ID: 932749095

View in Genome Browser
Species Human (GRCh38)
Location 2:74359922-74359944
Sequence AAGTGCCACCAGAAGTTGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 157}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932749089_932749095 22 Left 932749089 2:74359877-74359899 CCACCAAGGGAAAAGGATGGAAC 0: 1
1: 0
2: 1
3: 18
4: 203
Right 932749095 2:74359922-74359944 AAGTGCCACCAGAAGTTGCTTGG 0: 1
1: 0
2: 2
3: 11
4: 157
932749093_932749095 -9 Left 932749093 2:74359908-74359930 CCATTCTCCTTTCAAAGTGCCAC 0: 1
1: 0
2: 8
3: 25
4: 255
Right 932749095 2:74359922-74359944 AAGTGCCACCAGAAGTTGCTTGG 0: 1
1: 0
2: 2
3: 11
4: 157
932749090_932749095 19 Left 932749090 2:74359880-74359902 CCAAGGGAAAAGGATGGAACAAA 0: 1
1: 0
2: 3
3: 35
4: 387
Right 932749095 2:74359922-74359944 AAGTGCCACCAGAAGTTGCTTGG 0: 1
1: 0
2: 2
3: 11
4: 157
932749092_932749095 -8 Left 932749092 2:74359907-74359929 CCCATTCTCCTTTCAAAGTGCCA 0: 1
1: 0
2: 2
3: 35
4: 420
Right 932749095 2:74359922-74359944 AAGTGCCACCAGAAGTTGCTTGG 0: 1
1: 0
2: 2
3: 11
4: 157
932749091_932749095 -7 Left 932749091 2:74359906-74359928 CCCCATTCTCCTTTCAAAGTGCC 0: 1
1: 0
2: 4
3: 78
4: 984
Right 932749095 2:74359922-74359944 AAGTGCCACCAGAAGTTGCTTGG 0: 1
1: 0
2: 2
3: 11
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932749095 Original CRISPR AAGTGCCACCAGAAGTTGCT TGG Intronic
900013311 1:133648-133670 AGGTGCCAACTGAAGCTGCTGGG + Intergenic
900043375 1:489635-489657 AGGTGCCAACTGAAGCTGCTAGG + Intergenic
900064813 1:724632-724654 AGGTGCCAACTGAAGCTGCTGGG + Intergenic
900950825 1:5857437-5857459 AAGTGCTACCCGAGGTTGCTGGG + Intergenic
902408285 1:16198485-16198507 AAGTGCCAGCAGGAGCAGCTTGG + Exonic
904727987 1:32564730-32564752 AAATGCCAGCATAAGTTGTTGGG - Intronic
907045582 1:51298251-51298273 AAAGCCCACCAGCAGTTGCTGGG - Intronic
907554913 1:55335123-55335145 ATGTGCCCCCAGAAGTAGTTTGG - Intergenic
909694076 1:78445190-78445212 AAGTGCCACAAGAAGAGGCAAGG - Intronic
911952813 1:104197687-104197709 AAGTTGCACAAGCAGTTGCTAGG + Intergenic
914451274 1:147794200-147794222 AAGTCACACAAAAAGTTGCTCGG - Intergenic
915110881 1:153564117-153564139 AAGTGCCATCAGAGGAGGCTTGG - Intronic
916727287 1:167534322-167534344 ATGTGCCACCAGCAGTTGAGGGG + Intronic
917665919 1:177225563-177225585 CAGTTCCACCAGAAGTTGTGAGG + Intronic
921162828 1:212485219-212485241 AACTGTCATCAGAAGGTGCTTGG + Intergenic
922099718 1:222470651-222470673 AGGTGCCAACTGAAGCTGCTGGG + Intergenic
922261752 1:223950146-223950168 AGGTGCCAACTGAAGCTGCTGGG + Intergenic
922735328 1:227975599-227975621 AGGTGCCAACTGAAGCTGCTGGG - Intergenic
922945985 1:229514421-229514443 AAGTGGAACCACAAGTTGCCTGG - Intergenic
924342917 1:243052318-243052340 AGGTGCCAACTGAAGCTGCTGGG + Intergenic
924528157 1:244870258-244870280 ACTTGCCACCTGAAGTTGTTGGG + Intergenic
1063385277 10:5612619-5612641 AAGTGACATCAAAAGTTGCAGGG + Intergenic
1063886856 10:10588496-10588518 GAGTGCCACCAGAGGCTTCTGGG - Intergenic
1065153235 10:22843678-22843700 ATGTGCCACCACGAGTAGCTAGG - Intergenic
1066733566 10:38453234-38453256 AGGTGCCAACTGAAGCTGCTGGG - Intergenic
1074287506 10:112111809-112111831 AGGTGGCACCAGAAGAGGCTTGG + Intergenic
1075797921 10:125134528-125134550 AGGAGTCACCAGCAGTTGCTGGG - Intronic
1076101236 10:127780618-127780640 AAGGGGCACCAGATGTGGCTGGG + Intergenic
1076350641 10:129812810-129812832 AAGTGCCCCCAGAGCTTTCTGGG + Intergenic
1076969647 11:125852-125874 AGGTGCCAACTGAAGCTGCTGGG + Intergenic
1083965877 11:66043459-66043481 AAGTGCGCCGAGAAGTTGCGGGG + Exonic
1085310786 11:75515442-75515464 AAGTGCCACCAAATGCTGCCAGG - Intronic
1087182951 11:95157470-95157492 AACTGCCTCCAGGAGCTGCTGGG + Intergenic
1090752876 11:129762997-129763019 TGGTGCCATAAGAAGTTGCTGGG + Intergenic
1091223514 11:133944735-133944757 AAGTGCCAACAGAAGAGGATGGG + Intronic
1091996437 12:4997667-4997689 GAGTGCCACCAGAACATGCTGGG - Intergenic
1094007866 12:25774597-25774619 AGGTGACACAAGAAGTTACTGGG + Intergenic
1096467818 12:51857190-51857212 CAATGCCACCAGCAATTGCTAGG + Intergenic
1098807125 12:75034264-75034286 AAGGCCCACCAGAAGCTGTTTGG + Intergenic
1100395583 12:94183727-94183749 AAAAGCCACCAGTAGTTGATGGG + Intronic
1100735797 12:97529127-97529149 AAGTCCCACCAGAACTGGCATGG - Intergenic
1101197103 12:102394839-102394861 ATGAGCCACCAGAAATTCCTTGG + Intergenic
1101899681 12:108782202-108782224 AAGAGCCACCAAAAGCTGCCTGG + Intergenic
1106087352 13:26555507-26555529 AAATGCAAGCAGAAGGTGCTGGG + Intergenic
1114249166 14:20942935-20942957 AACTTCCACCCGAAGTAGCTTGG + Intergenic
1118824626 14:69368935-69368957 AAGTGGAACCAGAAGCTGATGGG - Intergenic
1122685266 14:103501412-103501434 AAGTGCCACCAGCTGTTGTGGGG + Intronic
1122686940 14:103513278-103513300 ATGTGGCACCAGAAGTCCCTGGG + Intergenic
1126112016 15:45180972-45180994 CTGTGTCACCAGAAGCTGCTTGG + Intronic
1130423911 15:83776102-83776124 ATGTGTCACCAACAGTTGCTTGG - Intronic
1132742111 16:1419912-1419934 AAGTGTCACCAGAAGTGCTTTGG + Exonic
1133027151 16:2993517-2993539 ACGTGCCACCACAACTGGCTAGG - Intergenic
1137485535 16:48887501-48887523 AAGTGCCCCCAGAAGATGCTAGG - Intergenic
1138265581 16:55657372-55657394 AAGGGGCACCAGAAGTGGGTGGG + Intronic
1138421407 16:56901692-56901714 AAGTGAGACCAGAAGCTGCTGGG - Intronic
1139587764 16:67915325-67915347 AAGGGCCACCAGAACCTGCCAGG - Intronic
1142451029 16:90173270-90173292 AGGTGCCAACTGAAGCTGCTGGG - Intergenic
1142456534 17:60425-60447 AGGTGCCAACTGAAGCTGCTGGG + Intergenic
1142698156 17:1644802-1644824 AAGGGCCAGATGAAGTTGCTGGG - Intronic
1143930982 17:10424389-10424411 AAATGCAAGCAGAAGTTGCTGGG + Intergenic
1146360482 17:32171892-32171914 AAGTGCCACCAAAAGTAGTAAGG + Intronic
1152626014 17:81388335-81388357 CAGTGCCCCCAGAAGTCGCAGGG + Intergenic
1154095754 18:11413643-11413665 GAATGCCACCAGGAGGTGCTGGG - Intergenic
1155381223 18:25224669-25224691 AAGTTTCACCAGATCTTGCTTGG + Exonic
1155921005 18:31602779-31602801 AAGTGCCACCAACAGAAGCTAGG - Intergenic
1156095266 18:33523896-33523918 AGCTGCCAGCAGAAGTTCCTTGG + Intergenic
1160646452 19:195778-195800 AGGTGCCAACTGAAGCTGCTGGG + Intergenic
1163647675 19:18499201-18499223 AAGGGCCACCAGCAGCTGCTGGG + Intronic
1163666215 19:18605313-18605335 AAGTGCCCCTAGAAGATGCCCGG + Intronic
1166369021 19:42291266-42291288 AGGTGCCACCTGAAGCTGCTGGG - Exonic
1166781731 19:45346715-45346737 AAGCGCCACCTGGAGTTCCTGGG + Exonic
1167150657 19:47707468-47707490 AACAGCCACCAGAGGGTGCTGGG - Intergenic
1168290355 19:55354409-55354431 AACTGCTACCAGAACTTCCTGGG - Exonic
1168705639 19:58468815-58468837 AAGTGCCATCTGAAGATGGTGGG + Intronic
925389482 2:3485649-3485671 AAGTGCCACAGGAACCTGCTGGG - Intergenic
925415047 2:3664076-3664098 ATGTCCCACCACAAGGTGCTGGG - Intronic
925992261 2:9263171-9263193 ACATGACACCAGAAGGTGCTGGG - Intronic
927981506 2:27377687-27377709 AAGCGCCACCAGAAGGTGCATGG - Exonic
928314763 2:30236617-30236639 AAGTGCCCCTAAATGTTGCTTGG - Intronic
930110989 2:47678356-47678378 AATGGTCACCAGAGGTTGCTTGG + Intergenic
932749095 2:74359922-74359944 AAGTGCCACCAGAAGTTGCTTGG + Intronic
938833643 2:135077540-135077562 AGGTGACACCAGCAGTTTCTTGG - Intronic
943403676 2:187451864-187451886 AAGTGCTAACAGCAATTGCTAGG - Intergenic
943716223 2:191155091-191155113 ATGTCCCACCTGAAATTGCTGGG + Intergenic
946147003 2:217738527-217738549 AGGTGGCAGCAGAGGTTGCTGGG + Intronic
946858267 2:223974839-223974861 AAGTGCCGAATGAAGTTGCTGGG - Intergenic
948645816 2:239403449-239403471 AAGTTCCAACAGAACTTCCTGGG + Intergenic
1170854553 20:20039195-20039217 CAGTGACAACAGAAGTTGCAAGG + Intronic
1172964003 20:38820168-38820190 AAATGCCCCCAGAAGTAGTTTGG - Intronic
1173182628 20:40816233-40816255 GAGAGCCACCAGCAGTTGTTAGG - Intergenic
1173322649 20:42002035-42002057 AACTGACACAAGAAGCTGCTGGG - Intergenic
1175210290 20:57349996-57350018 AATTCCCAGCAGAGGTTGCTGGG - Intergenic
1179255068 21:39708773-39708795 CAGTGCCAACAGAGGATGCTGGG + Intergenic
1181135458 22:20762976-20762998 ATGTGCCACCACAACTGGCTAGG + Intronic
1182232354 22:28848161-28848183 AGGTGTCAACAGAAGGTGCTAGG + Intergenic
1182772644 22:32806289-32806311 AAGTGGCCACAGAAGTAGCTTGG + Intronic
1183290444 22:36998884-36998906 AAGTGCCACATGAAGGTGCTTGG - Intronic
1185395619 22:50585963-50585985 ATGTCCCACCAGCAGGTGCTCGG - Intronic
951103996 3:18721876-18721898 AATTGCCACTTGAATTTGCTGGG + Intergenic
951154777 3:19337771-19337793 AAGAGACAACAGAAGTTGATAGG - Intronic
953610612 3:44444537-44444559 AACTGGCACTAGAAGTGGCTGGG - Exonic
957019270 3:75106445-75106467 AAGTGGCAAGATAAGTTGCTGGG + Intergenic
960404076 3:117238379-117238401 AAGTGGCACAAGAACTTACTTGG - Intergenic
960495868 3:118374467-118374489 GACTCCCACCAGAATTTGCTGGG - Intergenic
963743229 3:149099751-149099773 AAGTGTATCCAGAAGTTTCTGGG - Intergenic
964887301 3:161499204-161499226 CAGGGCCACCAGGAGTTGTTGGG + Exonic
965545782 3:169915120-169915142 AATGGCCAACAGAAGTTGATGGG + Intronic
968371229 3:198223748-198223770 AGGTGCCAACTGAAGCTGCTGGG - Intergenic
968468627 4:765859-765881 AGGGTCCCCCAGAAGTTGCTGGG - Intronic
968714345 4:2143969-2143991 TATTACCACCTGAAGTTGCTGGG - Intronic
970355159 4:15244336-15244358 GAGAGCCTCCAGAACTTGCTTGG + Intergenic
971386609 4:26146269-26146291 AAGTGCCAACATAATTTACTGGG + Intergenic
974934534 4:68397037-68397059 AAGTCCCAGTAGATGTTGCTGGG - Intergenic
976333354 4:83857095-83857117 CATTGCAACCAGCAGTTGCTTGG - Intergenic
978479494 4:109173017-109173039 AAGTACCATTAGAAGTTGCCAGG + Intronic
979259915 4:118636221-118636243 AGGTGCCAACTGAAGCTGCTGGG - Intergenic
979328469 4:119404404-119404426 AGGTGCCAACTGAAGCTGCTGGG + Intergenic
979815150 4:125091772-125091794 GAGAGCCAGCAGACGTTGCTTGG + Intergenic
980783729 4:137525512-137525534 TTATGCCTCCAGAAGTTGCTGGG + Intronic
985206568 4:187544012-187544034 AAATGCTAACAGAAGTTGTTAGG - Intergenic
987151286 5:15043052-15043074 TTGTCCCACCAGAAGTTTCTGGG + Intergenic
990168241 5:53018417-53018439 AACTGACCCCAGAAGTTGCTGGG + Intronic
992430592 5:76707313-76707335 AAGTGCCTACAGAAATTTCTTGG + Exonic
994843746 5:104958644-104958666 AAGTGCCACCAACAGTGGATTGG + Intergenic
996956892 5:129193950-129193972 TTGTGCCACCAGTAATTGCTTGG + Intergenic
1000914731 5:167066693-167066715 AACTGCCAAAAGATGTTGCTTGG - Intergenic
1002730468 5:181329294-181329316 AGGTGCCAACTGAAGCTGCTAGG - Intergenic
1002754065 6:144810-144832 AGGTGCCAACTGAAGCTGCTGGG + Intergenic
1005173502 6:23015700-23015722 GAGTTCCACAAGAAGTTGCAAGG - Intergenic
1008439795 6:51520074-51520096 AAGTGCCAGCAGAAGCTGCAGGG - Intergenic
1014512896 6:122346276-122346298 ATGTGCAACAAGAAGTTGTTTGG + Intergenic
1017545204 6:155443333-155443355 AAGTGCGGCCAGAAGTCCCTGGG + Exonic
1018110654 6:160534325-160534347 AAAACCCACCAGGAGTTGCTGGG + Intronic
1021493254 7:21244079-21244101 ATCTGCCATCAGAAGTAGCTAGG - Intergenic
1021624905 7:22583480-22583502 CAGTGCCAACATATGTTGCTTGG - Intronic
1022177722 7:27887864-27887886 AAGTGGCTGCAGAAGATGCTGGG + Intronic
1023401633 7:39795845-39795867 AGGTGCCAACTGAAGCTGCTGGG - Intergenic
1023747681 7:43336934-43336956 AAGTGTCACCAATAGTTGATTGG - Intronic
1024075612 7:45816467-45816489 AGGTGCCAACTGAAGCTGCTGGG - Intergenic
1024647985 7:51384830-51384852 AGGTGCCAACTGAAGCTGCTGGG + Intergenic
1025051841 7:55739329-55739351 AGGTGCCAACTGAAGCTGCTGGG + Intergenic
1025177178 7:56807875-56807897 AGGTGCCAACTGAAGCTGCTGGG + Intergenic
1025694614 7:63768511-63768533 AGGTGCCAACTGAAGCTGCTGGG - Intergenic
1027970321 7:85071901-85071923 AAGTGCCCCCAGTTGTTTCTTGG - Intronic
1030956692 7:115861639-115861661 CAGTGCCACCAGATACTGCTAGG + Intergenic
1031188765 7:118519115-118519137 AAGTGACACCAAAAGTATCTGGG - Intergenic
1032052139 7:128656214-128656236 AGGTGCCAACTGAAGCTGCTGGG - Intergenic
1034596327 7:152196990-152197012 AAGTGTAATGAGAAGTTGCTGGG + Intronic
1036485341 8:9174061-9174083 AACAGCCACCAGAAGATGCAAGG - Intergenic
1037585247 8:20271516-20271538 AAGAGCCACCTGTAGATGCTCGG + Intronic
1038810509 8:30836810-30836832 TTGTGCCTCCAGAAGTTCCTTGG - Exonic
1039393531 8:37202677-37202699 AAGTGCCACCAAAACTTGCTGGG + Intergenic
1039602425 8:38851375-38851397 AACTGCCCCCAGATGTTCCTGGG + Exonic
1042879436 8:73470872-73470894 CAGTGCCACCACTAGTTTCTAGG + Intronic
1048804630 8:138228658-138228680 AAGAGCAACCAGAAGTTGTGGGG - Intronic
1052894431 9:33734250-33734272 TGGTGCCATAAGAAGTTGCTGGG + Intergenic
1055285501 9:74724374-74724396 AAGTTCCACACGAAGATGCTTGG - Exonic
1059475683 9:114545594-114545616 ATGTGCGACCAGAAGTTCATGGG + Intergenic
1059813309 9:117881852-117881874 AAGTGCCTCCATAAGTTTATGGG - Intergenic
1061594883 9:131622329-131622351 AAGTGCCACGAGCAGCTGCCAGG + Intronic
1062754878 9:138281804-138281826 AGGTGCCAACTGAAGCTGCTGGG - Intergenic
1203578786 Un_KI270745v1:25973-25995 AGGTGCCAACTGAAGCTGCTGGG - Intergenic
1188979571 X:36714901-36714923 AAGTACCACCAGAAGGTGCATGG + Intergenic
1190336959 X:49268540-49268562 GTGTGCTACCAGAAGTTGATTGG - Intergenic
1192062578 X:67843355-67843377 AAGAGCCACCAGAAGGTATTGGG - Intergenic
1192238761 X:69313513-69313535 AACTGCCACCACATGATGCTAGG + Intergenic
1194790403 X:98141330-98141352 AAATGGAAGCAGAAGTTGCTGGG + Intergenic
1195396076 X:104411956-104411978 ACGTGCCCCCAGAAGTTGACTGG - Intergenic
1198628009 X:138601287-138601309 AAATGCAAACAGATGTTGCTGGG + Intergenic
1202381408 Y:24278591-24278613 AGGTGCCAACTGAAGCTGCTGGG - Intergenic
1202489377 Y:25391535-25391557 AGGTGCCAACTGAAGCTGCTGGG + Intergenic