ID: 932753167 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:74385412-74385434 |
| Sequence | GGAACTTGCTGGTTGATTCA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 133 | |||
| Summary | {0: 1, 1: 0, 2: 1, 3: 12, 4: 119} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 932753167_932753174 | 2 | Left | 932753167 | 2:74385412-74385434 | CCCTGAATCAACCAGCAAGTTCC | 0: 1 1: 0 2: 1 3: 12 4: 119 |
||
| Right | 932753174 | 2:74385437-74385459 | GCACTAGGACCCTGTAGACAGGG | 0: 1 1: 0 2: 1 3: 12 4: 201 |
||||
| 932753167_932753173 | 1 | Left | 932753167 | 2:74385412-74385434 | CCCTGAATCAACCAGCAAGTTCC | 0: 1 1: 0 2: 1 3: 12 4: 119 |
||
| Right | 932753173 | 2:74385436-74385458 | GGCACTAGGACCCTGTAGACAGG | 0: 1 1: 0 2: 0 3: 4 4: 97 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 932753167 | Original CRISPR | GGAACTTGCTGGTTGATTCA GGG (reversed) | Intronic | ||