ID: 932749615

View in Genome Browser
Species Human (GRCh38)
Location 2:74363097-74363119
Sequence CTCACTGCCAGGGCCCTCAT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 175}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932749609_932749615 20 Left 932749609 2:74363054-74363076 CCAGCAGCTGGCTGGTCTTACGA 0: 1
1: 0
2: 0
3: 7
4: 67
Right 932749615 2:74363097-74363119 CTCACTGCCAGGGCCCTCATGGG 0: 1
1: 0
2: 2
3: 18
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932749615 Original CRISPR CTCACTGCCAGGGCCCTCAT GGG Exonic