ID: 932747442

View in Genome Browser
Species Human (GRCh38)
Location 2:74345472-74345494
Sequence CTCAGGAATCCTCCTAATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 97}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932747436_932747442 11 Left 932747436 2:74345438-74345460 CCTCCAGGATGCACAAAGGGAAC 0: 1
1: 0
2: 1
3: 19
4: 166
Right 932747442 2:74345472-74345494 CTCAGGAATCCTCCTAATGGAGG 0: 1
1: 0
2: 0
3: 8
4: 97
932747435_932747442 12 Left 932747435 2:74345437-74345459 CCCTCCAGGATGCACAAAGGGAA 0: 1
1: 0
2: 1
3: 19
4: 207
Right 932747442 2:74345472-74345494 CTCAGGAATCCTCCTAATGGAGG 0: 1
1: 0
2: 0
3: 8
4: 97
932747437_932747442 8 Left 932747437 2:74345441-74345463 CCAGGATGCACAAAGGGAACAGG 0: 1
1: 0
2: 3
3: 16
4: 180
Right 932747442 2:74345472-74345494 CTCAGGAATCCTCCTAATGGAGG 0: 1
1: 0
2: 0
3: 8
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932747442 Original CRISPR CTCAGGAATCCTCCTAATGG AGG Intronic
900146208 1:1159926-1159948 CTCAGCAATCCTCCCACAGGTGG + Intergenic
905263096 1:36732911-36732933 CTCATGAAACCTCATAAGGGAGG - Intergenic
906942594 1:50268656-50268678 TTCAGGATTCTTCCTAATGCAGG - Intergenic
907372945 1:54014629-54014651 CTGAGGAAGTCTCCTGATGGCGG - Intronic
910265693 1:85334651-85334673 CTCAGGAAACCTAATCATGGTGG - Intronic
911104822 1:94121353-94121375 CTCAGGAACCCCTCTCATGGAGG - Intergenic
913564913 1:120063449-120063471 CTCAGGTAACATTCTAATGGAGG + Intronic
913633217 1:120730114-120730136 CTCAGGTAACATTCTAATGGAGG - Intergenic
914285499 1:146222799-146222821 CTCAGGTAACATTCTAATGGAGG + Intronic
914546530 1:148673554-148673576 CTCAGGTAACATTCTAATGGAGG + Intronic
914620035 1:149397116-149397138 CTCAGGTAACATTCTAATGGAGG - Intergenic
921337938 1:214107303-214107325 GTCAGGACTCCTGCTGATGGGGG + Intergenic
922081777 1:222304689-222304711 CTCAGGAAAGCTCCTAAAAGCGG + Intergenic
1066205983 10:33189625-33189647 TTCAGGAATCCTCTGAAAGGAGG + Intronic
1071940127 10:90580976-90580998 CTAACCAATCCTCCTAATTGAGG - Intergenic
1074281154 10:112052892-112052914 CTCTAGAATTCTCCTAATGCTGG - Intergenic
1074765788 10:116699120-116699142 CTCAGGATCCCCCCTGATGGAGG + Intronic
1078851816 11:15171200-15171222 CTCTGGCATCCTCTGAATGGAGG - Intronic
1083936606 11:65872851-65872873 CTCAGGAATCCGCCGAAGGGCGG - Exonic
1085753020 11:79178433-79178455 CTCATGAATCCTCTGAATGCAGG - Intronic
1087891688 11:103543645-103543667 CTCAGGCATACCCCAAATGGAGG - Intergenic
1089092755 11:115891925-115891947 CTCATGATTCCTCCCAGTGGAGG - Intergenic
1093651147 12:21647353-21647375 CTCAGAAAGCCTCCAAATTGGGG - Intronic
1095121801 12:38427875-38427897 CTCCGAAATCCTCATAATAGAGG + Intergenic
1096421318 12:51460447-51460469 CTCAGAATTCCTCTTCATGGTGG - Intronic
1098161699 12:67651541-67651563 CTCAGTACTCCTCATAATGGAGG + Intronic
1100023265 12:90097181-90097203 CACAGGTATCCTTCTAAGGGGGG + Intergenic
1105312240 13:19222688-19222710 CTCAGGGATCCACCTGATGCAGG + Intergenic
1107725666 13:43296629-43296651 CTGAGCCATCCTCCTGATGGAGG - Intronic
1114209643 14:20604074-20604096 CTCAGGCATACCCCAAATGGAGG + Intronic
1122613995 14:103004299-103004321 GTCAGGAATCCACATAAGGGTGG - Intronic
1124202357 15:27689538-27689560 CCCAGGAATCCGCCTCATGATGG + Intergenic
1124404203 15:29379613-29379635 CTCAGGACTCATCCCAGTGGGGG - Intronic
1124512771 15:30340711-30340733 CTCAGGATCCCTCCTGATGCAGG - Intergenic
1124730144 15:32190039-32190061 CTCAGGATCCCTCCTGATGCAGG + Intergenic
1125276135 15:37994252-37994274 ATCTGGAAGCCTGCTAATGGAGG - Intergenic
1126822933 15:52522628-52522650 CTCCTGAATTCTCCCAATGGAGG + Intronic
1127827541 15:62718271-62718293 CCCAGGGCTCCTCTTAATGGTGG + Intronic
1129171450 15:73810589-73810611 CCCAGGAATCTTCCTACTGTTGG - Intergenic
1130467140 15:84198111-84198133 CTCACGCAGCCTCCTGATGGGGG - Intergenic
1130497124 15:84475425-84475447 CTCACGCAGCCTCCTGATGGGGG + Intergenic
1141233351 16:82192372-82192394 CTGAGGTAGACTCCTAATGGAGG + Intergenic
1145780134 17:27557323-27557345 CCCAGGACTCCTCCTGATGCTGG - Intronic
1148762382 17:50013350-50013372 CTCAGGAAATCTCCATATGGTGG - Intergenic
1154997045 18:21650124-21650146 TTCAGGAGTTCTCCAAATGGTGG + Intergenic
1156631669 18:38976998-38977020 ACCAGGGATCCTCCTCATGGTGG - Intergenic
1160117196 18:76090410-76090432 CTCAGGCCTCCTCCCCATGGAGG - Intergenic
1160157867 18:76447238-76447260 CCCAATAATCCTCCTAATTGGGG - Intronic
1161623098 19:5309582-5309604 CGCAGGCGTCCTGCTAATGGGGG + Intronic
1163438683 19:17310531-17310553 CTCAGGATGCCAACTAATGGGGG - Intronic
925429371 2:3778022-3778044 CTCAGGTAACCTACTGATGGAGG - Intronic
925429398 2:3778146-3778168 CTCAGGAAACCCACTGATGGAGG - Intronic
930661275 2:54056154-54056176 CTCATGAATCCTCCTCAAGCTGG - Intronic
930685776 2:54306596-54306618 GACAGGAATCCTGCTAATGCTGG - Intergenic
931995682 2:67837168-67837190 CTGAGGAGTCCTGCTAATGGTGG + Intergenic
932747442 2:74345472-74345494 CTCAGGAATCCTCCTAATGGAGG + Intronic
935187656 2:100748457-100748479 CTCAGGAAGCCTCTTTGTGGAGG + Intergenic
937494922 2:122408398-122408420 CACAGGTATGCTCCTAATCGGGG - Intergenic
938446531 2:131384715-131384737 GGTAGGAATCCTGCTAATGGGGG + Intergenic
938771367 2:134504022-134504044 CTCAGGAGGCCACCAAATGGTGG - Intronic
940693127 2:156944859-156944881 TTCAGGATTCCTGATAATGGAGG - Intergenic
942216285 2:173722277-173722299 CTCCTCATTCCTCCTAATGGAGG - Intergenic
946012208 2:216574304-216574326 CTGAGCAATCCTGCTAATGCAGG + Intronic
946151281 2:217773152-217773174 CTCAGGAAACTTACAAATGGTGG - Intergenic
1177742377 21:25169633-25169655 CTCAGGACTTGTCCTTATGGTGG + Intergenic
1182111022 22:27723785-27723807 CTCAGGACTCATCTTCATGGAGG + Intergenic
1185027871 22:48425863-48425885 CTGAGGACTCCTCCAAAGGGTGG - Intergenic
949195340 3:1299001-1299023 CTCAGCAATCCAAATAATGGTGG + Intronic
956826146 3:72997867-72997889 AACAAGAATCCTCCTAAAGGGGG - Intronic
956964855 3:74447256-74447278 TTCAGTAGTCCTCCTACTGGAGG - Intronic
969439134 4:7207149-7207171 CTCAGGGGGCCTTCTAATGGAGG + Intronic
969502278 4:7560354-7560376 CTGAGGAATCCCTCTACTGGAGG + Intronic
970372757 4:15424549-15424571 CCAAGGAGTCCTCCTAGTGGGGG - Intronic
974850797 4:67403223-67403245 CTCAGGAAAGCTGCTCATGGTGG + Intergenic
979434752 4:120674645-120674667 CTGAGGAGTGCTCCTCATGGTGG - Intergenic
987378919 5:17265581-17265603 CACTGAAATCCTCTTAATGGTGG + Intronic
989817356 5:45752057-45752079 CTCAGGAAACATCATCATGGTGG + Intergenic
991149564 5:63350928-63350950 CTTAGGACTCCTTCTAAAGGAGG - Intergenic
998604162 5:143616437-143616459 CTCAATAACACTCCTAATGGGGG + Intergenic
1001105267 5:168848006-168848028 CTCAGGCATCCTCCAACTGCTGG - Intronic
1007587526 6:43000758-43000780 CTCAGGAATCCTCAGAACAGGGG - Intronic
1009707884 6:67278163-67278185 CTCAGGAATCCTAGTTATGGCGG + Intergenic
1012320839 6:97843427-97843449 CTCATGAATTTTCCAAATGGGGG + Intergenic
1013963663 6:115929810-115929832 CTCAGGAATTCTAGTATTGGAGG - Intergenic
1015660488 6:135568821-135568843 CTCAGGAATCCTGCTATTGCAGG - Intergenic
1016962142 6:149684142-149684164 CCCATGAATCCTCCTAATCAAGG - Exonic
1020895388 7:13932791-13932813 CTCAGGAATGCTTTTAGTGGGGG - Intronic
1025229003 7:57187172-57187194 GGCAGGAATCCTGTTAATGGGGG - Intergenic
1037384374 8:18322021-18322043 CTCAGGAAACTTACAAATGGCGG + Intergenic
1040711677 8:50195941-50195963 CTCAAGAATCATCATCATGGAGG - Intronic
1041376069 8:57210236-57210258 CCCCGGAAGCCTGCTAATGGAGG - Intergenic
1041965422 8:63669863-63669885 CACAAGAACCCACCTAATGGTGG - Intergenic
1046846749 8:118925217-118925239 TTCAGATATCCTCCTCATGGAGG - Intronic
1047103209 8:121703828-121703850 CCCAGGAAGCATCCTACTGGGGG - Intergenic
1048886443 8:138913706-138913728 CCCAGGAATCCTCCTCCTGGGGG + Exonic
1052526755 9:29628680-29628702 CTCAGGAAGCCTCATAATCATGG - Intergenic
1056003520 9:82242815-82242837 CTACTGAAGCCTCCTAATGGTGG + Intergenic
1056443694 9:86644520-86644542 CTCAGGAATCCTCCCAAGGCTGG + Intergenic
1057075280 9:92135272-92135294 CTCAGGAAGCATCCTGATGGGGG + Intergenic
1059717909 9:116930849-116930871 CTCAGGAAGCAATCTAATGGAGG - Intronic
1192560291 X:72123834-72123856 CTCAGCAACTCTCCTGATGGGGG - Intergenic
1194726310 X:97401551-97401573 CTCAGGAACCCTGCTACTGTGGG + Intronic
1195921736 X:109990500-109990522 CTCAAGAATTCTCAGAATGGTGG + Intergenic
1199448421 X:147953402-147953424 CTCAGGAAGTCTCCTCTTGGTGG - Intergenic
1199534634 X:148888674-148888696 CTCAGTACTCCTCCTTATGATGG - Intronic
1200575528 Y:4884501-4884523 CTGAGGAAGCCTCATAATGATGG - Intergenic