134799972 CCATCTAAAAAAAGTAAAAGTGG - Intronic
997789760 5:136747913-136747935 CCACAGAATAAAAATAGAAGAGG + Intergenic
999541445 5:152577706-152577728 CTACAGGATAAATGGAAAAGTGG + Intergenic
1001935200 5:175698759-175698781 TCATGGAAAAAATGTAAAAGGGG + Intergenic
1002670081 5:180859972-180859994 CCCCCGAATAGATCTAAAAAAGG + Intronic
1004030884 6:11868373-11868395 ACTCCTAATAAAGGTAAAAGGGG + Intergenic
1012617627 6:101296477-101296499 CAGCCGACCAAATGTAAAAGTGG - Intergenic
1015005900 6:128281418-128281440 CCTCCAAATGAATGTGAAAGGGG + Intronic
1018164481 6:161080273-161080295 CCACGGGATAAATCTAAAGGAGG + Intronic
1018814655 6:167321729-167321751 CTACAGAAAAAATGTAAAATCGG + Intergenic
1020471815 7:8546104-8546126 CCACAAAATATATGAAAAAGAGG - Intronic
1021232418 7:18101976-18101998 CTCCTGAATAAATATAAAAGAGG - Intronic
1023636198 7:42213375-42213397 CCATGGAATAAATGTAGAAAAGG - Intronic
1023962428 7:44937987-44938009 CCTCTGAATAAGTATAAAAGTGG + Intergenic
1026682995 7:72483723-72483745 CAACCGAATAAATGTGTAATTGG - Intergenic
1028960110 7:96739082-96739104 CCAACAAATAAATTTAAAATGGG - Intergenic
1030450790 7:109708476-109708498 CCACTGAATTAATTTTAAAGAGG + Intergenic
1031333892 7:120502062-120502084 CCACTGAATAAATTTTAAAGAGG - Intronic
1032900156 7:136297921-136297943 CAAACATATAAATGTAAAAGTGG - Intergenic
1037266840 8:17072711-17072733 CCACTGAATATATGTAAAGGAGG + Intronic
1037457288 8:19076014-19076036 CAACCTAATAAATGAAAAAAAGG + Intronic
1037856767 8:22377069-22377091 CCAATAAATAAATGTACAAGAGG - Intronic
1041167934 8:55109402-55109424 CCAACGAATAGATTTTAAAGTGG - Intronic
1044860332 8:96516810-96516832 CCAACTAACAAATGGAAAAGGGG - Intronic
1055320926 9:75082840-75082862 CCACAAAATAAATGGGAAAGTGG + Intronic
1055544110 9:77349108-77349130 CTACAGAAAAAATGTGAAAGAGG + Intronic
1056469531 9:86892340-86892362 CCACTGAATAGATGTGAGAGTGG - Intergenic
1056912169 9:90711506-90711528 ACACTGAATACATGTAAAATTGG + Intergenic
1059080756 9:111246750-111246772 GCAGCTAATAACTGTAAAAGGGG + Intergenic
1188338379 X:28967786-28967808 TCACTGAATGAATGTTAAAGTGG + Intronic
1189052837 X:37664569-37664591 CCTCTGAATCAAAGTAAAAGTGG - Intronic
1191254019 X:58272094-58272116 CCACCGAAAAAACCTCAAAGTGG - Intergenic
1193316694 X:80073177-80073199 CCACCAAACAAATGGAAAACAGG - Intergenic
1194789873 X:98134537-98134559 CCTCTGAATAAATGTTAATGGGG - Intergenic
1202302317 Y:23429787-23429809 CCTACTAATAAATGTAGAAGGGG - Intergenic
1202568494 Y:26240811-26240833 CCTACTAATAAATGTAGAAGGGG + Intergenic