ID: 932750909

View in Genome Browser
Species Human (GRCh38)
Location 2:74371166-74371188
Sequence TCTCCTTTGCAGGAGGAGGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 483
Summary {0: 1, 1: 0, 2: 4, 3: 36, 4: 442}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932750909_932750921 30 Left 932750909 2:74371166-74371188 CCCTCCTCCTCCTGCAAAGGAGA 0: 1
1: 0
2: 4
3: 36
4: 442
Right 932750921 2:74371219-74371241 CCTCTCCACCAACACTGAGCTGG 0: 1
1: 0
2: 3
3: 20
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932750909 Original CRISPR TCTCCTTTGCAGGAGGAGGA GGG (reversed) Exonic
900793536 1:4694206-4694228 GCTCCTTTGCCGGGGGGGGATGG + Intronic
901585295 1:10285295-10285317 TCTCCTTTACATCAAGAGGAAGG - Intronic
901805522 1:11736259-11736281 TCCCCTTTGCGGGAGGAAGTGGG + Intronic
901927011 1:12572754-12572776 TGTCCATGGGAGGAGGAGGAGGG + Exonic
903279222 1:22240829-22240851 GCTCCTTGGCAGGCTGAGGAAGG - Intergenic
903637110 1:24828664-24828686 TCCCCTTTGAGGGATGAGGATGG + Intronic
904310017 1:29622815-29622837 ACTTCTTTGGAGGAGGAGGAGGG + Intergenic
904678986 1:32215785-32215807 TGCCCTCTGCAGGAGGTGGAAGG - Exonic
905976736 1:42180991-42181013 TGTCCTTTGCTGAAGGGGGAAGG - Intronic
906283294 1:44568586-44568608 ACTCCTTTGCAGGATTTGGAAGG + Intronic
907680152 1:56555402-56555424 TCACTTATGCAGGAGAAGGAAGG + Intronic
907933697 1:59022972-59022994 TGTCCTTTGCAGGCAGGGGATGG + Intergenic
908138456 1:61157316-61157338 TCTCTTTTGCAGGGAGTGGAGGG - Intronic
909857833 1:80561609-80561631 TCTCCTTTGCATAAGGAGTTTGG + Intergenic
910416616 1:87007014-87007036 TGTCCATTGCAGTAGGAAGAAGG + Intronic
911126385 1:94344522-94344544 TATCTTTTGGAGGAGGAGAAGGG + Intergenic
911201861 1:95052490-95052512 TTTGTTTTTCAGGAGGAGGATGG + Intronic
911710590 1:101067106-101067128 CCTCCTTTGCAGGACATGGATGG - Intergenic
913103620 1:115592723-115592745 CCACCTGTGCAGTAGGAGGATGG + Intergenic
913343434 1:117783158-117783180 TGTCATTTGCAGGAGTGGGAAGG + Intergenic
913387769 1:118278296-118278318 TCTCCTGTGGAGGAGTGGGATGG + Intergenic
916078166 1:161215188-161215210 TCTCTTGTGCAGGAAGGGGAAGG + Intergenic
916979380 1:170116652-170116674 TCTCCATTACTGGAGGATGAGGG + Intergenic
916994906 1:170286027-170286049 TCTCCTTTACAGGAGAAAGATGG - Intergenic
917787591 1:178475394-178475416 TGTCCTTTGTTGAAGGAGGAGGG + Intronic
918295479 1:183152291-183152313 GCTGGTTTGAAGGAGGAGGAAGG + Intergenic
919455022 1:197811067-197811089 TCTCCTTTGGAGAGGGAGAAAGG + Intergenic
919598744 1:199596594-199596616 TGTCCTTTGCAGGAAATGGATGG - Intergenic
920164352 1:204025212-204025234 TCCCCTTTGAACGTGGAGGAAGG + Intergenic
920206079 1:204292992-204293014 GCTCCATGCCAGGAGGAGGAAGG - Intronic
920434857 1:205941097-205941119 CATCCATGGCAGGAGGAGGAAGG + Intronic
920529335 1:206690497-206690519 ACCCCTTTGTGGGAGGAGGAAGG + Intronic
921175596 1:212591334-212591356 TCTCCCTTGCAAGAGGAGCCTGG - Intronic
922413986 1:225403744-225403766 TCTTCTTTGCTGGGGGAAGAAGG - Intronic
922447411 1:225709131-225709153 TCTCCTGTGAAGTAGGAGGTAGG + Intergenic
924128496 1:240880908-240880930 TATTCTTTGCAGGAAGAGGGAGG + Intronic
1062942931 10:1438311-1438333 TCTCCTTAGCAGATGGAGGCAGG + Intronic
1062943160 10:1439357-1439379 TCTCCTCAGCAGGTGGAGGCAGG + Intronic
1063454274 10:6172266-6172288 GCTCCTTTGCAGGAAGGAGAGGG + Intronic
1064281189 10:13953027-13953049 TCTCTTCTGTAGGATGAGGATGG + Intronic
1064991946 10:21264002-21264024 TCACCATGGCAGGAGTAGGAGGG + Intergenic
1067438888 10:46297106-46297128 TCTCCTCTGGAGGATGAGGTGGG + Intronic
1068114638 10:52723893-52723915 TACCCTTTGAAGGAGGTGGATGG + Intergenic
1068530664 10:58182291-58182313 TCTCCTTTCGGGGAGAAGGAGGG + Intergenic
1070053985 10:72916476-72916498 TGTCCTTTGCAGGGAGTGGATGG - Intronic
1070208552 10:74289858-74289880 TCTCCTTTGTAGAAAAAGGAGGG + Intronic
1070739857 10:78895667-78895689 TCTCATTTGCAGGACAAGAAGGG - Intergenic
1072915990 10:99537547-99537569 TCTCCCTTACAGGAGGGGGTGGG + Intergenic
1073051242 10:100668822-100668844 TCTCCTTTGGAGTGAGAGGATGG + Intergenic
1073178048 10:101568587-101568609 TCTCCTTTGCAGGCAGAGTTGGG + Intergenic
1074099812 10:110345901-110345923 TCTCTATTGCAGGAGGGGAAAGG + Intergenic
1074601366 10:114917164-114917186 CCTCATTTCCAGCAGGAGGAAGG + Intergenic
1075070746 10:119318539-119318561 TGTCCTTTGGAGGAGGGGGCTGG + Intronic
1075438023 10:122459704-122459726 ACTGCTTTGCGGGAGGTGGAGGG - Intergenic
1076121926 10:127943473-127943495 TCTCCCATGCAGGAGGGAGACGG + Intronic
1076518152 10:131061718-131061740 CCAGCTCTGCAGGAGGAGGATGG - Intergenic
1077424094 11:2466362-2466384 CCTACTTTGCAGGAGGAGGGGGG + Intronic
1077528793 11:3085517-3085539 GCAACTTTGCAGGAGGTGGAAGG - Intergenic
1078762916 11:14265893-14265915 ACTCCTCTGCAGGAAGAGGCTGG - Exonic
1078975287 11:16467475-16467497 TGTCCTTTGCAGGACATGGATGG + Intronic
1079002365 11:16768970-16768992 TATCCGTTGCAGGAGTGGGAGGG + Intergenic
1079688394 11:23391655-23391677 TCTCCCTGCCAGAAGGAGGAGGG + Intergenic
1080131518 11:28801143-28801165 TGTGCTTTGAAGGTGGAGGATGG - Intergenic
1081407274 11:42712228-42712250 TCACCTCTGCATGATGAGGATGG - Intergenic
1081587955 11:44400304-44400326 CCTCCTTTGGGGGAGGAGGGAGG + Intergenic
1082907462 11:58325702-58325724 TGTCCTTTGCAGGAACAAGATGG - Intergenic
1083492140 11:63020990-63021012 GCTCCTTAGCAGCAGGCGGAGGG + Intergenic
1084156040 11:67313039-67313061 TTTGCTTTGTAGCAGGAGGAAGG - Intergenic
1085141304 11:74144754-74144776 TGTCCTTTGCAGGACATGGATGG - Intronic
1085766540 11:79288064-79288086 TCTTCCTTGAAGGAGAAGGATGG + Intronic
1085874209 11:80386570-80386592 TCAACTTTGCAGCAGGAAGAAGG - Intergenic
1086656454 11:89362763-89362785 TTTCCTTGGTAGGTGGAGGAGGG - Intronic
1087365865 11:97217886-97217908 TCTCCCTTGAGGGAAGAGGAGGG + Intergenic
1088547397 11:110973695-110973717 TCTTCTTAGCAGCAGCAGGAAGG - Intergenic
1088580657 11:111312586-111312608 TGTCACTTGTAGGAGGAGGAGGG - Intergenic
1088607053 11:111541881-111541903 TCTCATTTGCAGGAAGGCGAAGG - Intronic
1089082475 11:115788305-115788327 GTTCCATGGCAGGAGGAGGAGGG + Intergenic
1090514678 11:127412432-127412454 GCTCCTGGGCAGGAGGAGGTGGG - Intergenic
1090586941 11:128223197-128223219 TGTCCTTTGCAGGACATGGATGG - Intergenic
1091320073 11:134643212-134643234 TCCCCTTTGCAGGTGGAGACTGG + Intergenic
1091687952 12:2577061-2577083 TTTCCTTTGCAGCAGGATAAAGG - Intronic
1091811115 12:3398689-3398711 TCTCCTGTGCTGGAGGAGACTGG + Intronic
1091866774 12:3845211-3845233 TCTCCTTGGCAGCAGGATGCTGG + Intronic
1092104816 12:5913871-5913893 CCTCCTTTTCAGGAAGAGGTCGG - Intronic
1094352896 12:29546277-29546299 TGTCACTTGCAGGAGGAGGGTGG + Intronic
1095066830 12:37787987-37788009 GCTCCTTTGTAGGAAGAGAAGGG - Intergenic
1095169016 12:39011084-39011106 TCTCCTTGGAAAGAGGAGAAGGG + Intergenic
1095236720 12:39805298-39805320 TCTGCTTTGCAGGGAGAGGCAGG + Intronic
1095819287 12:46459824-46459846 TTTTCTATGCAGGAGGGGGATGG + Intergenic
1096845972 12:54406839-54406861 TCTCCTTTCTAGGAAAAGGATGG - Intronic
1097879183 12:64671646-64671668 CTTCCTTGGCAGGAGGAGGAAGG + Intronic
1098196813 12:68010868-68010890 ACTCCTATGCAAAAGGAGGATGG + Intergenic
1100549787 12:95636417-95636439 TCTCCTTTGAGGGTGGAGGAGGG - Intergenic
1100804212 12:98263993-98264015 TCTCCTCTGCAAGCAGAGGAAGG + Intergenic
1101344752 12:103876513-103876535 TGTCCTTTGCAGGAACAGGGAGG + Intergenic
1102027214 12:109720340-109720362 CCTCCCTTGGAGGAGGAGGGAGG + Intronic
1102367266 12:112348981-112349003 TTGCCTTTGAATGAGGAGGAGGG + Intronic
1102541475 12:113622477-113622499 TCTCCTTTGCAAGAGCTGAAGGG - Intergenic
1102854170 12:116278180-116278202 TCTCCTCTGCAAAAGGCGGACGG - Intergenic
1102855605 12:116290482-116290504 TCTCCTTGGCAGGAGGACGAGGG + Intergenic
1103074050 12:117968278-117968300 TCTCTCTGGGAGGAGGAGGAGGG - Intronic
1104576852 12:129973873-129973895 TCTACTTAGCAGGAGGAATAGGG - Intergenic
1104796459 12:131523204-131523226 TATCCTTTGCAGGACATGGATGG + Intergenic
1105219468 13:18312329-18312351 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1105478402 13:20749306-20749328 TCTACATTGTAGTAGGAGGATGG - Intronic
1106119457 13:26847434-26847456 TCACCTCTGCTGGAGGGGGAGGG + Intergenic
1106300798 13:28462902-28462924 TCTCAGTGGCAGGAGGAGGTCGG - Intronic
1106435503 13:29720202-29720224 TGGCCTCTGCAGGAGGAGGGAGG + Intergenic
1106598941 13:31170859-31170881 TCTGCTATGCAGGAAAAGGAGGG - Intergenic
1106891964 13:34255371-34255393 ACTCCTTTGCTGGAGGAGCAGGG - Intergenic
1107969002 13:45623196-45623218 TCTCCACATCAGGAGGAGGAGGG - Intergenic
1111818364 13:93183416-93183438 TGTGCTTTGCAGATGGAGGAAGG - Intergenic
1111992805 13:95133642-95133664 TCTCCTTTGTTGGAGGTGGGAGG - Intronic
1113022262 13:105900423-105900445 TCTCTTTTGCATGAACAGGATGG - Intergenic
1114270872 14:21098915-21098937 TCTCTTTTGGGGGAGGAGGAGGG + Exonic
1114663788 14:24367196-24367218 TCACCTGGGCTGGAGGAGGAAGG - Exonic
1114829139 14:26118231-26118253 TGTCCTTTGCAGGACATGGATGG + Intergenic
1115175333 14:30555558-30555580 TTTCCTTTTCAGGAAAAGGATGG - Intergenic
1115366493 14:32563324-32563346 TCTCCTTTGCAGGAGGAAACTGG - Intronic
1116242196 14:42359271-42359293 TCTCTTTTTCAGGATAAGGATGG - Intergenic
1116900335 14:50356518-50356540 TGTCCTTTGCAGGGACAGGATGG + Intronic
1118470492 14:66070469-66070491 TCTCCTTTGGTGGAGGAGTGGGG - Intergenic
1119033016 14:71207164-71207186 CCTCTTTTGCACGAGGAGGTAGG - Intergenic
1119723749 14:76909271-76909293 TCTCCTTTGCTAGTGGAGGCTGG - Intergenic
1119816693 14:77575386-77575408 TCCCATTTGGAGGTGGAGGAGGG + Intronic
1121057838 14:90875238-90875260 TCTCCTTTGAAGGAGAAGCCTGG - Exonic
1121325367 14:93016624-93016646 TGGCATTTTCAGGAGGAGGAGGG - Intronic
1122247973 14:100417569-100417591 TCTCCCTCCCTGGAGGAGGAAGG - Intronic
1122878048 14:104677850-104677872 CCTCCTTGGGAGGAGGAGGAAGG - Intergenic
1123125923 14:105945931-105945953 TTCACTTTGCAGGAGTAGGAAGG + Intergenic
1202893674 14_KI270722v1_random:183332-183354 TCTCCATTGCAGCAGGAGCCGGG - Intergenic
1123836145 15:24195219-24195241 TCTCCATGGCTGCAGGAGGAGGG - Intergenic
1125127658 15:36242859-36242881 TGTCCTTTGCAGGGACAGGAAGG - Intergenic
1126732664 15:51699949-51699971 CCTCCTTTCAAGGAGGAGGGTGG + Intronic
1127630895 15:60826661-60826683 TTTCCCATGGAGGAGGAGGAGGG + Intronic
1128245340 15:66128844-66128866 TCTCCTTGGCAGGAGGGAGTAGG - Intronic
1129208263 15:74050228-74050250 GCTCCTCTGTAGGAGGAAGATGG - Intergenic
1129229932 15:74191431-74191453 CCTCCTTTGCAGGAAGAAGCTGG - Exonic
1130181045 15:81628909-81628931 TGTCCTTTGCAGGGCGCGGATGG + Intergenic
1130234807 15:82124321-82124343 TCTCCTTTGCAGTAGGCAGGAGG - Intergenic
1130312707 15:82769118-82769140 TCTCTTTTGTGGGAGGAAGAAGG - Intronic
1130722960 15:86407966-86407988 ACTCCTCTGCAGGAGGGAGAAGG + Intronic
1131203993 15:90426095-90426117 TCTCCTTTGGTGCAGGTGGATGG + Exonic
1131505311 15:93012875-93012897 TCTCCTTTGGAATAGGGGGATGG + Intronic
1132230698 15:100181722-100181744 TCTCTCCTGAAGGAGGAGGAAGG + Intronic
1132327734 15:100985827-100985849 ACTCCTTTGCAGGAAGTGCAGGG - Intronic
1132355423 15:101168039-101168061 CTTCCTCTTCAGGAGGAGGAGGG + Intergenic
1132596970 16:756818-756840 TCTACTTGGGAGGAGGAGGTGGG - Intronic
1132621324 16:869531-869553 TCAGCTACGCAGGAGGAGGAAGG - Intronic
1133129114 16:3665267-3665289 TCTCCCCAGCAGCAGGAGGAGGG - Exonic
1133442098 16:5829473-5829495 TGTCATTTGGGGGAGGAGGAGGG + Intergenic
1134136798 16:11681832-11681854 TGTCCTTGGGAGGAAGAGGAAGG - Intronic
1134371846 16:13633288-13633310 TGTACTTTGCAGATGGAGGAAGG + Intergenic
1135024621 16:18989554-18989576 CCACCCTTGGAGGAGGAGGAAGG + Intronic
1135178910 16:20255924-20255946 TCTCCTTGGACGGTGGAGGATGG + Intergenic
1135933561 16:26760052-26760074 TCTCATTGGCATGAGGTGGAAGG - Intergenic
1136549123 16:30972942-30972964 GCACATCTGCAGGAGGAGGAAGG + Intronic
1137707384 16:50545060-50545082 TATCCTTTGGGGGAGGAGAATGG - Intergenic
1137782001 16:51105335-51105357 TCTCCATTGCAGGAGAAGTCAGG - Intergenic
1137846657 16:51696347-51696369 GCTCATATGCAGGAGGGGGAAGG + Intergenic
1138150445 16:54651625-54651647 TGCCTTTTGGAGGAGGAGGATGG + Intergenic
1139253503 16:65519286-65519308 GCTACATGGCAGGAGGAGGATGG + Intergenic
1140509815 16:75498910-75498932 TGTCCTTTGCAGGAAGGGGGAGG + Intergenic
1140515611 16:75539118-75539140 TGTCCTTTGCAGGAAGGGGGAGG + Exonic
1141652140 16:85398368-85398390 CCTCCTGAGCAGGAGGTGGAGGG + Intergenic
1142976485 17:3647726-3647748 TTTCCCTGGCAGGAGAAGGAAGG + Intronic
1143114775 17:4576325-4576347 CCTGCTTTGGAGGAGGAAGATGG + Intergenic
1143139776 17:4735116-4735138 TGTGCTGTGCAAGAGGAGGAGGG - Exonic
1143435510 17:6921725-6921747 CCGCCTTTTCAGGAGGAGGAAGG + Intronic
1143682609 17:8488597-8488619 TCCTCTTTGCAGGAAGCGGAAGG - Intronic
1143735952 17:8912128-8912150 TCTCCTCAGTAGGATGAGGAAGG - Intronic
1144716734 17:17441470-17441492 TTTCCTTTGGTGGTGGAGGAAGG + Intergenic
1145235533 17:21205447-21205469 TCTCCGCTGCAGGAGGAGGCAGG + Intronic
1145715557 17:27016699-27016721 TGTCCTTTGCAGGATGAAGCTGG - Intergenic
1145790525 17:27623927-27623949 TTTCCTCTGCAAGACGAGGAAGG - Exonic
1146890041 17:36501000-36501022 TCTCCTCAGCAGGAGGGGGCAGG - Intronic
1146909381 17:36638710-36638732 TCTCCATTGCAGCAGCACGAAGG + Intergenic
1148143001 17:45341717-45341739 TCTCCTTTGCCAGAGGAGGATGG + Intergenic
1148578542 17:48727910-48727932 TTTCCCTGGGAGGAGGAGGAGGG - Intronic
1149656193 17:58310741-58310763 TCTCTGTTCCAGGAGGAGGCTGG - Exonic
1150436233 17:65156436-65156458 TCACCTGTGCAGGAGGAACAAGG - Intronic
1151353718 17:73546231-73546253 TCTCCTGTGCAGGCGGATGCAGG + Intronic
1151540778 17:74763641-74763663 CCTCCCATGAAGGAGGAGGAGGG - Intronic
1151550150 17:74818025-74818047 TCTCTTTTGAAGGATGAAGAGGG - Intronic
1151973777 17:77472474-77472496 GCTCCTTTGCAGGACCTGGAAGG - Intronic
1152216872 17:79038375-79038397 CCCCCTTTACAGGAGGAGGGAGG - Intronic
1152501947 17:80717990-80718012 TCTTCTTTGCAAAAGGAGAAAGG + Intronic
1153468621 18:5417386-5417408 TTTCCTCTGCAGGTGGCGGAGGG + Intronic
1154030403 18:10748539-10748561 TCTTCTTTGCAGCAGGAGGAAGG + Exonic
1154302811 18:13209246-13209268 TGTCCTTTGCAGGATGTGGATGG - Intergenic
1154472406 18:14717373-14717395 TGTCCTTTGCAGGATGAAGCTGG + Intergenic
1155512776 18:26594184-26594206 CTTCCCTAGCAGGAGGAGGAAGG - Intronic
1155988759 18:32257579-32257601 TCTCCTAGGCAGATGGAGGAAGG - Intronic
1156503104 18:37572202-37572224 CCTCCTTTGTAGGAGGTGGGAGG - Intergenic
1158171821 18:54608385-54608407 TTTCCTTTTCAGTAGGAGGTAGG + Intergenic
1158836286 18:61334224-61334246 TCCCCTCTGCAGGCGGAGGGAGG - Intronic
1159937722 18:74382335-74382357 TCTGCTCTGCGGGAGGAGAAGGG - Intergenic
1160081765 18:75734559-75734581 TGTCCTTTGCAGGACATGGATGG - Intergenic
1161447834 19:4328119-4328141 ACTCCTTTGCAGGAAGAGCCAGG - Intronic
1164851748 19:31489895-31489917 TCTCATTTGCTGGGGGTGGAGGG + Intergenic
1165139472 19:33690121-33690143 TCTGCTTTGGAGGGAGAGGAGGG + Intronic
1165373614 19:35425978-35426000 TCTCTTGAGCAGGAGCAGGATGG + Intergenic
1165738530 19:38192588-38192610 TATCCTGGGCTGGAGGAGGAGGG - Intronic
1165824045 19:38695485-38695507 TCCCCCTGGCAGGAAGAGGAAGG - Intronic
1166039268 19:40192026-40192048 TCCCCCATGGAGGAGGAGGAGGG + Exonic
1166643565 19:44514381-44514403 TCTGCTTTGGAGGGGCAGGAGGG + Intronic
1167698231 19:51027209-51027231 TCTCCTTTGCAAGGAGAGGGGGG + Intronic
1167708025 19:51093400-51093422 ATTCTTTTGCTGGAGGAGGAAGG - Intergenic
1168197608 19:54787128-54787150 TCAGCTTTGAAGGTGGAGGAAGG + Intronic
925678434 2:6391121-6391143 TCTCCTTTTCATGAGAAGCACGG + Intergenic
926867515 2:17375945-17375967 TATATTTTGGAGGAGGAGGAAGG - Intergenic
928130062 2:28642839-28642861 TCTCCTGTGGAGGAGGAGCGGGG - Exonic
929057211 2:37888699-37888721 TGCACTTTGCAGGTGGAGGAAGG + Intergenic
929440829 2:41964830-41964852 TCTCCTGTGCAAGAGGAGTTGGG + Intergenic
929820393 2:45268942-45268964 CCCCCTTTGCAGGGTGAGGATGG - Intergenic
930875804 2:56214236-56214258 TCTCATTTGTAAGAAGAGGATGG + Intronic
931077969 2:58737464-58737486 TCACATTTGCAGGAGGAAGATGG - Intergenic
931117925 2:59184523-59184545 TGGCCTTTGCATGAGGGGGAGGG + Intergenic
932128976 2:69170262-69170284 TCTCCTCGGCAGGGGGTGGAGGG - Exonic
932750909 2:74371166-74371188 TCTCCTTTGCAGGAGGAGGAGGG - Exonic
932970665 2:76537218-76537240 TCTCCTTAGCAGGAGGAATAGGG - Intergenic
933194349 2:79371626-79371648 CCTACTTTGCAGGAGGAACATGG + Intronic
933646160 2:84814216-84814238 TCCCATTGGCAGGAGCAGGAAGG + Intronic
934184580 2:89660188-89660210 CCTTCTTTGCAGGAGATGGATGG + Intergenic
934294862 2:91734326-91734348 CCTTCTTTGCAGGAGATGGATGG + Intergenic
934652056 2:96098417-96098439 CCTCCTTGGCAGAACGAGGAAGG + Intergenic
934916958 2:98308244-98308266 TTTCCTTTGCAGCATGACGACGG + Intronic
935085656 2:99842115-99842137 TGTCCTTAGAAGTAGGAGGATGG + Intronic
936536085 2:113312417-113312439 ACACCTTCGCAGTAGGAGGAGGG + Intergenic
936651565 2:114433228-114433250 TCTCCTTGGCAGGGTGATGAGGG + Intergenic
937290775 2:120780527-120780549 TCCCCTTCCCAGCAGGAGGAGGG + Intronic
937413527 2:121696804-121696826 TCTCCTTTCCTGCTGGAGGATGG + Intergenic
937874163 2:126808617-126808639 TCTTTTTTGGTGGAGGAGGAAGG + Intergenic
937986995 2:127642461-127642483 TCTGGTTTGGAGGAGGAGGGGGG - Intronic
938082738 2:128378866-128378888 GCTCACTTCCAGGAGGAGGAAGG + Intergenic
938382923 2:130846685-130846707 TTTCTTTAGCAGAAGGAGGAAGG + Intronic
938556502 2:132429557-132429579 TCTCATTTGGAAGAGAAGGATGG + Intronic
938714799 2:134009692-134009714 ACTCCTATGCAAGAGGAGGCAGG - Intergenic
941183580 2:162291633-162291655 TGACCTCTGGAGGAGGAGGAAGG + Intronic
942624868 2:177889228-177889250 TCTCCTGTGCTGGAGGACAATGG - Intronic
944128419 2:196319430-196319452 TCTTCCTTGGAGGAGGAGGGAGG - Exonic
944561270 2:200940902-200940924 TTTCTTTTGCAGGGGGAAGAGGG - Intronic
944802867 2:203253385-203253407 TCTCCTTTGCCTCTGGAGGATGG - Intronic
945545870 2:211150974-211150996 TCTACTTTCCTGGAAGAGGAAGG - Intergenic
946652964 2:221913926-221913948 TCTCCTGTGCACTGGGAGGATGG - Intergenic
946956229 2:224932744-224932766 TGTACTTTGCAGAATGAGGAAGG - Intronic
947218239 2:227768394-227768416 TCTCCTTTTCAGGAGCTGCAGGG + Intergenic
947284241 2:228493975-228493997 ACTCCTTTACAGGAGGAATAAGG - Intergenic
948564164 2:238873022-238873044 TCTCCTTGGCTGGATGTGGATGG - Intronic
949026364 2:241768174-241768196 CCTCCTTTGCAGGGCGAGGTGGG + Exonic
1169097192 20:2912510-2912532 GCTCCTTTGCAGGCTGAGGCAGG + Intronic
1170728028 20:18947290-18947312 TGTGCTTTGCAGGAGGTGGTGGG - Intergenic
1171090508 20:22281675-22281697 TCTGCCTTGCACAAGGAGGAAGG - Intergenic
1171120324 20:22562889-22562911 TTTCTTTTGGAGGAGGAGGTAGG - Intergenic
1172213049 20:33214418-33214440 TCACCTTTGTGGGATGAGGACGG + Intergenic
1173756288 20:45519303-45519325 TCTCTTTTGTAGAAGGAAGAAGG + Intergenic
1173925563 20:46778709-46778731 TGGCCTTTGCAGGAAGAGGGAGG - Intergenic
1174510785 20:51050748-51050770 TCTCCTTTGGAGCGTGAGGAGGG + Intergenic
1174702458 20:52622694-52622716 ACTCCTCTTCAGGAGAAGGAAGG + Intergenic
1175278407 20:57787418-57787440 TCTCCCCTGGGGGAGGAGGAAGG - Intergenic
1175381258 20:58565995-58566017 CTTCCTTTGCAGGAGGGGCAGGG + Intergenic
1175414203 20:58790864-58790886 TCTCCTTAGCAAGTGGAGGGTGG - Intergenic
1175485347 20:59342183-59342205 TGTCCTTTGCAGGGGGAGCTTGG + Intergenic
1176802085 21:13440526-13440548 TGTCCTTTGCAGGATGAAGCTGG - Intergenic
1177204248 21:17993519-17993541 TGTCCTTTGCAGGAACATGATGG - Intronic
1180800624 22:18630272-18630294 GGGCCTTTGGAGGAGGAGGAAGG - Intergenic
1180817070 22:18797189-18797211 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1180851856 22:19025829-19025851 GGGCCTTTGGAGGAGGAGGAAGG - Intergenic
1181203259 22:21231534-21231556 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1181221095 22:21364990-21365012 GGGCCTTTGGAGGAGGAGGAAGG + Intergenic
1181639894 22:24190880-24190902 TCCCCTTTCCAGCAGGAGAAAGG + Intergenic
1181683074 22:24509263-24509285 TCTCCTATGCAGGGGATGGAGGG - Intronic
1182249172 22:28985969-28985991 TGTGCTTTGAAGGTGGAGGAGGG - Intronic
1184380098 22:44140112-44140134 TCTTGTTTGCAGGATGATGATGG + Exonic
1184967486 22:47991371-47991393 TCCCCTTTGCAGCAGGTGCAAGG + Intergenic
1203223660 22_KI270731v1_random:63890-63912 CCTTCTTTGCAGGAGATGGATGG + Intergenic
1203267169 22_KI270734v1_random:22910-22932 CCTTCTTTGCAGGAGATGGATGG - Intergenic
949214123 3:1544790-1544812 TGACCTTTACAGGAGGAGTAAGG + Intergenic
949731207 3:7115461-7115483 TCTCATTGGCAGGAGCAGCAAGG - Intronic
949822095 3:8126500-8126522 TCTCTTTTGCAGCACAAGGAAGG + Intergenic
950383185 3:12634800-12634822 TCCCCTTTGGAGGAGGTGAATGG + Intronic
950484487 3:13265033-13265055 TCTGCTTTCCAGGGGGAGAAGGG - Intergenic
951045199 3:18029850-18029872 TCTTCTTGGAAGGAGGAGAAAGG + Intronic
951047707 3:18059409-18059431 TCTCCATTGCAGGTGGGAGAAGG + Intronic
951854875 3:27185176-27185198 TCTACTTTGGAGGAGCAGGCTGG - Intronic
952006898 3:28851440-28851462 TCATGTTTGCAGGAGTAGGAAGG + Intergenic
952109863 3:30109681-30109703 TCTCCTTTGTGGGAGGAGAAGGG + Intergenic
953040834 3:39253548-39253570 TTTCCTGGGCAGGAGGAGGCAGG + Intergenic
954122713 3:48509223-48509245 TCTCATTTGCATCAGAAGGATGG - Intergenic
954286742 3:49624853-49624875 TCTTCTGGGCAGGAGGAAGAGGG + Intronic
954675518 3:52313374-52313396 TTCCCTTTACAGGAGGAGGAGGG - Intergenic
955111600 3:55956574-55956596 TATCCTTTCCAGGAAGAGAAAGG + Intronic
955457015 3:59133836-59133858 TCTCCTATGTAGGTAGAGGAAGG - Intergenic
955871056 3:63438913-63438935 TCTTCATTGCAGTAGGAGAAAGG - Intronic
956687811 3:71847400-71847422 TATCATTTGCAGGAGATGGAGGG - Intergenic
956802415 3:72772275-72772297 TCTACTTGGCAGGAGAGGGAGGG + Intronic
957254016 3:77813423-77813445 ACTACTCTGCAGGAGGAGGAAGG + Intergenic
959213109 3:103414480-103414502 TCTCCTTTGCAGCAACATGATGG + Intergenic
959869843 3:111313707-111313729 TCTTCTTTGTAAGAGTAGGAAGG + Intronic
960085904 3:113591103-113591125 TATACTTTGCAGATGGAGGAAGG + Intronic
960524060 3:118689522-118689544 TATCCTTTACAGCAGGAGGATGG - Intergenic
961184857 3:124905871-124905893 GCTCCTTTGCTGATGGAGGAGGG + Exonic
961381105 3:126497095-126497117 TCACCTGTGGAGGAGGAGGCGGG - Intronic
962110758 3:132444119-132444141 TCTCATGTGCAGGAGGTGGATGG - Intronic
962154006 3:132924887-132924909 GCTCCTTTGCGGGGGGAGGGGGG - Intergenic
963532545 3:146489006-146489028 TGTCCTTTGCAGGACATGGATGG + Intronic
964016208 3:151950224-151950246 TGTTCTTTGCAGGAACAGGATGG + Intergenic
964290971 3:155179595-155179617 TGGCCTTAGCAGGAGGAGAAGGG + Intronic
965419085 3:168434789-168434811 TCTCTTTTTCAAGCGGAGGATGG - Intergenic
965642659 3:170846967-170846989 TTTCCTTTTGAGGAGGACGATGG + Intronic
966485449 3:180464041-180464063 TCTCCTTTATAGAAGTAGGAAGG + Intergenic
966775412 3:183539135-183539157 TCTCCTTCTCAGGAGGAAGTAGG - Intronic
966849570 3:184156134-184156156 GCTCCTCGGCAGGAGGAGGATGG - Intronic
967580355 3:191145899-191145921 TGTCCTTTGCAGGGACAGGAGGG - Intergenic
968875296 4:3263606-3263628 TCTCCCGTTCAAGAGGAGGAGGG - Intronic
968983361 4:3862850-3862872 TCTCCATTGTAGGAGGACGCAGG + Intergenic
969455375 4:7297139-7297161 TCTCCTCTGCATTAGGTGGAGGG + Intronic
969641148 4:8399461-8399483 TCTCCTTTCCAGGTGCAGGGAGG + Intronic
969842595 4:9893388-9893410 TCTCATTTGCAGGGGGAGGGCGG + Intronic
970652673 4:18195829-18195851 ACTCCTATGGAGGAGGAGCAGGG - Intergenic
970777531 4:19694024-19694046 TCTGCTTTGCAAGAGAAGGCAGG + Intergenic
972573768 4:40333516-40333538 ACTCCATTCCAGGAGGATGATGG - Intergenic
973272311 4:48273814-48273836 TTTCCTTTTCAGTAGGAAGATGG - Intergenic
974392200 4:61285889-61285911 TCTCCTTTGCATGAGTTGGAGGG - Intronic
975229177 4:71910759-71910781 TGTCCTATGCAGCAGGAGCAGGG + Intergenic
976224081 4:82781458-82781480 TCTCCTTTCCAAGAGAAGGGAGG + Intronic
976521577 4:86033949-86033971 TCTCCTTAGCGGAAGGAGGCAGG - Intronic
977609350 4:99016396-99016418 TCTACTCTCCTGGAGGAGGAGGG + Intronic
977615136 4:99080190-99080212 TTTTCTTTGCAGCAGGAGGGAGG + Intronic
979452067 4:120884720-120884742 TGTTCTTTGAAGGAGGAGGATGG - Intronic
981470988 4:145134706-145134728 TCTCCTTGGCAGCAGGATGCTGG - Exonic
981618711 4:146669924-146669946 TCTACTCTGGAGGATGAGGAAGG - Intergenic
982786075 4:159538347-159538369 TTTCTTTTGCAGGAGCAAGAAGG + Intergenic
983630174 4:169842017-169842039 ACTCCTTGGCAGCAGCAGGATGG + Intergenic
984709362 4:182872260-182872282 GCTGCTTTGCAGATGGAGGAAGG - Intergenic
984946579 4:184973353-184973375 TCTCCTGTGGAGGTGCAGGAAGG - Intergenic
984983674 4:185306852-185306874 ACTCCTTTGTGGGAGGATGAAGG - Intronic
985858730 5:2452451-2452473 TCCCCTTTTCAGTGGGAGGAGGG - Intergenic
986904207 5:12473666-12473688 TGTTCTTTGCAGGATCAGGATGG + Intergenic
988523511 5:31966776-31966798 TATCCTTTGCTTGGGGAGGAAGG + Intronic
988661087 5:33269349-33269371 TCTCCTTTGCATGTGGTAGAAGG - Intergenic
988683203 5:33503178-33503200 TCTCTGTGGCAGGAGGAGGGTGG - Intergenic
989284839 5:39687575-39687597 TTTCCTTTGGAGGAGGAGAGGGG + Intergenic
989835935 5:45991239-45991261 TTTCCTTTGAAGGAGCAGGTTGG + Intergenic
990052781 5:51528890-51528912 CATCCTTTGCAGCAGGAGGTGGG + Intergenic
990739734 5:58900188-58900210 TCTCCCATGCAGCTGGAGGATGG - Intergenic
991535031 5:67660377-67660399 TCACCTTTCCAGGAGGCGGTTGG - Intergenic
992255525 5:74917202-74917224 TCTCATTGGCAGGAAGTGGAAGG - Intergenic
993071139 5:83165787-83165809 TGTCCTTTGCAGGACATGGATGG - Intronic
993820605 5:92611011-92611033 TATCCTTTGCAGGACATGGATGG + Intergenic
994709708 5:103252479-103252501 TGTACTTTGCAGGAGGAATAGGG + Intergenic
995657592 5:114444297-114444319 ACCCCTTCTCAGGAGGAGGAGGG + Intronic
996213974 5:120845318-120845340 TCTCATTTGCAGGATGAAGAGGG + Intergenic
997606642 5:135179612-135179634 TCTACCTCGCAGCAGGAGGAGGG + Intronic
997682032 5:135763527-135763549 TATTCTATGGAGGAGGAGGAGGG + Intergenic
999153456 5:149441939-149441961 GCTCCTGTGCAGCTGGAGGAAGG + Intergenic
999508958 5:152227658-152227680 TCTCCTTTGGTGGAAGCGGATGG + Intergenic
999673186 5:153975215-153975237 TCTCCCTGGCAGGAGGACAAAGG - Intergenic
1000045166 5:157516345-157516367 TCTCCTTTGTAAGAGAAAGATGG + Intronic
1000514338 5:162221000-162221022 TCTGCTTTGCACAAGGAAGAAGG - Intergenic
1000668121 5:164024329-164024351 TGTCCTTTGCAGGAACTGGATGG - Intergenic
1001303753 5:170556517-170556539 TCTCCTCTCCAGGAGGTGGGGGG + Intronic
1001448862 5:171808654-171808676 TGTCCTTTGCAGAACGTGGATGG + Intergenic
1001955324 5:175844783-175844805 GTGCCTTTGCAGGGGGAGGAAGG + Intronic
1001964775 5:175902515-175902537 TCTCATCTGCACCAGGAGGACGG + Intergenic
1002097680 5:176840998-176841020 TCTCCGGTGAAGGAGGTGGATGG - Intronic
1002252175 5:177936673-177936695 TCTCATCTGCACCAGGAGGACGG - Intergenic
1003441259 6:6144745-6144767 TCTCCTTTGCAGAATGATGCAGG - Exonic
1003788640 6:9516652-9516674 CTTCCTTGGCAGGAGGAGGAAGG + Intergenic
1004013603 6:11712093-11712115 TCCCCGTTACAGGAGGAGGAAGG - Intronic
1004534827 6:16490519-16490541 TGACCTTTGGAGGAGAAGGAAGG - Intronic
1005592904 6:27347732-27347754 TCCCCATTGCAGGAGGAGTAGGG + Intergenic
1006514142 6:34536700-34536722 ACTCCCTTGTAGGAGGAGGGTGG - Intergenic
1006611877 6:35298910-35298932 TCTCCTTTGGAGGATGGGGCAGG - Intronic
1007169905 6:39855696-39855718 TCTCCAGAGCAGGAGGAAGACGG - Intronic
1007452438 6:41950478-41950500 TCTCATTTGCAAAAGGAGGATGG + Intronic
1007839672 6:44705502-44705524 TCTCCTTTCCAGGAAGATGGTGG - Intergenic
1008186252 6:48394639-48394661 TGTCCTTTGCAGGAACATGATGG - Intergenic
1008725670 6:54415338-54415360 TGTCCTTTGCAGGAACATGATGG - Intergenic
1009888430 6:69652699-69652721 TGTTCTTTGCAGGAGGATGTTGG - Intergenic
1010743347 6:79533331-79533353 TGTTCGTTGCAGGAGGAGGGGGG + Intronic
1013091740 6:106906427-106906449 TCTGCTTTGCAGCAGGACAAAGG + Intergenic
1013208188 6:107963481-107963503 TCTTCATGGCAGGAGGAGAAGGG - Intergenic
1013720369 6:113019078-113019100 TCTCCCTGCCAGGAGCAGGAGGG - Intergenic
1015218037 6:130772792-130772814 ACTCCTTTGCTTGTGGAGGATGG + Intergenic
1015904790 6:138106276-138106298 TCTCCTTTCCTGGGGGTGGATGG - Intronic
1016017518 6:139201062-139201084 TCTCCTGTGAATGAGGAAGAGGG - Intergenic
1016733938 6:147455627-147455649 TCTGTTATGGAGGAGGAGGAAGG + Intergenic
1017159484 6:151351449-151351471 ACTCCGGTGCAGGAGGTGGAAGG + Exonic
1018850822 6:167589084-167589106 GCTCCTCTGAAGGAGGAGGATGG - Intergenic
1020136660 7:5591838-5591860 TCCCCTTTGGGGGAGGAGGATGG + Intergenic
1020536734 7:9407629-9407651 TGTCCTTTGCTGAAGGATGATGG + Intergenic
1020823274 7:12997050-12997072 TGTCCTTTGCAGGATGAAGCTGG - Intergenic
1022153596 7:27636073-27636095 TCTGCTTTGCAGCATGAGGAGGG + Intronic
1022294348 7:29035865-29035887 TATCCTTTGCCAGAGGAGGCAGG - Intronic
1024016932 7:45325627-45325649 TCACCTTAGCAGGAAGTGGAGGG + Intergenic
1024568488 7:50704704-50704726 TCTCTTTTGCATGAATAGGAGGG - Intronic
1024946426 7:54812308-54812330 TCTCCTATTCAGTAGGAGGGTGG - Intergenic
1026148808 7:67771149-67771171 GCTCCTTTGGAGGTTGAGGAGGG - Intergenic
1026639660 7:72113206-72113228 TCTCTCTGGGAGGAGGAGGAGGG + Intronic
1026869577 7:73842210-73842232 CCTCCTCTGAAGGGGGAGGAGGG - Intronic
1027236781 7:76303082-76303104 TCTCCCCTGCAGGAGCAGGGGGG - Intronic
1028071018 7:86450922-86450944 TCACATTTCCAGGAGGAAGAAGG + Intergenic
1028305379 7:89256800-89256822 TTTCCTCTGGAGGAGGAGGATGG + Intronic
1029046357 7:97633184-97633206 GCTCCTTTGCAGGAAAAAGAAGG + Intergenic
1029251339 7:99238882-99238904 TCTCCTTTTCAGGAGGTGCCAGG - Intergenic
1029259783 7:99294006-99294028 CCTCATTTGCAGGAGGAAGCTGG + Intergenic
1030086756 7:105822340-105822362 TCTCCTGTGAATGGGGAGGATGG + Intronic
1031999298 7:128254385-128254407 ACTGCTATGCAGGAGGAAGAGGG - Exonic
1032420643 7:131776285-131776307 CCACCATTGCAGTAGGAGGAGGG + Intergenic
1035110347 7:156476351-156476373 TTTCTTTTGGAGGAGAAGGAAGG - Intergenic
1035672955 8:1434093-1434115 GCTGCTTTGCAGGTGGAGCATGG + Intergenic
1035917522 8:3641290-3641312 CCTCCTGTGCAGGTGGAGAACGG + Intronic
1037014967 8:13892608-13892630 TTTCCTTATCAGGATGAGGATGG + Intergenic
1037577667 8:20223312-20223334 TCTCCTTTGTAGGAGCCTGAGGG + Intronic
1037876175 8:22549730-22549752 ACAGCTTTGCAGGAGGAGGCGGG - Intronic
1038382420 8:27108838-27108860 CCTCATTTGCAGGAGCAGGCAGG + Intergenic
1039451205 8:37676363-37676385 TCTCCTGTGAGGGAGAAGGAAGG - Intergenic
1039557688 8:38488416-38488438 TGACCTCTGTAGGAGGAGGAAGG + Intergenic
1040459442 8:47633392-47633414 TCTTCTTTATAGGAGGGGGATGG + Intronic
1041435820 8:57840639-57840661 TCTCCTTTAGAGGAGAAAGATGG - Intergenic
1042306258 8:67336657-67336679 TGTCCTTTTAAGGAAGAGGAAGG - Intronic
1042312617 8:67393830-67393852 TCTCCCTCGCAGGAGAGGGAAGG + Intergenic
1043001536 8:74766019-74766041 TGTCCTTTGCAGGAACAGGATGG + Intronic
1043510695 8:80947399-80947421 GCTGCTTTGCAGATGGAGGAAGG - Intergenic
1044639442 8:94363104-94363126 ACTCATTTCCAGGAGGAAGAAGG - Intergenic
1044931132 8:97252707-97252729 TCTTCTAAGCAGGAGAAGGATGG - Intergenic
1045504531 8:102769179-102769201 TCTGATTTGAAGGAGGAGGATGG - Intergenic
1045960704 8:107964690-107964712 TCTGCTTTGCAGGGGGTGGGGGG + Intronic
1046271161 8:111899213-111899235 TCTCGTGTGCAGCAGCAGGATGG - Intergenic
1047561470 8:125991657-125991679 TCTACTTTTCCAGAGGAGGAGGG - Intergenic
1047731742 8:127734413-127734435 TCTCTTTTGGAGGTGGTGGAGGG + Intergenic
1048237852 8:132709634-132709656 TGTGCTTTGGAGGTGGAGGAGGG + Intronic
1048794600 8:138138189-138138211 TCTCCTGTGGAGGAGGAGGAGGG - Intronic
1049222920 8:141436058-141436080 TCTGCCTTGCAGGAGCGGGACGG - Intergenic
1049647941 8:143744781-143744803 GCTCCTTGGCCGGAGGAGTAAGG - Intergenic
1050194910 9:3071959-3071981 TGTCCTTTGCAGGGACAGGATGG - Intergenic
1050237989 9:3603142-3603164 TGTCATATGCAGGAAGAGGAAGG - Intergenic
1050689948 9:8215137-8215159 TCTCCTTTGCAGGAGGAAACTGG - Intergenic
1050804030 9:9651545-9651567 TGTCCTTTGCAGGACATGGATGG - Intronic
1052807692 9:33026949-33026971 TGTTTTTTGGAGGAGGAGGAAGG + Exonic
1055360467 9:75484480-75484502 TGTCCATAGCAGGAGGATGAGGG - Intergenic
1055941994 9:81659287-81659309 TAGCCTTTGCAAGAGGTGGAAGG - Intronic
1056220714 9:84448358-84448380 TATCCTTTGAAGGTGGAGAAAGG + Intergenic
1056251672 9:84754788-84754810 TCTCTTTTGCTGGAGGCAGATGG + Intronic
1056308349 9:85313686-85313708 TCTATTTTGCAGGAGGAATAAGG - Intergenic
1056384185 9:86081922-86081944 TTTCCTTTGGAGTAGGATGAGGG - Intronic
1056806416 9:89732415-89732437 TTTACTGTGCAGGTGGAGGAAGG + Intergenic
1058549369 9:106097549-106097571 TGTCCTTTGCAGGACATGGATGG + Intergenic
1058995180 9:110292381-110292403 CCTCCTTTGCAGGACGAGGTGGG - Intergenic
1059901285 9:118928939-118928961 GCTGCTTTGCAGGAGAAAGAAGG + Intergenic
1060184252 9:121554204-121554226 CCAACTTTGCAGGAGGAGGCAGG + Intergenic
1060522382 9:124301068-124301090 TCTCCTTCTGGGGAGGAGGAGGG + Intronic
1060676577 9:125520744-125520766 TCTACTTTGGAGGAAGAGGTAGG - Intronic
1061526635 9:131170342-131170364 TTTCCTTTGAAGGCTGAGGAAGG - Intronic
1061657222 9:132101695-132101717 TGTGCTTTGAAGGTGGAGGAAGG - Intergenic
1062107438 9:134763681-134763703 TCTCCTCTGCAGGGTGACGACGG + Exonic
1062197586 9:135282823-135282845 CCTCCTTGGCAGAAGGAGGTTGG + Intergenic
1062581867 9:137232367-137232389 CCTCCCTCGCAGGAGCAGGAGGG - Intronic
1062594524 9:137293080-137293102 TCTCCTTTGCCAGAGGAAGGAGG - Intergenic
1186188799 X:7048750-7048772 TCACCACTGCAGGAGCAGGACGG + Intergenic
1186288710 X:8072927-8072949 TGTGCTTTGAAGGTGGAGGAAGG + Intergenic
1186428987 X:9488396-9488418 GCTCCTCTGCAGATGGAGGAAGG - Intronic
1186807731 X:13156565-13156587 TATGCTTTGCAGATGGAGGAAGG + Intergenic
1186898849 X:14032098-14032120 TCTCCTGGGCTGGGGGAGGAGGG + Intergenic
1187118199 X:16375214-16375236 TGTGCTTTGAAGGTGGAGGAAGG - Intergenic
1187640561 X:21284263-21284285 TGTCCTTGGCAGGACGTGGATGG + Intergenic
1187675338 X:21710900-21710922 TCTTCTTTGCAGAAGGAGCCAGG + Intronic
1190221888 X:48517111-48517133 TCCCCCGTGCAGGAGGAGGTGGG + Intronic
1191101117 X:56729539-56729561 TCTACTTCTCCGGAGGAGGAGGG - Intergenic
1191956678 X:66649874-66649896 TTTCCTTTGTAGGAGGAGAGGGG + Intergenic
1192660417 X:73036731-73036753 TTTCCTTTGGAGGAGGAGATGGG + Intergenic
1193087638 X:77461334-77461356 CAGCCTTTTCAGGAGGAGGAAGG - Intergenic
1194172585 X:90605807-90605829 TTTCCTTTGCAGGACATGGAAGG - Intergenic
1195425878 X:104729809-104729831 TGTCCTTTGCAGGAACATGATGG - Intronic
1195837402 X:109132600-109132622 TCTCCTTGGGATGAGGAGAAAGG - Intergenic
1200137783 X:153883360-153883382 TCTGCCTAGAAGGAGGAGGAAGG + Intronic
1200518812 Y:4183544-4183566 TTTCCTTTGCAGGACATGGAAGG - Intergenic
1201942484 Y:19474737-19474759 TTTCCTTTCCAGTTGGAGGATGG + Intergenic
1202275668 Y:23117094-23117116 TGTCTTTTGCAGGAAGTGGATGG + Intergenic
1202290360 Y:23303597-23303619 TGTCTTTTGCAGGAAGTGGATGG - Intergenic
1202428660 Y:24750813-24750835 TGTCTTTTGCAGGAAGTGGATGG + Intergenic
1202442131 Y:24919276-24919298 TGTCTTTTGCAGGAAGTGGATGG - Intergenic