ID: 932749615 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:74363097-74363119 |
| Sequence | CTCACTGCCAGGGCCCTCAT GGG |
| Strand | + |
| Crispr in exon? | Yes |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 196 | |||
| Summary | {0: 1, 1: 0, 2: 2, 3: 18, 4: 175} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 932749609_932749615 | 20 | Left | 932749609 | 2:74363054-74363076 | CCAGCAGCTGGCTGGTCTTACGA | 0: 1 1: 0 2: 0 3: 7 4: 67 |
||
| Right | 932749615 | 2:74363097-74363119 | CTCACTGCCAGGGCCCTCATGGG | 0: 1 1: 0 2: 2 3: 18 4: 175 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 932749615 | Original CRISPR | CTCACTGCCAGGGCCCTCAT GGG | Exonic | ||