ID: 932747328

View in Genome Browser
Species Human (GRCh38)
Location 2:74344715-74344737
Sequence TTAGGGAATTTCCAGCTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 133}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932747314_932747328 30 Left 932747314 2:74344662-74344684 CCCCTTAGTCCCAGGAAGATCAG 0: 1
1: 1
2: 2
3: 22
4: 202
Right 932747328 2:74344715-74344737 TTAGGGAATTTCCAGCTGGTTGG 0: 1
1: 0
2: 2
3: 7
4: 133
932747323_932747328 -4 Left 932747323 2:74344696-74344718 CCAGAAACAGTTTCGGGCCTTAG 0: 1
1: 0
2: 0
3: 6
4: 54
Right 932747328 2:74344715-74344737 TTAGGGAATTTCCAGCTGGTTGG 0: 1
1: 0
2: 2
3: 7
4: 133
932747318_932747328 20 Left 932747318 2:74344672-74344694 CCAGGAAGATCAGCACAGCCTAG 0: 1
1: 0
2: 1
3: 20
4: 178
Right 932747328 2:74344715-74344737 TTAGGGAATTTCCAGCTGGTTGG 0: 1
1: 0
2: 2
3: 7
4: 133
932747321_932747328 2 Left 932747321 2:74344690-74344712 CCTAGGCCAGAAACAGTTTCGGG 0: 1
1: 0
2: 1
3: 4
4: 97
Right 932747328 2:74344715-74344737 TTAGGGAATTTCCAGCTGGTTGG 0: 1
1: 0
2: 2
3: 7
4: 133
932747317_932747328 21 Left 932747317 2:74344671-74344693 CCCAGGAAGATCAGCACAGCCTA 0: 1
1: 0
2: 0
3: 18
4: 197
Right 932747328 2:74344715-74344737 TTAGGGAATTTCCAGCTGGTTGG 0: 1
1: 0
2: 2
3: 7
4: 133
932747316_932747328 28 Left 932747316 2:74344664-74344686 CCTTAGTCCCAGGAAGATCAGCA 0: 1
1: 0
2: 2
3: 20
4: 254
Right 932747328 2:74344715-74344737 TTAGGGAATTTCCAGCTGGTTGG 0: 1
1: 0
2: 2
3: 7
4: 133
932747315_932747328 29 Left 932747315 2:74344663-74344685 CCCTTAGTCCCAGGAAGATCAGC 0: 1
1: 0
2: 4
3: 12
4: 232
Right 932747328 2:74344715-74344737 TTAGGGAATTTCCAGCTGGTTGG 0: 1
1: 0
2: 2
3: 7
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932747328 Original CRISPR TTAGGGAATTTCCAGCTGGT TGG Intronic
900349861 1:2229230-2229252 TTTGAGGATCTCCAGCTGGTCGG - Exonic
900687300 1:3956928-3956950 TCAGGGAAATCCCAGCTGGAGGG + Intergenic
900739847 1:4324129-4324151 TCAGGATATTTCCAGCTAGTGGG + Intergenic
900854278 1:5168233-5168255 TAAAGGAAATTCCAGCTGGGGGG + Intergenic
903374407 1:22856784-22856806 TTAGGTACTTTCCAGGTGGCAGG - Intronic
906210001 1:44007441-44007463 ACAGGGAATTTCCAACTGGTGGG + Intronic
906708522 1:47912520-47912542 TTTGGGAAATCCCAGGTGGTGGG - Intronic
907250045 1:53132067-53132089 TTAGGGAACTTGAGGCTGGTGGG + Intronic
912855231 1:113162797-113162819 TGAGGGAATTTGTTGCTGGTTGG - Intergenic
920058563 1:203211900-203211922 TCATGGTGTTTCCAGCTGGTGGG - Intergenic
923080700 1:230651575-230651597 TTAGTCAACTTCCAGCTGTTTGG + Intronic
1063717158 10:8539550-8539572 GTAGGTAGTTTACAGCTGGTAGG + Intergenic
1064509356 10:16072523-16072545 TTATGTAATTTCCAGGTAGTTGG + Intergenic
1070577080 10:77687386-77687408 CTAGGGACTTTTGAGCTGGTGGG - Intergenic
1070751796 10:78968250-78968272 TTAGGGACACTCCAGCTGCTGGG - Intergenic
1073899815 10:108206757-108206779 TTAAGGAATATCCAGATAGTTGG - Intergenic
1074394443 10:113085991-113086013 TTGGGGCAATTCCAGCAGGTGGG + Intronic
1075553669 10:123413183-123413205 TGAGGGCATTTCCAGCTTCTAGG - Intergenic
1079391203 11:20023516-20023538 TTCCGGACTTTTCAGCTGGTGGG + Intronic
1088224509 11:107604878-107604900 TTGGGGCATTTCCAGCAGCTTGG - Intronic
1090642764 11:128743526-128743548 TCAGGGCATGTCCACCTGGTAGG + Intronic
1092564526 12:9650223-9650245 TGAGGGAATTTCGAGTGGGTGGG - Intergenic
1093194128 12:16110153-16110175 TTACGGAACTTACATCTGGTTGG + Intergenic
1093616237 12:21228882-21228904 GTTGGTCATTTCCAGCTGGTTGG - Intronic
1095160361 12:38906874-38906896 GCACGGAGTTTCCAGCTGGTTGG + Intronic
1095556448 12:43511400-43511422 TTAGGGAATTTATAGCTTGGTGG - Intronic
1098425634 12:70363367-70363389 GAAGGGAATTTACAGCAGGTGGG - Intergenic
1100022199 12:90083280-90083302 TTAAGGAACTTACAGCTGTTTGG - Intergenic
1102536784 12:113587779-113587801 TTTGGGCATTCCCAGCAGGTGGG + Intergenic
1103203926 12:119113269-119113291 TTGGGTAATTTCCAGATGATTGG + Intronic
1105886024 13:24642303-24642325 TTAGAGAATTTCCACTTGTTGGG - Intergenic
1112659896 13:101496012-101496034 TTGTGGAATTTGAAGCTGGTGGG - Intronic
1113171339 13:107507221-107507243 TTAGGGATTTTCTAGTTGGCAGG + Intronic
1113389131 13:109879004-109879026 TATGGGAATTTGCAGCTGGTGGG + Intergenic
1113436680 13:110297768-110297790 TTAGGAAATATGCAGGTGGTTGG - Intronic
1115807469 14:37067681-37067703 TCAGGGAATTGCCAGCAGCTTGG + Intronic
1118489543 14:66245676-66245698 TTAGGGTTTTCCCAGCTGTTAGG - Intergenic
1118807832 14:69253074-69253096 TTATGGAGTTTCCTCCTGGTAGG - Intergenic
1120811389 14:88807417-88807439 TCAAGGAACTTACAGCTGGTGGG - Intergenic
1120910508 14:89662461-89662483 TTAGGAAGTTGCCAGTTGGTGGG - Intergenic
1122229436 14:100298280-100298302 TTGGGGAATTTCCAGCTGGAGGG + Intronic
1122305370 14:100762751-100762773 TTAGGGAATTTGCACCTTGGAGG + Intergenic
1202904595 14_GL000194v1_random:60869-60891 TTTGGGAGTTTGCAGCTGGCAGG - Intergenic
1125708101 15:41759858-41759880 TTTGGGAATTTCTAGCAGATAGG + Intronic
1125902481 15:43361598-43361620 ATATGGATTTTCCACCTGGTGGG + Exonic
1128304529 15:66589265-66589287 TAAGGGCATTTCCTGCTGGCTGG - Intronic
1129655331 15:77520510-77520532 TTTGGGTATTTCCAGCTTTTTGG - Intergenic
1129942938 15:79513966-79513988 ATATGGAACTTCCAGCTGGTAGG - Intergenic
1129988383 15:79939209-79939231 ATAGGAAGTTTCAAGCTGGTAGG - Intergenic
1131360113 15:91783320-91783342 CCAGAGAATTTCTAGCTGGTTGG - Intergenic
1131664237 15:94553200-94553222 TTCTGGAATTTCCAGATAGTGGG + Intergenic
1133847275 16:9467000-9467022 TTAGGGCATTACCTGCTGCTGGG - Intergenic
1135388231 16:22064093-22064115 TTAGAGAATTTAGAGCTGGCAGG - Intronic
1136051456 16:27653531-27653553 TTAGGGCAGTTCCTGCTGTTTGG + Intronic
1137341062 16:47605939-47605961 TTAGGCAACTTCCTGGTGGTTGG - Intronic
1138771846 16:59674845-59674867 TGAGGGAATTTTCTCCTGGTTGG + Intergenic
1141209051 16:81959156-81959178 TGAGTGAATTTACAGCTGATGGG + Exonic
1142786007 17:2223260-2223282 GCAGGGAATTTCCAACTGCTGGG - Intronic
1149419957 17:56500702-56500724 TTAGGGAATTGCAAGCAGTTTGG + Intronic
1149952762 17:61008359-61008381 GAAGGGAATTTCCTGCAGGTGGG - Intronic
1157332845 18:46716155-46716177 TTAGGTCACTTCCAGGTGGTGGG - Intronic
1157427068 18:47593259-47593281 TCAGGGTAGATCCAGCTGGTGGG + Intergenic
1165725645 19:38110763-38110785 TTGGGGGATTTGCAGCTGGTAGG - Intronic
1168419829 19:56194255-56194277 TTATGAAATTTCCAGGTAGTGGG + Intronic
926508606 2:13745553-13745575 TTAGGAAAGTTCCAACTGGGCGG + Intergenic
931624276 2:64242810-64242832 TTAGGAAACTTACAGGTGGTGGG + Intergenic
931808638 2:65832493-65832515 GTAGGGAATTTCCACATGATTGG - Intergenic
932747328 2:74344715-74344737 TTAGGGAATTTCCAGCTGGTTGG + Intronic
934502046 2:94869526-94869548 TTTGGGAGTTTGCAGCTGGCAGG + Intergenic
937839980 2:126515111-126515133 TTTTGGAATTTGTAGCTGGTGGG - Intergenic
938979713 2:136514557-136514579 TGAGGGTTTTTCCAGCTGGAGGG + Intergenic
939320650 2:140615840-140615862 TTAAGGAATTTACAGATAGTTGG - Intronic
941478159 2:165972817-165972839 TTTGGGAATTTCCAGCATTTTGG - Intergenic
945358058 2:208861899-208861921 TAAGTGAATTTCCAGCTGAGAGG - Intergenic
946586090 2:221189440-221189462 TTAGGGGCTTTCCAGCTGCCAGG + Intergenic
947903603 2:233743463-233743485 TCAGTGAATTTCCAGCTTTTGGG - Intronic
948594886 2:239073551-239073573 TTTGGGCAACTCCAGCTGGTGGG - Intronic
1168874071 20:1158435-1158457 TTGGGAATTTTCCAGCTGGTTGG - Intronic
1169752553 20:9009387-9009409 TTTGGGAATTGTCAGCTGATAGG - Intergenic
1170125857 20:12963469-12963491 TGTGGGAATTTCCATTTGGTGGG - Intergenic
1176623965 21:9075636-9075658 TTTGGGAGTTTGCAGCTGGCAGG - Intergenic
1181999210 22:26906425-26906447 TTAGGTACTTTTCTGCTGGTGGG + Intergenic
1182909587 22:33971028-33971050 TTAGGGAATTTCTTGCTGTGAGG + Intergenic
1184379819 22:44138277-44138299 TAAGGGAATTTCCAGGAGGAGGG + Intronic
1185120769 22:48968630-48968652 TTTGGGAATGTCCAGGTGGCAGG - Intergenic
949189093 3:1230059-1230081 TTAGGAACTTTCCATTTGGTTGG - Intronic
951619601 3:24586816-24586838 TTGGGAAATTTCCACCTGGGGGG + Intergenic
952479848 3:33750009-33750031 CTAGGGAATTCCCAGCTCATAGG - Intergenic
952581891 3:34843770-34843792 TTAGCGGATTTCCAGCTGGTGGG - Intergenic
953119016 3:40021247-40021269 TAAGGGAATTTCCAGTTAGGAGG + Intronic
953528846 3:43719920-43719942 TTAGGGAATTTGTAGTTGTTAGG + Intronic
954339194 3:49939692-49939714 TTAAGCCATCTCCAGCTGGTTGG - Intergenic
954698401 3:52439555-52439577 TTACTGAATTTGCAGCTGGCAGG - Intronic
954952972 3:54491239-54491261 TTAGGGAGTTTGCAGCCAGTTGG + Intronic
959940918 3:112080065-112080087 TTAGGAAAATTCCAACTAGTAGG - Intronic
961040858 3:123677055-123677077 TTAGGGGAGTCCCAGCTGGAGGG - Intronic
961056161 3:123790428-123790450 TTAGGGCTTTTCCACCTTGTGGG - Intronic
963737991 3:149042850-149042872 TTGGGTTATTTCCTGCTGGTCGG + Intronic
967024944 3:185556535-185556557 TTAACGATTTTCCTGCTGGTGGG + Intergenic
969453331 4:7287182-7287204 TCTGGGATTTTCCAGTTGGTCGG - Intronic
969572936 4:8020635-8020657 TTGGCGAATTTGCAGTTGGTTGG - Intronic
972727523 4:41758201-41758223 TTAGGGGGTTTTCAGCAGGTAGG - Intergenic
974348688 4:60716074-60716096 ATAGGGAATATAAAGCTGGTTGG + Intergenic
975384629 4:73741745-73741767 TTAGGAAAGTTCCAGGTGTTAGG + Intronic
978653486 4:111037938-111037960 TTGGGGAATATCCACCTGGCAGG + Intergenic
980022146 4:127722817-127722839 TTAGGCAGTTTCTAGCTGGTGGG + Exonic
986097857 5:4577753-4577775 GTAGGGAACTATCAGCTGGTAGG - Intergenic
986333257 5:6733595-6733617 CCAGGGAATTTACAGCTGGCAGG - Intronic
987987455 5:25165788-25165810 TTAGGGAATTTGGTGCTTGTTGG + Intergenic
988221863 5:28356777-28356799 TTAGTTGATTCCCAGCTGGTAGG + Intergenic
989689193 5:44120114-44120136 CTATGGAATTTGCAACTGGTGGG - Intergenic
992697069 5:79300112-79300134 TTAAAAAATTTCTAGCTGGTGGG - Intronic
997809516 5:136953806-136953828 TTAAGGAAGTTCCAACTGGGCGG - Intergenic
999342743 5:150786918-150786940 TTAAGGAATCTCCAGGTGCTTGG - Intronic
999461355 5:151759709-151759731 TTAGGGAATTCCTGGCAGGTTGG - Intronic
1000522144 5:162308538-162308560 TAGGGGAATTTCAAGCAGGTTGG - Intergenic
1003254461 6:4462254-4462276 TCAGAGAATTTCCAGATGATTGG + Intergenic
1007135483 6:39517225-39517247 TTAGGCAATTTCAAGCTGAGGGG + Intronic
1010712374 6:79190279-79190301 TTAATGAATATCCAGCTAGTTGG + Intergenic
1012325750 6:97914778-97914800 TCATGGATTTTCCAGCTAGTTGG - Intergenic
1020437313 7:8178726-8178748 TAAGGTAATTTCCAGCAGGAAGG - Intronic
1023007338 7:35886327-35886349 TTAGGGATTTCTCACCTGGTAGG - Intronic
1023254848 7:38302672-38302694 TTAGGGAATTTTCACCTCATGGG - Intergenic
1027517554 7:79161422-79161444 CTAGAGAATTTCCACTTGGTGGG + Intronic
1034327843 7:150253605-150253627 TTTGGTAATTTCCAGCTACTTGG - Intronic
1034755747 7:153617627-153617649 TTATTGAATTTCCTTCTGGTAGG + Intergenic
1034765365 7:153715828-153715850 TTTGGTAATTTCCAGCTACTTGG + Intergenic
1036773221 8:11592828-11592850 TTGGGGAAATTCCAGGTGGCTGG + Intergenic
1037265350 8:17053255-17053277 TTAGGGTATTATCAGCTGGTAGG + Intronic
1041997294 8:64078531-64078553 TTAGGGAATGTACAAATGGTTGG - Intergenic
1044217092 8:89624764-89624786 TTTGGGAACTTCCTGCTGGGAGG - Intergenic
1048139328 8:131777817-131777839 TTAGGGAATTTCAAGATTGAGGG - Intergenic
1054733944 9:68731595-68731617 TCAGGGAATTTGCAACAGGTTGG + Intronic
1058229715 9:102410621-102410643 TTAGAGAATTTCCACTTGATAGG - Intergenic
1061905813 9:133696282-133696304 TTCGGGAAGTTCTACCTGGTGGG - Exonic
1062429087 9:136519056-136519078 TTCGGGAATTACCCTCTGGTGGG - Intronic
1203747148 Un_GL000218v1:46064-46086 TTTGGGAGTTTGCAGCTGGCAGG - Intergenic
1203562958 Un_KI270744v1:73416-73438 TTTGGGAGTTTGCAGCTGGCAGG + Intergenic
1188733262 X:33678892-33678914 TTTGGGACTTCCCAGCTGCTGGG + Intergenic
1189865585 X:45323759-45323781 TTGGGGAGTTTTCAGCTGGATGG + Intergenic
1194046144 X:89005917-89005939 TTTGGGAATTTCCAGCAGTCTGG - Intergenic
1196963386 X:121028380-121028402 TTATGAAACTTACAGCTGGTTGG + Intergenic
1201160469 Y:11161059-11161081 TTTGGGATTTTGCAGCTGGCAGG - Intergenic