ID: 932747980

View in Genome Browser
Species Human (GRCh38)
Location 2:74350435-74350457
Sequence CTTAAAGCCCAGATCCAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 104}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932747980_932747983 7 Left 932747980 2:74350435-74350457 CCAGGTTGGATCTGGGCTTTAAG 0: 1
1: 0
2: 0
3: 7
4: 104
Right 932747983 2:74350465-74350487 AGACCATCAAGTTGAGTAATGGG 0: 1
1: 0
2: 1
3: 12
4: 104
932747980_932747985 23 Left 932747980 2:74350435-74350457 CCAGGTTGGATCTGGGCTTTAAG 0: 1
1: 0
2: 0
3: 7
4: 104
Right 932747985 2:74350481-74350503 TAATGGGAACATTACAACCAAGG 0: 1
1: 0
2: 0
3: 10
4: 154
932747980_932747982 6 Left 932747980 2:74350435-74350457 CCAGGTTGGATCTGGGCTTTAAG 0: 1
1: 0
2: 0
3: 7
4: 104
Right 932747982 2:74350464-74350486 CAGACCATCAAGTTGAGTAATGG 0: 1
1: 0
2: 2
3: 6
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932747980 Original CRISPR CTTAAAGCCCAGATCCAACC TGG (reversed) Intronic
903663769 1:24994697-24994719 CCTTAAGACCAGAGCCAACCAGG - Intergenic
905856488 1:41317977-41317999 CTTGGATCCCAGATCCTACCAGG - Intergenic
909549463 1:76881428-76881450 CATACAGCTCAGATCAAACCTGG - Intronic
910448175 1:87319890-87319912 CTTATAACCCAGATCCTAACTGG + Intergenic
915033525 1:152903969-152903991 CTTAAACACCAGACCCAGCCAGG + Intergenic
916482479 1:165227240-165227262 TTTAAAACACAGAGCCAACCAGG + Intronic
916588975 1:166171990-166172012 CTTAAAGTCCAGAACCATCTTGG + Intergenic
921329007 1:214016727-214016749 CTTCAACCCCACTTCCAACCTGG - Intronic
1062905449 10:1176481-1176503 CTTACACCCCAGTTCCCACCTGG + Intergenic
1063341604 10:5270574-5270596 CTTAAAACACACATCCAGCCTGG - Intergenic
1067300846 10:45007799-45007821 CTTAAATCCCAGAGAGAACCTGG + Intergenic
1073032337 10:100536572-100536594 CTTTAAGCCGAGGTCCAACAGGG + Exonic
1074914139 10:117939412-117939434 CTTAGAGTCCAGTCCCAACCAGG + Intergenic
1076824281 10:132959423-132959445 CTCAAAGACCAGCTCCCACCTGG - Intergenic
1078669202 11:13350034-13350056 CTTACACCCCAGATCCAGCTTGG - Exonic
1081869477 11:46376812-46376834 CTGGAAGCCCAGAGCCATCCAGG + Intronic
1083134388 11:60658039-60658061 AATAAAGCCCAGCTCCAAGCAGG + Intergenic
1084406529 11:68977094-68977116 CATAAACCCTGGATCCAACCAGG - Intergenic
1088362704 11:109007723-109007745 CTAAAAGCCCAAATCCTAACAGG - Intergenic
1089328365 11:117672994-117673016 CTTAGAGCCCAGATCCAGGCAGG - Intronic
1089528114 11:119109959-119109981 CTTAAAGCCCTGAGCCAAGGAGG + Intronic
1096410712 12:51375331-51375353 TTTAAGGCCCAGCTCCAATCTGG + Intronic
1098118517 12:67208166-67208188 CTCCAGGCCCAGTTCCAACCTGG - Intergenic
1101070957 12:101075374-101075396 CTCTAAATCCAGATCCAACCAGG - Intronic
1102653933 12:114464033-114464055 CAAAAAGCCCAGATTCAACCTGG - Intergenic
1107565905 13:41604144-41604166 CCTGAAGCTCAGAGCCAACCTGG + Intronic
1117227016 14:53671675-53671697 TTTAACGCCCAGATCAAGCCAGG + Intergenic
1118302908 14:64631126-64631148 TTTAAATCCCAGATCAGACCTGG + Intergenic
1119170309 14:72529873-72529895 CATAAAGCTTAGATCCAACTAGG - Intronic
1121679797 14:95783977-95783999 TTAAAAGCACAGATCCAGCCAGG - Intergenic
1123459561 15:20457231-20457253 CTGAAATCACAGATCCAACGTGG + Intergenic
1123658500 15:22543190-22543212 CTGAAATCACAGATCCAACGTGG - Intergenic
1124312365 15:28637682-28637704 CTGAAATCACAGATCCAACGTGG - Intergenic
1125006667 15:34824547-34824569 CTTATACCCCAGATCCAATACGG + Intergenic
1128115573 15:65102702-65102724 CGTAAAGCCCAGGGCAAACCAGG + Intronic
1130103130 15:80909092-80909114 CTTAAATCCCAGAGCAAACTAGG - Exonic
1130772765 15:86941518-86941540 CCCAAAGCTGAGATCCAACCTGG + Intronic
1135099771 16:19595344-19595366 CCTAAAGCCCTCATCCATCCTGG - Intronic
1140507607 16:75483726-75483748 CTTAAATCCAAGAGCCAGCCGGG + Intronic
1141017441 16:80463892-80463914 CTTAATGCGCAGCTCCAGCCGGG + Intergenic
1155527712 18:26734033-26734055 TTTAAACTCCAGATGCAACCAGG - Intergenic
1155604484 18:27588464-27588486 CTTAAAACCATGAGCCAACCAGG + Intergenic
1156586766 18:38439507-38439529 TTTATAGCCAAGATCCAAACAGG - Intergenic
1156797814 18:41069588-41069610 CTTAAAGACCAGCCCCAACTCGG - Intergenic
1161384769 19:3985133-3985155 CTAACAACCCAGCTCCAACCAGG + Intronic
1166210384 19:41302989-41303011 GTCAAAGCCCAGCCCCAACCTGG - Intronic
926887645 2:17612726-17612748 GTTAAAGCCCAGAGGCAACCTGG - Intronic
932747980 2:74350435-74350457 CTTAAAGCCCAGATCCAACCTGG - Intronic
932837322 2:75049705-75049727 CTTGAAGCCCAGACGGAACCTGG + Exonic
933433565 2:82215392-82215414 CTTAAGGCCCAGACCCAAGCGGG + Intergenic
934767946 2:96890916-96890938 AATAAAGCCCAGATCAAACCAGG + Intronic
936627769 2:114166644-114166666 CTTAAAGTACAGCTCCATCCAGG - Intergenic
938765343 2:134457513-134457535 CTGAAAGGCCAGCTCCAGCCTGG + Intronic
942449627 2:176100779-176100801 CCAAAAGGGCAGATCCAACCCGG - Exonic
943483770 2:188454906-188454928 CTTAAAGCTGAGTTCCAATCCGG + Intronic
1169089669 20:2851149-2851171 ATTATAGACCAGCTCCAACCTGG - Intronic
1171276976 20:23865532-23865554 AATAAAGCCCAGAACCAAACAGG - Intergenic
1175272823 20:57746896-57746918 CTTAAAGCCCAGAGCCCCTCGGG + Intergenic
1175580109 20:60091970-60091992 CTCAATGGCCAGATCCTACCAGG - Intergenic
1175618274 20:60421894-60421916 CATATAGCCCAGGTCTAACCTGG - Intergenic
1181054379 22:20253144-20253166 CTTCCAGCCCAGATGCAGCCAGG - Intronic
1185235527 22:49710562-49710584 CTTAAAGCCCAAATGCAATCAGG + Intergenic
950435260 3:12975543-12975565 CTCAAATCCCTGATCCAGCCAGG - Intronic
951243187 3:20310834-20310856 GTCAAAGCCCAGAGCCACCCTGG - Intergenic
952820561 3:37482392-37482414 CTTAAAGCTCAGATTCGACTGGG - Intronic
955419139 3:58719602-58719624 CATCAAGCCCAGCCCCAACCAGG - Intronic
964540020 3:157769387-157769409 CTTAAAGCCCAGCTGAGACCAGG + Intergenic
972197200 4:36668048-36668070 CTTCAACCCCAGTTCTAACCTGG + Intergenic
972935316 4:44127694-44127716 GTTAAAGCCTAGATCCAAAGTGG + Intergenic
973067368 4:45812791-45812813 ATTAAACCCTAAATCCAACCAGG + Intergenic
973647610 4:52965679-52965701 CCTAAAGGCCAGACCCAGCCAGG - Intronic
974378717 4:61109700-61109722 CTTATAGCCCATATGCAAACTGG - Intergenic
975597527 4:76064142-76064164 CTTGAAGACCAGTTCTAACCTGG - Intronic
976666542 4:87600274-87600296 CTTAAAGCATAAATCCAACAAGG + Intergenic
977842318 4:101723527-101723549 CTTTAATCCCAGATCAAACAAGG + Intronic
978859413 4:113430700-113430722 CTAAAAAACCAGATCCGACCAGG - Intergenic
991909452 5:71547171-71547193 CTTAAATTCAAGATCCAATCAGG + Intronic
997349979 5:133223906-133223928 TTTAAGGCCCAGATCTGACCAGG + Intronic
997456952 5:134024802-134024824 CTTATAGCCCAGACCCACACTGG + Intergenic
1002420713 5:179147448-179147470 CTTTAAACACAGATCCAACATGG - Intronic
1007952276 6:45883078-45883100 CTTGAATCCCAGAGCCAAGCTGG - Intergenic
1009821024 6:68801389-68801411 CTTAAATCCCATATCCAGGCTGG + Intronic
1011771335 6:90676694-90676716 CTGTAAGCCCAGCTCCAACAGGG - Intergenic
1012770351 6:103425232-103425254 CTTGAAGCCTAGATCCACCGGGG - Intergenic
1013944260 6:115703821-115703843 CTTAGAGCCCAGATCCATAGGGG + Intergenic
1014179324 6:118367506-118367528 CATAAAGCCCACAGCCAAGCTGG + Intergenic
1015625475 6:135177496-135177518 CTTAATGCCCTGAGCCAAACTGG + Intergenic
1015750212 6:136550945-136550967 CCTAAAGCGCAGATCCAGGCCGG - Intergenic
1022230342 7:28408091-28408113 TTTCAAGCCCAGATCCCAACTGG - Intronic
1022976242 7:35559044-35559066 CTCAAAGCCCAGTTCTAAACAGG + Intergenic
1028484417 7:91342421-91342443 CTTAGACCCCAGATCCTGCCAGG + Intergenic
1029946718 7:104541017-104541039 CTTAAAGCCCAGATTCCAGAAGG + Intronic
1032259351 7:130322442-130322464 CTTGAAGCCCAGTTCCCTCCTGG - Intronic
1034545950 7:151789485-151789507 CTTGGAGCACAGATCCAAACAGG - Intronic
1036793618 8:11740097-11740119 CTTCAGGCTCAGATACAACCAGG - Intronic
1037225009 8:16575990-16576012 CTTAATGCCCTGCTTCAACCTGG - Intergenic
1038163541 8:25063249-25063271 CTTAAAGCCCAAATACAATTAGG - Intergenic
1039982385 8:42418682-42418704 TTTAAAGCCAAAATCCAACCTGG - Intronic
1040018407 8:42719130-42719152 CTTAATCCCCAGATGCCACCAGG + Intronic
1042051223 8:64710182-64710204 CGTAAAGCACAGATCTGACCAGG + Intronic
1046870434 8:119199637-119199659 CTTAAAGCACAGATCAAATTTGG + Intronic
1057336018 9:94155911-94155933 CCTAAAGCCCAGCACCAAGCTGG - Intergenic
1059695131 9:116723517-116723539 CTCCAAGCCCAGATTCATCCTGG + Intronic
1059854154 9:118376687-118376709 CTGAAAGCCCAGACCCCACGGGG - Intergenic
1059948423 9:119437043-119437065 CATAGGGCCCAGAGCCAACCTGG - Intergenic
1060119423 9:120974267-120974289 CCTAAAGGCCAACTCCAACCTGG + Intronic
1185852685 X:3503961-3503983 CACAATGCCCAGAACCAACCTGG - Intergenic
1192683199 X:73275278-73275300 ATTAAAGGCCAGACCCAATCTGG - Intergenic
1196885684 X:120243336-120243358 CTTAAGGCACAGATAAAACCAGG - Intergenic
1197789026 X:130232114-130232136 CTCAAAGTCTAGTTCCAACCAGG - Intronic
1199169423 X:144718384-144718406 CTTATGGCCCAGATTCACCCTGG + Intergenic
1200246530 X:154529496-154529518 CTGTGAGCCCAGATCCACCCTGG - Intergenic