ID: 932753167

View in Genome Browser
Species Human (GRCh38)
Location 2:74385412-74385434
Sequence GGAACTTGCTGGTTGATTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 119}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932753167_932753174 2 Left 932753167 2:74385412-74385434 CCCTGAATCAACCAGCAAGTTCC 0: 1
1: 0
2: 1
3: 12
4: 119
Right 932753174 2:74385437-74385459 GCACTAGGACCCTGTAGACAGGG 0: 1
1: 0
2: 1
3: 12
4: 201
932753167_932753173 1 Left 932753167 2:74385412-74385434 CCCTGAATCAACCAGCAAGTTCC 0: 1
1: 0
2: 1
3: 12
4: 119
Right 932753173 2:74385436-74385458 GGCACTAGGACCCTGTAGACAGG 0: 1
1: 0
2: 0
3: 4
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932753167 Original CRISPR GGAACTTGCTGGTTGATTCA GGG (reversed) Intronic