ID: 932752773

View in Genome Browser
Species Human (GRCh38)
Location 2:74382042-74382064
Sequence TAGAAAGCACAGAGGGCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 315
Summary {0: 1, 1: 1, 2: 1, 3: 33, 4: 279}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932752773_932752783 19 Left 932752773 2:74382042-74382064 CCCAGAGCCCTCTGTGCTTTCTA 0: 1
1: 1
2: 1
3: 33
4: 279
Right 932752783 2:74382084-74382106 CAGACATATCTAGGCTTCCAAGG 0: 1
1: 0
2: 0
3: 10
4: 111
932752773_932752781 10 Left 932752773 2:74382042-74382064 CCCAGAGCCCTCTGTGCTTTCTA 0: 1
1: 1
2: 1
3: 33
4: 279
Right 932752781 2:74382075-74382097 CCATTACCACAGACATATCTAGG 0: 1
1: 0
2: 0
3: 10
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932752773 Original CRISPR TAGAAAGCACAGAGGGCTCT GGG (reversed) Intronic
900353731 1:2249664-2249686 GAGCCAGCACAGAGGGCTCACGG + Intronic
900737432 1:4308010-4308032 GTGACAGCAGAGAGGGCTCTGGG - Intergenic
900881840 1:5387934-5387956 CACAAAGCTCACAGGGCTCTGGG + Intergenic
900894821 1:5475743-5475765 AACAAAACACAGAGGACTCTGGG - Intergenic
900994484 1:6113038-6113060 CAGAAAACACAGAGGACTCTGGG + Intronic
902598794 1:17527017-17527039 TAGAAAGCAGAGTGGGATCCCGG - Intergenic
902894497 1:19469571-19469593 GAGTCAGCTCAGAGGGCTCTGGG + Intronic
903660169 1:24972270-24972292 GAGTGAGCTCAGAGGGCTCTGGG - Intergenic
903660174 1:24972299-24972321 GAGAGAGCTCAGAGGGCTCTGGG - Intergenic
903690698 1:25171430-25171452 CGGCAAGCACAGAGGCCTCTGGG - Intergenic
905366624 1:37455093-37455115 TGGCCAGCACTGAGGGCTCTGGG + Intergenic
905456486 1:38091725-38091747 TAGAAAGCACTCTGGCCTCTTGG + Intergenic
905901687 1:41585593-41585615 CAGAAGGCAAAGTGGGCTCTGGG + Intronic
906061573 1:42952556-42952578 CAGACAGCACACAGGGCTGTGGG + Intronic
907182562 1:52583680-52583702 AAGAAAGCAGAGGGGACTCTGGG - Intergenic
909861501 1:80611455-80611477 TGGAAAGCTGAGAGGGCTTTGGG - Intergenic
913177432 1:116287731-116287753 CAAATATCACAGAGGGCTCTTGG - Intergenic
913281703 1:117191256-117191278 AAGAAAGCACAGAAGACTTTTGG + Intronic
914247544 1:145897211-145897233 TAGGATGAAAAGAGGGCTCTAGG - Intronic
914668150 1:149849720-149849742 TAGAAAGCGCAGAAGGTTATCGG + Intronic
914853995 1:151336797-151336819 TAGTGAGCACAGAGTGCTGTGGG - Intergenic
914897992 1:151694050-151694072 TAGAAAGAACATTGGGCTCTGGG + Exonic
915348062 1:155208077-155208099 TAGAAAGCAGGGAGGCCTCCAGG - Intronic
915648884 1:157293364-157293386 CAGGAAGGACAGAGGTCTCTGGG - Intergenic
915661820 1:157411211-157411233 CAGGAAGGACAGAGGTCTCTGGG + Intergenic
916821617 1:168404221-168404243 AAGAAAGCACAGAGGTCTGGTGG + Intergenic
917438419 1:175044423-175044445 TAGAAACCACAGAGGCAACTCGG + Intergenic
918355836 1:183706086-183706108 TAGAAGCCCCAGAGGGGTCTGGG + Intronic
918606307 1:186431059-186431081 TTTAAAGCACAGGTGGCTCTTGG + Intergenic
919130826 1:193448448-193448470 CAGAAAGTACAGAGGGCCCCTGG - Intergenic
920972562 1:210755142-210755164 TAGGAAGCACAGAGTGGTCGGGG + Intronic
921718460 1:218444093-218444115 GAGAAAGCACAGAGGGCAATCGG - Exonic
921956081 1:220984220-220984242 TAGCAAGGACAGAGGGCTTTTGG - Intergenic
924059200 1:240154273-240154295 CAGATAGTACAGAGTGCTCTGGG + Intronic
1063472040 10:6295751-6295773 TAAAGAGAACAGAGAGCTCTGGG + Intergenic
1065703740 10:28450559-28450581 TCAAAAGCACAAAGTGCTCTAGG + Intergenic
1065822071 10:29534943-29534965 TAAAAAGCAAAGAGGGCTTTTGG + Intronic
1066184432 10:32995396-32995418 TAGCAAGAACACAGGGATCTCGG + Intronic
1067803449 10:49376418-49376440 TGGACAGCACATAGGGCTCCAGG - Intronic
1068265420 10:54642162-54642184 CAGAAGGCACAGACAGCTCTCGG - Intronic
1069075000 10:64030095-64030117 AAGAAAGCACTGAGTGCTTTGGG + Intergenic
1069808040 10:71138151-71138173 AAGGAGGCACAGTGGGCTCTGGG + Intergenic
1070972729 10:80580824-80580846 TGGACAGCTCAGAGGGCTTTGGG + Intronic
1071492862 10:86147905-86147927 GAGTAAGCCCAGTGGGCTCTGGG - Intronic
1071815903 10:89232587-89232609 TTGAAACCAAAGAGGGCCCTGGG + Intronic
1073934502 10:108614899-108614921 TACAAAACATAGAGTGCTCTTGG - Intergenic
1074418752 10:113290460-113290482 TAGAAAGAAAAGAGAGCCCTGGG - Intergenic
1076577634 10:131480561-131480583 TAGAAAGCTCAGAGGAATCCAGG + Intergenic
1077394931 11:2316068-2316090 TAGGAAGCCCCCAGGGCTCTAGG - Intronic
1077543429 11:3158385-3158407 TACAAAGCACAAACGGCTCTTGG + Intronic
1078109809 11:8383237-8383259 AAGAAGGCACACAGGGCTGTGGG + Intergenic
1079314617 11:19397118-19397140 GAGAAAACCCAGAGGGCTATGGG + Intronic
1079621215 11:22556985-22557007 TAGAAAGCACAGAGATCAATTGG + Intergenic
1079994368 11:27279985-27280007 AGGAAAGCACAGAGAGCTCTAGG + Intergenic
1080815300 11:35750100-35750122 TAGAAATGACAGAAGGCTCATGG - Intronic
1081590651 11:44420748-44420770 AAGAAATCACAGAAGGCTCTGGG - Intergenic
1082267125 11:50131234-50131256 TAGAAAGAACAGTGGGCCCAAGG + Intergenic
1082288964 11:50347334-50347356 TAGAAAGAACAGTGGGCCCAAGG - Intergenic
1083052797 11:59792100-59792122 GAGAAAGGACAGAGTGCTGTGGG - Exonic
1083236385 11:61353545-61353567 AAGTTAGCAGAGAGGGCTCTGGG + Intronic
1084556263 11:69878086-69878108 AAAAAAGCACAGAGGGCTGCAGG + Intergenic
1087214396 11:95479746-95479768 TAGAAAACAGCGAGGGCCCTCGG - Intergenic
1087598384 11:100283054-100283076 TAGAGAACTAAGAGGGCTCTTGG - Intronic
1091395317 12:150798-150820 TAGAGAGCAACGAGGGCTCAAGG + Intronic
1092476623 12:8824185-8824207 AAGAAAGCACTGAGGGCATTTGG + Intronic
1093616288 12:21229415-21229437 TAAAAAGCACAGTGGTCTCCAGG - Intronic
1094015035 12:25853704-25853726 CAGACAGCACAGAATGCTCTGGG + Intergenic
1096987850 12:55773455-55773477 AAGAAATCACAGAGGACTCTAGG + Intronic
1097722705 12:63040977-63040999 TAGAAGGCACACTAGGCTCTTGG + Intergenic
1097994396 12:65871912-65871934 TACAAAGCACAGAAGGCAATTGG - Intronic
1098422926 12:70322879-70322901 TAATAAGTACAGAGTGCTCTAGG + Intronic
1098891166 12:76011886-76011908 AAGAAAACACAGAGGCCTCGTGG - Intergenic
1100535472 12:95504918-95504940 CAGAAAGCACAGGGGACTCTGGG - Intronic
1102588103 12:113937276-113937298 TAGACAGCAGTCAGGGCTCTGGG - Intronic
1103852463 12:123942121-123942143 CAGCAGGCACAGAGGGCCCTGGG + Intronic
1104248858 12:127070402-127070424 TACAAAGCACAGATAGCTCTGGG - Intergenic
1104713548 12:131002652-131002674 CAGAAAGGAAAGAGGGCTCTTGG + Intronic
1104970979 12:132530612-132530634 CAGGAAACACAGAGTGCTCTGGG - Intronic
1106229325 13:27809648-27809670 GAGAAAGCACAGGATGCTCTAGG + Intergenic
1106785834 13:33107416-33107438 GATTATGCACAGAGGGCTCTGGG + Intronic
1107424310 13:40277423-40277445 GAGAAAGAGCAGAGGGCTCAGGG - Intergenic
1108332407 13:49402319-49402341 TAGAAAGCTGAGTGGGCTCGTGG + Intronic
1111847364 13:93528301-93528323 GAGTAAGCAAAGAGGGCTGTGGG + Intronic
1113074364 13:106453280-106453302 TGGGAACCACAGAGGGCTCCTGG + Intergenic
1114808622 14:25869220-25869242 TAGAAAGAACAGAGAGCTCCAGG - Intergenic
1115994484 14:39181638-39181660 TAGAAAGCACAGAAGGAGCGTGG + Exonic
1117775724 14:59181862-59181884 TGGAAGGCACAGAGTGCTTTGGG + Intergenic
1120188403 14:81417881-81417903 TAGAAAAACCAGAGGGCTCCAGG + Intronic
1120248667 14:82035669-82035691 TAGAGAGAACACATGGCTCTAGG + Intergenic
1120681579 14:87486794-87486816 TTGAAAGCACAGAGGGCATCAGG + Intergenic
1121673334 14:95730869-95730891 TAGAAAGCATACAGGACACTGGG + Intergenic
1121786172 14:96662814-96662836 TAAAAAACACAGGGTGCTCTGGG - Intergenic
1122606385 14:102949398-102949420 TAAAACGCACAGACGGCTGTGGG + Intronic
1124242012 15:28036629-28036651 TAGAAAGAACCAAGGGATCTAGG - Intronic
1125294837 15:38191350-38191372 TAGGAAGAACAGAATGCTCTGGG + Intergenic
1127383485 15:58449127-58449149 TAGGAAGGACAAAGGGCCCTTGG - Intronic
1128552222 15:68605688-68605710 GAGGAGTCACAGAGGGCTCTTGG + Intronic
1129073941 15:72975539-72975561 TATCAAGCAGCGAGGGCTCTGGG + Intergenic
1129461711 15:75703081-75703103 GAGAAGGCAGAGAGGGCCCTGGG + Intronic
1129553457 15:76479034-76479056 TGTAAAGCACAGAGGGCATTAGG - Intronic
1129723141 15:77888765-77888787 GAGAAGGCAGAGAGGGCCCTGGG - Intergenic
1129956280 15:79639738-79639760 AATAAAGCTCAGAGGGCCCTGGG + Intergenic
1130896194 15:88172124-88172146 CAGAAAGGGCAGAGGCCTCTTGG + Intronic
1131168226 15:90158193-90158215 TAGAAAGCCACGAGCGCTCTAGG + Intergenic
1131774939 15:95784815-95784837 TAGAAAGAACAGTGGGCCCAGGG + Intergenic
1134776862 16:16860772-16860794 GATAACGCACAGAGTGCTCTTGG + Intergenic
1135411354 16:22237243-22237265 TACATAGAACAGAGGGCTATGGG - Intronic
1135480446 16:22816642-22816664 TGGAAAGCACAGTGGGCTATTGG - Intronic
1135863523 16:26079270-26079292 TAGAAGCCACAGGGGGCTTTTGG + Intronic
1137308885 16:47233566-47233588 TAGGGAGAACAGAGAGCTCTGGG - Intronic
1138147309 16:54624346-54624368 TAGGAGCCACAGAGGGCTTTTGG + Intergenic
1138407355 16:56807199-56807221 TAGGAAGCACAGAGGACTGGAGG - Intronic
1138491964 16:57382271-57382293 CAGGAAGCACAGAGGGCCCTGGG + Exonic
1139474996 16:67198662-67198684 AAGAAGGAACAGAGGTCTCTGGG + Exonic
1140231317 16:73119510-73119532 TAGAGAGGAAGGAGGGCTCTGGG + Intergenic
1147817228 17:43218854-43218876 CAGAAAGGACAGAGGGCTAAAGG - Exonic
1147985957 17:44308156-44308178 GAGAAAGCGCAGATGGCTCCCGG - Intergenic
1148283373 17:46366778-46366800 TGGAAAGGACAAAGTGCTCTTGG + Intergenic
1148305591 17:46584699-46584721 TGGAAAGGACAAAGTGCTCTTGG + Intergenic
1148343682 17:46889407-46889429 AAGAAAGGACAGAGGGGACTTGG - Intergenic
1150896213 17:69213657-69213679 GAGAAAGCAAGCAGGGCTCTCGG + Intronic
1152040319 17:77898724-77898746 TTGAAATCACAGTGAGCTCTTGG + Intergenic
1153666281 18:7370009-7370031 CAGGAAGGTCAGAGGGCTCTGGG + Intergenic
1153812133 18:8761516-8761538 TAGAAAGAACAGAGGTCACCAGG - Intronic
1155645589 18:28073572-28073594 TAGTAAGCTAAGAGGGCTCAAGG - Intronic
1156573780 18:38289167-38289189 GAGAAAGCACAGAATGCTCTAGG - Intergenic
1156656220 18:39290487-39290509 TAGGAAGCACAGAGGGATAGTGG + Intergenic
1157069560 18:44390194-44390216 TGGAAAGGTCAGAGTGCTCTTGG - Intergenic
1159566233 18:70053860-70053882 TAGAAAGTACAGTGAGTTCTGGG - Intronic
1160078989 18:75704709-75704731 GAGACAGCACAGAGGCGTCTAGG - Intergenic
1160665400 19:325814-325836 TAGACGGCACAGATGGGTCTGGG - Intronic
1161055842 19:2190316-2190338 TAGAAAGCACCGGGGGCCCCTGG + Intronic
1161578700 19:5068734-5068756 CAGAAATCACAAAGGACTCTTGG - Intronic
1162304455 19:9863294-9863316 TGGGAAGCAGTGAGGGCTCTGGG + Intronic
1163810037 19:19425395-19425417 CACAAAGCACAGAGTCCTCTTGG - Intronic
1163921428 19:20293511-20293533 GAGAAAGAAGAGAAGGCTCTGGG - Intergenic
1164555691 19:29249165-29249187 GAGAGAGGACAGAGGGCTTTGGG - Intergenic
1166108376 19:40608610-40608632 TAGAAAGAACTGAGGGCATTGGG + Intronic
1166285883 19:41828018-41828040 CAGAAAGCACAGAGAGTGCTTGG - Intergenic
1166958018 19:46478754-46478776 AAGAAAGTCCAGGGGGCTCTGGG + Intergenic
1168269915 19:55244200-55244222 TACAGAGCAGAGATGGCTCTGGG - Intronic
1168469911 19:56631292-56631314 GAGAGAGCACAGAGGCCTCTTGG - Intergenic
926115500 2:10210484-10210506 AAGAATGCACAGAGGGCGCTGGG + Exonic
927432264 2:23036740-23036762 TAGAAAGAACTGGGGGCCCTTGG + Intergenic
927948187 2:27149865-27149887 TAGAGAGAACACAGGACTCTGGG + Intronic
930130444 2:47844496-47844518 TATATAGCACAGGGGGCTTTTGG - Intronic
930241330 2:48938385-48938407 GAGTATGCACACAGGGCTCTGGG + Intergenic
930395388 2:50816987-50817009 TATAAATTACACAGGGCTCTCGG + Intronic
931263823 2:60642922-60642944 CAGAGCGCACAGAGGGTTCTGGG - Intergenic
932752773 2:74382042-74382064 TAGAAAGCACAGAGGGCTCTGGG - Intronic
935268388 2:101413629-101413651 CAGAGGACACAGAGGGCTCTTGG + Intronic
935329760 2:101968405-101968427 TGGAAAGCACATAAGGCTCCAGG + Intergenic
936809171 2:116375585-116375607 TGGAAAGCATAGAGGGCTCAAGG - Intergenic
936864048 2:117056609-117056631 TGGAACACACAGAGGTCTCTTGG + Intergenic
938779120 2:134568802-134568824 TAGAATGCTCACAGGGCTCATGG - Intronic
939496657 2:142934381-142934403 TAGAAGCCCCAGAGGGGTCTGGG + Intronic
939855539 2:147354532-147354554 TGGAAAGCACAGAATGCACTGGG + Intergenic
939935611 2:148288864-148288886 TAGAAAACACAGAGAAGTCTTGG - Intronic
940190172 2:151032348-151032370 GTGAAACCACAGAGGGCTCCAGG + Intronic
940988666 2:160075522-160075544 TAGCAGGCAGAGAGGGCTCTGGG + Intergenic
941473656 2:165921578-165921600 TCAAAAGCACAGGAGGCTCTAGG + Intronic
941753358 2:169157630-169157652 TGGAGAGGACAGAGGGCACTGGG + Intronic
942778478 2:179613202-179613224 TAGAACACCAAGAGGGCTCTTGG - Intronic
944210132 2:197198416-197198438 TAGTCTGCACAAAGGGCTCTGGG + Intronic
944510045 2:200455747-200455769 TGGATAGGACAGAGGGCACTTGG - Intronic
945502396 2:210592318-210592340 TTTAAAACACAGAGGGCTATGGG - Intronic
946978759 2:225183393-225183415 GAGAAAGCAAATAGGGCTTTTGG + Intergenic
947565909 2:231192913-231192935 TAGGGCCCACAGAGGGCTCTAGG + Intergenic
948573740 2:238936469-238936491 AAGAAAGCGGAGAGGGTTCTGGG - Intergenic
1168790504 20:572854-572876 GAGACAGCAGAGAGGGCTGTGGG + Intergenic
1171342207 20:24439171-24439193 TATAAAACACAGAGGGATGTGGG - Intergenic
1175065765 20:56286323-56286345 TAGAAAGTACAGAATGCTCAAGG - Intergenic
1177290451 21:19104212-19104234 GAGAAAGAACAGTGGGCTCAGGG - Intergenic
1179107272 21:38413350-38413372 AAGTATGCAGAGAGGGCTCTTGG - Intronic
1180927388 22:19565728-19565750 TAGAAAACTCAGAGACCTCTGGG - Intergenic
1181551178 22:23639856-23639878 TGGAGGGCAGAGAGGGCTCTGGG - Intergenic
1181985270 22:26796288-26796310 TAGAAGGCAGAGATGGCTCAGGG - Intergenic
1182075187 22:27490763-27490785 TAAAAAGGACCGGGGGCTCTGGG - Intergenic
1183362162 22:37388317-37388339 GAGGAAGCACAGGGGGCTGTGGG - Intronic
1183920011 22:41158369-41158391 TAAAAAGCACAGAGGCCTTAAGG - Intronic
1184112424 22:42403130-42403152 TAGAAGGCACAGAGGGGGCCGGG - Intronic
1185073477 22:48669809-48669831 CAGAAAGCACTGACGTCTCTGGG - Intronic
1185161429 22:49232244-49232266 TGGGAGGCACAGAGGGGTCTGGG + Intergenic
949782726 3:7708392-7708414 CAGAAAGCACAGAGTGCTGTAGG + Intronic
950158959 3:10744316-10744338 TGGAAATCACAGCGGGCTTTAGG + Intergenic
950190902 3:10975412-10975434 GAGACTGCACAAAGGGCTCTAGG + Intergenic
950445756 3:13036789-13036811 TAGAAAGAACAGAGGCCGCCAGG - Intronic
950565322 3:13766541-13766563 TAGAAGGCACTGAGGCCACTCGG - Intergenic
951145650 3:19223594-19223616 TAGAAAGCACAGTGGAATCCAGG - Intronic
953126952 3:40100062-40100084 AAGAAAAGACACAGGGCTCTGGG - Intronic
953180438 3:40589756-40589778 CAGCATGCTCAGAGGGCTCTTGG - Intergenic
954907755 3:54077292-54077314 TGGAAAGCCCAGGAGGCTCTGGG - Intergenic
955330334 3:58041925-58041947 AAGAAAGCAAAGAGGGCACTTGG - Intronic
956353654 3:68366375-68366397 CAGAAAGAACAGAGGGCACAAGG + Intronic
957667450 3:83251325-83251347 TAGAATGTACAGAGTGTTCTTGG - Intergenic
959628224 3:108477970-108477992 TAGAAAGCAGAGAGGGGTTTTGG - Intronic
960191462 3:114711456-114711478 TGGAAAGAATAGAGGCCTCTGGG - Intronic
960681280 3:120249871-120249893 TAGAATACCAAGAGGGCTCTTGG + Intronic
960713947 3:120557869-120557891 TGGAGCCCACAGAGGGCTCTGGG - Intergenic
961559556 3:127719190-127719212 TATAGAGCCCAGGGGGCTCTGGG + Intronic
962084957 3:132180921-132180943 AAGTTAGCACAGAGGGCTGTAGG + Intronic
962362467 3:134753804-134753826 TAGACAGAACAGAGTTCTCTAGG + Intronic
962630611 3:137272060-137272082 AAGAGAGCTCAGACGGCTCTGGG - Intergenic
962921391 3:139953533-139953555 TGGCAAGCACAGAGGGGTCTAGG - Intronic
966822144 3:183933454-183933476 CAGGAAGCACAGGGAGCTCTGGG + Intronic
967989681 3:195121609-195121631 TAGAAAGCACAGAGGAGGTTTGG - Intronic
968677515 4:1891973-1891995 GAGAAAGCATAGAGGGCAATGGG - Intronic
971743833 4:30553090-30553112 TAGTAAGAACAGAAGGCACTAGG + Intergenic
972754518 4:42031986-42032008 TAGAAAGCATAGAAGCTTCTGGG + Intronic
972793755 4:42397342-42397364 CAGAAAGCGCAGAGGACCCTCGG + Intergenic
973052170 4:45609953-45609975 TAGAAGCCCCAGAGGGGTCTGGG - Intergenic
976299951 4:83507876-83507898 TAGAAGCCCCAGAGGGGTCTGGG + Intronic
976591011 4:86849977-86849999 TAGAATGCACAGAGGGGCCCTGG - Intergenic
978843905 4:113248993-113249015 TATAAAAGACAGAGGGCACTTGG + Intronic
978940698 4:114433276-114433298 TAGAAAGGACAGATTGCTATTGG - Intergenic
979123828 4:116940784-116940806 GAAAAAGCACAGAGGACTCATGG + Intergenic
980008762 4:127571332-127571354 TAGGAAGCACAGTGGTCTTTTGG - Intergenic
981050349 4:140303606-140303628 TAGAAAGGACAGAGGAACCTGGG - Intronic
981689955 4:147497448-147497470 TAGAAAACACAGAGGAATCTAGG + Intronic
982126482 4:152188308-152188330 TTGAAAGGACAAAGGGTTCTGGG - Intergenic
982398818 4:154943252-154943274 TCAAAAGCACAGAAGGTTCTGGG - Intergenic
982564032 4:156966802-156966824 TAGAAAGTACAGAGGTTTGTAGG - Intronic
983477292 4:168229576-168229598 GAGAAAGCAAGCAGGGCTCTTGG - Intronic
983529344 4:168793796-168793818 TAGAAAGCTATGAGGTCTCTTGG - Intronic
985608313 5:871182-871204 TCCCAAGCACAGTGGGCTCTGGG - Intronic
985811217 5:2088139-2088161 TCGAAAGAACTGAGGGTTCTAGG - Intergenic
985945505 5:3179315-3179337 TACAAAGCACAAAGGTTTCTAGG + Intergenic
986893121 5:12333059-12333081 TAGAAAAAACAGAGGCCTCTGGG - Intergenic
987210949 5:15682706-15682728 TAGAATTCCCAAAGGGCTCTTGG + Intronic
988599088 5:32622832-32622854 TGGAAAGCACAGAGGGTTCCTGG - Intergenic
988634664 5:32970033-32970055 TAGAAAGCTGAGGGAGCTCTTGG + Intergenic
989747193 5:44843904-44843926 TAGAAAGCTTAGAGGTTTCTAGG - Intergenic
991090884 5:62692832-62692854 TTGAAAGCACACAGGGCTCTTGG - Intergenic
993089288 5:83404271-83404293 TAGAAATAACAGAGGACTATTGG - Intergenic
995536773 5:113144445-113144467 TGGAAAGCACATATGGCTCTTGG - Intronic
995709923 5:115025021-115025043 CTGAAAGCACAGAGAGCACTTGG + Intergenic
996962659 5:129269899-129269921 TAGAACACACAGCGGGATCTTGG - Intergenic
997434636 5:133865512-133865534 TACAAAGCAAGGAGGGCACTGGG - Intergenic
998296074 5:140969751-140969773 TAAAAAGCTCTGAGGCCTCTAGG + Intronic
998412182 5:141919771-141919793 AAGAAAGTACAGAGTGCTATGGG - Intergenic
998467722 5:142358838-142358860 TAGAAAGCCAAGAGGGTCCTTGG + Intergenic
999776555 5:154816749-154816771 TAGGATGAACAGAGGGATCTGGG - Exonic
1001923061 5:175616019-175616041 AAGAAAGCATAAAGGACTCTGGG - Intergenic
1002046747 5:176545823-176545845 TGGGAAGCACACAGGGATCTGGG - Intronic
1002256879 5:177964396-177964418 TAGAAAGTCCAGATGCCTCTGGG + Intergenic
1002469171 5:179424719-179424741 AAGAAGGCATAGAGGTCTCTCGG + Intergenic
1004777503 6:18864284-18864306 TGTGAAGCACAGAGGGATCTTGG + Intergenic
1005803377 6:29449079-29449101 TAGAAAGCACAGAGAACCTTGGG + Intronic
1006581764 6:35081492-35081514 AGGAGAGCACAGAGGGCTCTGGG - Intronic
1007156454 6:39749721-39749743 CAGAAAGGACAGAGGGGTCAAGG + Intergenic
1009643179 6:66363113-66363135 TTGAAATCAGAGTGGGCTCTGGG + Intergenic
1009666863 6:66693200-66693222 TAGACAGTACAGAAGGCTCAGGG - Intergenic
1010507333 6:76676181-76676203 TAGAAAACACAGAAGTGTCTGGG + Intergenic
1011071241 6:83386812-83386834 CAGAAAGCAGAGAGCTCTCTGGG - Intronic
1013165628 6:107589241-107589263 GAGAAAGCACTGAGGGCACAGGG + Intronic
1013416622 6:109931408-109931430 GAGAGATCTCAGAGGGCTCTTGG + Intergenic
1014270064 6:119326597-119326619 TACAAAGGAAAGAGGGCTCATGG + Intronic
1017399257 6:154040144-154040166 TACTGAGCAAAGAGGGCTCTTGG + Intronic
1017757427 6:157541435-157541457 TAGGAAGCAGACAGGGCTCTTGG - Intronic
1018074976 6:160204057-160204079 GAGATAGTACAGAGGGCTCCTGG + Intronic
1018984950 6:168629278-168629300 AAGACAGCACTGAGGGCACTTGG - Intronic
1021746887 7:23750024-23750046 TAAGAAGTACAGAGTGCTCTGGG + Intronic
1028184549 7:87767746-87767768 TAGGATGCACTGAGGTCTCTGGG + Intronic
1028730216 7:94138966-94138988 TAGGAAGCATAGAGACCTCTAGG + Intergenic
1029220159 7:98982355-98982377 CAGAAAGCACAGATTGTTCTAGG + Intronic
1029483120 7:100824720-100824742 CTGAAAGCAGAGAGGGGTCTTGG - Intronic
1030758095 7:113314754-113314776 TAGGAAGCACAGCTGGATCTAGG - Intergenic
1031822282 7:126518542-126518564 TAGATACCCCATAGGGCTCTTGG + Intronic
1032543089 7:132720492-132720514 TAGAAAGCAAAAAGGATTCTGGG - Intronic
1034166046 7:149026042-149026064 TAGACAGCACAGTGGTGTCTAGG - Intronic
1034459977 7:151192796-151192818 TCCAAATCACAGAGGGCTGTAGG + Exonic
1034986457 7:155518545-155518567 TCGAAAGCAATGAGAGCTCTAGG + Intronic
1035456517 7:159012994-159013016 TTAAAACCACAGAGGGCTCATGG + Intergenic
1037587751 8:20289587-20289609 AGGAAAGCAGGGAGGGCTCTGGG + Intronic
1038072553 8:24033407-24033429 GAAAAAGCACAGAAGCCTCTGGG - Intergenic
1038223009 8:25628517-25628539 TGGAAAGAACAGAGGTTTCTAGG + Intergenic
1038646517 8:29366357-29366379 GAGGAATCACAGATGGCTCTGGG - Intergenic
1038695948 8:29806260-29806282 TAGAAATCACAGAAAGATCTAGG + Intergenic
1040098083 8:43467656-43467678 GAGGAAGAACAGAGGTCTCTAGG + Intergenic
1040304976 8:46207340-46207362 GAGAAAGCACTGAGGGCTTCTGG - Intergenic
1040873015 8:52120434-52120456 AAGGAAGCACAAAGGGTTCTGGG + Intronic
1041602158 8:59731870-59731892 TGAAAAGAACAGAGAGCTCTGGG - Intergenic
1043451089 8:80367437-80367459 AAGAAAGGAAAGAGGGCTTTTGG - Intergenic
1045752861 8:105507058-105507080 TAGAGAGAACAGATGGATCTAGG + Intronic
1047411361 8:124627187-124627209 TAGATAGCTCAGAGGGCCGTGGG - Intronic
1048902363 8:139051008-139051030 GAGAAAGCACAGTGGGCCCAGGG - Intergenic
1048959148 8:139561586-139561608 TATAAAGCCCAGTGGTCTCTGGG - Intergenic
1049291890 8:141807720-141807742 TAAGAAGCACAGAGGGCCCCGGG + Intergenic
1049909425 9:251026-251048 TAGGAAGCAAAGAGGAGTCTAGG + Intronic
1050622721 9:7471488-7471510 CAGAAAGCACACAGGGCTGGAGG + Intergenic
1051236961 9:15011308-15011330 TAGAAAGCACAGAAGAACCTGGG - Intergenic
1051588777 9:18754623-18754645 GAGAAAGCACAGAGGACACGTGG - Intronic
1051680031 9:19597826-19597848 CAGACAACACAGAGTGCTCTGGG + Intronic
1053806057 9:41803091-41803113 GACAAAGCACAGAGGCTTCTGGG - Intergenic
1054751554 9:68912339-68912361 TAGAAAAAACAGAGAGCTTTGGG + Intronic
1055311293 9:74984312-74984334 TAGAAAGTAGAGTAGGCTCTGGG - Intronic
1057136397 9:92691622-92691644 TAGAGAGAACAGAGAGCTCTGGG + Intergenic
1057946131 9:99330528-99330550 TAGAAAGCACAGAGGTGGCTAGG - Intergenic
1059297185 9:113281838-113281860 CAGTAAGCACAGAGGGCTAGAGG - Intronic
1060702569 9:125770648-125770670 TAAAAAGGAGAGAGGGCTCCTGG + Intronic
1061290688 9:129649029-129649051 TCAGAAGCACAGAGGTCTCTGGG - Intergenic
1061619607 9:131803285-131803307 TAAAAAGAACAGAGGTCTTTGGG + Intergenic
1186401926 X:9268268-9268290 AAGAAGGAACAGAGGGCTTTAGG - Intergenic
1189315195 X:40050361-40050383 CAGAAAGCACTGAGGGCATTCGG + Intronic
1189630988 X:42952992-42953014 TAGAAGGCACATAAGGCTTTAGG - Intergenic
1189720037 X:43906455-43906477 TAGAAAACACAGAAGGCTACAGG - Intergenic
1190981886 X:55463673-55463695 GAGAAAGGGCAGAGGGCTTTGGG - Intergenic
1190986812 X:55509507-55509529 GAGAAAGGGCAGAGGGCTTTGGG + Intergenic
1191151060 X:57221268-57221290 TAGAAGCCCCAGAGGGGTCTGGG - Intergenic
1194892484 X:99397863-99397885 TAGAAAGGACAGAGAGGTGTAGG - Intergenic
1196722985 X:118872137-118872159 TAGATGGCACAGAGGGGCCTAGG - Intergenic
1196776262 X:119340715-119340737 GAGTAAGCACAAAGTGCTCTGGG + Intergenic
1198017070 X:132622047-132622069 TAGTAGTCACAGAGGGCCCTCGG - Intergenic
1198684568 X:139213925-139213947 TAGAAACCACAGAGGGCTCTGGG + Intronic
1200119204 X:153782514-153782536 GAGCAGGCACAGAGGCCTCTCGG - Intronic