ID: 932757908

View in Genome Browser
Species Human (GRCh38)
Location 2:74421674-74421696
Sequence CGCGGGCGGCGCGGTTGCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 235}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932757908_932757918 7 Left 932757908 2:74421674-74421696 CCCCGGCAACCGCGCCGCCCGCG 0: 1
1: 0
2: 3
3: 26
4: 235
Right 932757918 2:74421704-74421726 CCGGCCGCTCACCCCGCCCAAGG 0: 1
1: 0
2: 1
3: 13
4: 200
932757908_932757919 8 Left 932757908 2:74421674-74421696 CCCCGGCAACCGCGCCGCCCGCG 0: 1
1: 0
2: 3
3: 26
4: 235
Right 932757919 2:74421705-74421727 CGGCCGCTCACCCCGCCCAAGGG 0: 1
1: 0
2: 1
3: 4
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932757908 Original CRISPR CGCGGGCGGCGCGGTTGCCG GGG (reversed) Intronic
900184043 1:1324777-1324799 CGAGGGCGGGGCGGTGGGCGGGG + Exonic
900787107 1:4655826-4655848 CGCGGCGGGCGCGGGGGCCGGGG + Intronic
900787110 1:4655835-4655857 CGCGGGGGCCGGGGCTGCCGGGG + Intronic
901007702 1:6179851-6179873 CGCGGGCGGCGGGGGCGGCGCGG - Intronic
901109551 1:6784685-6784707 GGCGGGCGGCGCCGGGGCCGTGG + Intergenic
901632348 1:10654031-10654053 CGCAGCCGGCGCGGATGCAGTGG + Exonic
902350195 1:15848282-15848304 CGCGGGCCGAGCGGCTGACGAGG - Intronic
903044289 1:20553887-20553909 CGCGGGCGGCGGGGGCGCCGGGG - Exonic
903055572 1:20633775-20633797 GGCTGGCGGCGCGGTTGCAGCGG + Exonic
904030072 1:27528144-27528166 CGCGGGGGGAGCTGTTGCCATGG - Intergenic
904215402 1:28914783-28914805 CGGCGGCGGCGCGGGAGCCGGGG + Intronic
905179163 1:36156043-36156065 CGCGGACGGCGCGGGCGCGGGGG + Intronic
905655485 1:39683903-39683925 CGCGGGCGCTGCTGTTCCCGAGG - Intronic
906140519 1:43531305-43531327 CGCTGGGGGCGCGTCTGCCGCGG - Intronic
906242424 1:44250241-44250263 GGCGGGCGGCAGGGCTGCCGAGG + Intronic
910935095 1:92480846-92480868 TGCCGGCGGCGCGGGGGCCGGGG - Exonic
911208735 1:95117905-95117927 CCCGGGCGGCGCGGGGGCCGCGG - Exonic
914361421 1:146939083-146939105 CGCGAGCGGGGCGGTTGCGCCGG + Intronic
914919707 1:151838791-151838813 CCCGGGCGGCGCAGTGCCCGCGG - Exonic
915552309 1:156642283-156642305 GGCGGGCGGCGGGGCTGCGGAGG - Intronic
921355427 1:214281012-214281034 CGCGCGCGGGGCGGCCGCCGAGG + Intergenic
922950975 1:229558432-229558454 CGCTGGAGGAGCGGCTGCCGGGG - Exonic
1067015222 10:42753290-42753312 CGCCGGCGGCGCCTTTGCCTGGG - Intergenic
1067071931 10:43138621-43138643 CCCGGGCGGTGCGGGCGCCGGGG + Intronic
1069019156 10:63466032-63466054 CGCGGGCGGGGCAGCAGCCGCGG + Intergenic
1069942402 10:71964553-71964575 CTCGGGCCGCGCGGGCGCCGGGG + Exonic
1071309416 10:84328682-84328704 CTCGGGCGGCGGGGCTGGCGGGG + Exonic
1071579487 10:86756585-86756607 AGGGGGCGGCGCGGGTGCGGGGG - Intergenic
1072139197 10:92574495-92574517 CGCGGGCCGCGCGCCGGCCGCGG - Intergenic
1073076863 10:100829722-100829744 CGAGGGCGGCGAGGGCGCCGAGG + Exonic
1073137725 10:101229020-101229042 CGCGGGCGCCGCTGCTGCTGGGG + Exonic
1076374212 10:129972766-129972788 CGCTGGGGGCCGGGTTGCCGGGG - Intergenic
1076880347 10:133236671-133236693 CGCGGGCGGCGTGGGCGCTGAGG + Intergenic
1077008506 11:369961-369983 CGCGGGGGGCGCGGGGGGCGCGG + Intronic
1077008513 11:369970-369992 CGCGGGGGGCGCGGGGGGCGGGG + Intronic
1077008521 11:369988-370010 CGGGGGCGGCGCGGGGGGCGCGG + Intronic
1077008526 11:369997-370019 CGCGGGGGGCGCGGGGGGCGCGG + Intronic
1077008529 11:370006-370028 CGCGGGGGGCGCGGGCGGCGCGG + Intronic
1077008534 11:370015-370037 CGCGGGCGGCGCGGGGGGCGCGG + Intronic
1077008537 11:370024-370046 CGCGGGGGGCGCGGGCGGCGCGG + Intronic
1077008542 11:370033-370055 CGCGGGCGGCGCGGGCGGCGGGG + Intronic
1077008546 11:370042-370064 CGCGGGCGGCGGGGGCCCCGGGG + Intronic
1077107995 11:850145-850167 CGCGGGCGGCGGGGACGCCGGGG + Intronic
1077491383 11:2862436-2862458 GGCGGGCGGGGCGGGGGCCGGGG + Intergenic
1078066332 11:8081482-8081504 CGGGGGCGGGGCGGTGGCTGCGG - Intronic
1081992155 11:47343643-47343665 TGCGGGCGGTGGGGTGGCCGGGG - Intronic
1083936552 11:65872689-65872711 CGCGGGCCGCGGGGGTGTCGCGG - Exonic
1084888136 11:72223855-72223877 GGCGGGCGGCGCGGAGGGCGGGG + Intronic
1085205831 11:74731368-74731390 CGGCGGCGGCGCGGCGGCCGCGG + Intronic
1086361850 11:86068600-86068622 CGCGGGTCGCGCGGGCGCCGGGG + Intronic
1087118005 11:94544554-94544576 CGCGGGTGGCGCCGAGGCCGGGG + Exonic
1091273136 11:134331940-134331962 CGCCGGCGGGCCGGTTGCCCAGG + Exonic
1091450563 12:569955-569977 CTTGGGCGCCGCGGCTGCCGGGG + Intronic
1091550042 12:1530259-1530281 CGGGGCCGGCGCGGCTGTCGGGG + Intronic
1091616095 12:2052612-2052634 CGCGGTGGCCGCGGTGGCCGCGG - Intronic
1091778709 12:3200644-3200666 CGCGGGCGAGCCGGTTCCCGGGG + Intronic
1097267545 12:57755038-57755060 GGCGGGCGGGGCGGGCGCCGGGG - Intronic
1101605917 12:106247755-106247777 GTCGGGCGGCGCGGATGACGTGG - Exonic
1101640375 12:106582596-106582618 CGCGGGCGGGGGGGGAGCCGCGG - Intronic
1101970674 12:109309921-109309943 CGCCGTCGTCGCGGCTGCCGGGG - Intergenic
1103813349 12:123633580-123633602 CGCGGGCGGCTCGGGTCCCCTGG - Exonic
1104448817 12:128853491-128853513 CGCGGACGGCGGGGGAGCCGGGG - Intronic
1104692805 12:130839238-130839260 CGCGCGGGGCGCGGTTGCCGTGG - Intronic
1105411859 13:20177528-20177550 GGGAGGCGGCGCGGTGGCCGCGG - Intergenic
1106517110 13:30465247-30465269 CGAGGGCGGCGCGGGGGCCTGGG - Intronic
1110630107 13:77697882-77697904 CGAGGGCGCCGCGGCCGCCGGGG - Intronic
1110705975 13:78602263-78602285 CGCGGGCGGCGCGGGCGCGGCGG - Exonic
1112508145 13:99987818-99987840 CGCGGGTGGCGCGATGGCTGCGG + Intergenic
1113493937 13:110713607-110713629 GGGGGGCGGGGCCGTTGCCGGGG + Intronic
1113542019 13:111115919-111115941 CGCGGGCGGCGGGGGTCCCCGGG + Intronic
1114558510 14:23576020-23576042 GGCGGGCGGCGCTGCGGCCGGGG + Exonic
1114649015 14:24271453-24271475 CGCGGGGGGCGGGGGTGCCCGGG - Exonic
1115816751 14:37172050-37172072 AGCGGCCGGCGCGGACGCCGAGG + Intronic
1116018247 14:39432076-39432098 CCCGGGTGGCGCGGTGGCGGCGG - Exonic
1118592538 14:67412115-67412137 CGCGGGCTGCGCGGGTGCCGAGG - Exonic
1119318457 14:73714522-73714544 CGGGGGTCGAGCGGTTGCCGTGG + Intergenic
1122143347 14:99675181-99675203 CGCTGGCCGCGGGGTTGGCGCGG - Exonic
1122621105 14:103057910-103057932 CGCGCGCGTCGCGGATCCCGGGG + Intergenic
1123001946 14:105300598-105300620 CGCGTGTGCCGCGGTTGCGGCGG - Exonic
1123047651 14:105526641-105526663 TGCGGGCGGCGGGGTAGGCGCGG + Exonic
1123630737 15:22258194-22258216 CGCGGGCCGGGCGGGCGCCGGGG - Intergenic
1124427041 15:29570932-29570954 GGCGGGCGGCGCGGCGGCGGCGG - Intergenic
1126113264 15:45187679-45187701 CGGGGGCGGCGCGGGGGGCGCGG + Intronic
1126668420 15:51094694-51094716 CCCGGGCGGCGCGGGCGGCGCGG + Intronic
1126738050 15:51751614-51751636 CAGGGGCGGCGCCGTGGCCGGGG - Exonic
1128344044 15:66842603-66842625 GGCGGGCGGGGCGGCGGCCGGGG + Intergenic
1129189133 15:73927404-73927426 CGCGGGCGGCGGCGTGGGCGCGG + Exonic
1132398231 15:101489571-101489593 CGCGGGGGGCGCGGGGGGCGCGG - Exonic
1132519756 16:381776-381798 CGGGGGCGAGGCGGTGGCCGCGG - Exonic
1132519871 16:382044-382066 CGGGGGGGGCGCGGACGCCGGGG + Intronic
1132523371 16:401700-401722 GGCCGGGGGCGCGGTTCCCGCGG - Intronic
1132683605 16:1153411-1153433 CCCGGGCGGCGCGGTCACCGCGG - Exonic
1132793351 16:1706109-1706131 CCCTGGCGGCGCGGCTGCGGCGG + Intergenic
1133032931 16:3020322-3020344 CGGGGGCGGGGCGGCGGCCGTGG + Exonic
1134134363 16:11669243-11669265 CGCGGGCGGCGTGGCAGGCGCGG - Intronic
1134143631 16:11742845-11742867 CGGCGGCGGCGCGGCTGACGTGG - Exonic
1136993327 16:35170389-35170411 GGCGGGCCGCGCGGTGGGCGCGG - Intergenic
1137655234 16:50153456-50153478 CGCGGGCGGCGCGGTCGCGCAGG - Intronic
1138591233 16:58000678-58000700 GGCGGGCGGCGCGGGGGCCAGGG + Intronic
1139364798 16:66426970-66426992 GGCGGGGGGCGCGGGTGCGGGGG - Intergenic
1139954318 16:70685994-70686016 GGCGGGCGGCGCGGGGGGCGCGG + Exonic
1140927614 16:79599275-79599297 CGCGGGCAGCGCGGCCGCCTCGG - Exonic
1141456429 16:84145264-84145286 CGCGTGCGCAGCGGTTGCCTGGG + Intergenic
1141961451 16:87411973-87411995 GGCGGGCTGCGGGGGTGCCGGGG + Exonic
1141972308 16:87492379-87492401 CGCGGGCCGGGCGGGCGCCGGGG + Intergenic
1142005980 16:87689811-87689833 CGCGGGCGGCGGGGTGGCCGCGG - Exonic
1142393258 16:89816370-89816392 CTGGGGCGGCGCGGCTGCCTCGG - Intronic
1143223751 17:5282675-5282697 CGAGGGCGGCGCGGGCGCCCCGG + Intronic
1145059675 17:19724747-19724769 CGCGGGTGGCGCGGATACCGAGG + Intergenic
1145884426 17:28372275-28372297 GGCGGGCGGCGCGCGGGCCGTGG + Exonic
1145915403 17:28571159-28571181 AGAGGGCGGCGCGCTTGCCCCGG + Exonic
1146053302 17:29568650-29568672 CGCGGGCGGCGCGGGCGGCGCGG + Exonic
1146053306 17:29568659-29568681 CGCGGGCGGCGCGGGGGCGCTGG + Exonic
1146142374 17:30379115-30379137 CGCGGGCGCCGAGGCGGCCGAGG + Exonic
1146167437 17:30600840-30600862 CCCCGGCGGCGGGGTTGGCGGGG - Intergenic
1147307384 17:39573536-39573558 CTCGGGCGTCCCGGTTGCCAAGG + Intergenic
1147312931 17:39605777-39605799 CGTAGGCGGCGCAGTAGCCGTGG + Exonic
1147341241 17:39754363-39754385 CGCGGGAAGTGCGGTCGCCGCGG + Intergenic
1148156890 17:45429818-45429840 CGCGGGCCGCACGGGCGCCGCGG + Intronic
1150388594 17:64778592-64778614 CGCGGGCCGCACGGGCGCCGTGG + Intergenic
1151625097 17:75271322-75271344 CGCAGGCGGCGCGGCTTCCGGGG - Intergenic
1152628603 17:81399646-81399668 CGCGGGCGGCGCAGAGGCGGCGG - Exonic
1152861363 17:82698427-82698449 CGCGGGCGGAGGGCGTGCCGGGG - Intronic
1157353989 18:46917117-46917139 CGCGGGCGGCGCGGGGGCGGCGG - Intronic
1160696814 19:488946-488968 GGCGGGCGGCGCGGACGCCCTGG - Intergenic
1160747879 19:720237-720259 TGGGGACGGCGCGGTTGCCACGG + Intronic
1160967711 19:1753863-1753885 CGCGGGCGGCGCGGGCAGCGCGG + Exonic
1160995735 19:1881263-1881285 TGCAGGAGACGCGGTTGCCGCGG + Exonic
1161073058 19:2271919-2271941 CCCGGGCGGCGCGCTGCCCGAGG + Exonic
1162033255 19:7926187-7926209 CGCGGGGGGCGGGGCTGCAGGGG + Intergenic
1162470951 19:10871735-10871757 CGCGGGCGGCGCGGGGTCGGCGG + Exonic
1162809119 19:13153761-13153783 CGCGGGCGGCGCCGTCGGAGGGG - Exonic
1162953559 19:14085841-14085863 CGCGTGCGGCGCGTGTGCAGGGG - Intronic
1163606936 19:18280863-18280885 CGCGGGCGGCGCCGGGGGCGCGG - Exonic
1164594976 19:29526557-29526579 CGCGGGGGGCGCGGTGGCGGCGG - Exonic
1165472033 19:36009442-36009464 CGCGGGCGGCGGCGATGCCGTGG + Exonic
1167258152 19:48443151-48443173 CGCGGGCGGCGCGGGGGGCACGG + Exonic
1168293870 19:55369626-55369648 CGCGGGGGGCGCGGGGGGCGCGG + Intronic
1168307314 19:55442647-55442669 CGCGGGCGGGGCGGGCGCGGCGG - Exonic
1168721821 19:58558543-58558565 GGCGGGCCGCGCGGTGGGCGCGG - Exonic
1202712405 1_KI270714v1_random:25582-25604 CGCAGGCGGCGCAGTCGTCGCGG - Intergenic
926727981 2:16013345-16013367 CGCGGGCGGCGTTGTCGCGGTGG - Intergenic
927156549 2:20224456-20224478 CCCGGCCGCCGCGGTGGCCGGGG + Intronic
927215773 2:20667198-20667220 GGCGGGCGGCGCGGGCTCCGTGG - Exonic
931467763 2:62506201-62506223 CTCGCGCCGCCCGGTTGCCGTGG - Exonic
931868290 2:66434266-66434288 CGCGGGCGGAGCCGGGGCCGGGG - Intronic
932757908 2:74421674-74421696 CGCGGGCGGCGCGGTTGCCGGGG - Intronic
934882445 2:97995719-97995741 CGGCGGCGGCGCGGAAGCCGTGG + Exonic
934933213 2:98445115-98445137 CGCGGCCGCCGCGGGGGCCGGGG + Intronic
936038400 2:109129987-109130009 CGCGGGCGGCGGGGGCGGCGCGG + Exonic
936972111 2:118186006-118186028 CGCGGGCGGGGCCGGGGCCGAGG - Intergenic
937950952 2:127387725-127387747 CGCGGGCCTCGGGGTTGCAGCGG - Intronic
938042996 2:128091375-128091397 CGCGAGCGGTGCGTGTGCCGCGG + Exonic
938277150 2:130037147-130037169 CGCAGACGGCGGGGTCGCCGGGG - Intergenic
938361829 2:130693558-130693580 CGCAGACGGCGGGGTCGCCGGGG + Intergenic
938438234 2:131300242-131300264 CGCAGACGGCGGGGTCGCCGGGG + Intronic
946386668 2:219387967-219387989 GGTGGGCGGGGCGGATGCCGAGG - Exonic
948876316 2:240831713-240831735 CGCGGATGGCGGGGGTGCCGAGG + Intergenic
1169191396 20:3660916-3660938 CGCGGGCGGCGGCGGGGCCGTGG - Exonic
1169278480 20:4248843-4248865 CGCGGGCGGCGCGGCCCCCTCGG - Exonic
1171013850 20:21522766-21522788 CTGGGGCTGCGCGGTGGCCGCGG - Intergenic
1173548129 20:43914739-43914761 CGCGGGCGGGGCGGGGGCGGGGG + Intergenic
1174607005 20:51768387-51768409 CGCGGGGGGCGCGGCGGCCAAGG - Exonic
1174812654 20:53660279-53660301 CGCGGGCGGCGTGGACGCTGCGG - Intergenic
1176380547 21:6110567-6110589 GGCTGGCGGCGCGGATGCCCTGG - Intergenic
1178992178 21:37366134-37366156 CGCGGCCGCCGCGCTTCCCGGGG + Intronic
1179742925 21:43427673-43427695 GGCTGGCGGCGCGGATGCCCTGG + Intergenic
1180092878 21:45541986-45542008 CGCGGGGGTCGCGGTGGCCCGGG - Intronic
1180187241 21:46145832-46145854 CGGGGGCGGCTCGGTGGCGGCGG - Exonic
1181121511 22:20670681-20670703 TGCAGGAGACGCGGTTGCCGTGG + Intergenic
1182532131 22:30968873-30968895 CGCGGGCGGCGCGCGGGCGGCGG - Intergenic
1183441391 22:37825014-37825036 CGCGGGCGCGGCGGCGGCCGAGG + Exonic
1183444426 22:37843880-37843902 CGCGAGCGGCGCGGGGGCCCGGG - Intronic
1184034109 22:41910491-41910513 CGCGGGCCGCGCGGGGGCCCCGG + Exonic
1184101509 22:42343753-42343775 CGCGGGCGGCGCCGCTGCGGTGG + Intergenic
1184439219 22:44498304-44498326 CGGGGCCGGCGCGGTGGCGGTGG + Intergenic
1184557377 22:45240721-45240743 TGCGGGCGGCGCCGAGGCCGAGG - Intronic
1184663773 22:45977167-45977189 CGCTCGCGGCTCGCTTGCCGGGG - Intergenic
1185283015 22:49983685-49983707 CGGGGGCGTCGCGCTTCCCGGGG - Intergenic
1185313922 22:50170678-50170700 CGCGGGCGGGGCGGGGGGCGCGG - Intergenic
954633160 3:52057618-52057640 CGCAGGCGGCGCGCTTGCGTAGG + Intergenic
954717473 3:52533770-52533792 GGCGGGCGGCGGGCTGGCCGAGG - Exonic
955769565 3:62373910-62373932 CGCGGGCGCCGCGTTTGGAGGGG + Intronic
955911580 3:63863975-63863997 CGCGGGGAGCGCGGGTCCCGCGG - Intergenic
956675046 3:71725335-71725357 GGCGGGGGGCGCGGCGGCCGGGG + Exonic
957078650 3:75619690-75619712 CGCGGGATGCGGGGCTGCCGCGG + Intergenic
960556391 3:119034954-119034976 CGCTGGAGCCGCGGTTGCCCTGG - Intronic
961013397 3:123449806-123449828 CCCGGGCGGCGCGGGGGGCGGGG - Intergenic
961442406 3:126960787-126960809 GGCAGGCGGCGCGGCTGCAGAGG + Intergenic
963827298 3:149970229-149970251 CGCGGGAGGCGCGCTGTCCGCGG + Intronic
964451511 3:156817062-156817084 CGCAGGCGGCGCGGCGGCCTGGG + Intergenic
967316202 3:188154069-188154091 CGCGGGCGGCGCGCTCGAGGAGG + Intronic
968010437 3:195270849-195270871 CGCGGGCGGCGAGGGCGCGGCGG + Exonic
968230717 3:197003228-197003250 CGTGGGCGGCGGGGCTCCCGGGG + Exonic
969559582 4:7938995-7939017 CGCGGGGGGCGCGGTTGGTGGGG - Exonic
969912857 4:10461323-10461345 CTCGGCCGCCGCGGCTGCCGCGG + Intergenic
970202858 4:13627455-13627477 CGCGGGCGGGGCGGGCGGCGCGG - Exonic
972162541 4:36244357-36244379 CGCGGGCGGCGCTGTTAGTGGGG + Exonic
972396623 4:38663992-38664014 CGCGGGAGGCGGGGGTGGCGGGG + Intergenic
977809695 4:101346054-101346076 CGCGGGGGGCGCGGGAGGCGGGG - Intronic
985512780 5:321672-321694 GGCGGGCGGCTCGCGTGCCGGGG + Intronic
986402948 5:7396604-7396626 CGCGGGCCGAGGGGCTGCCGCGG - Intronic
986402955 5:7396622-7396644 CGCGGGCCGAGGGGCTGCCGCGG - Intronic
987303349 5:16616770-16616792 CGCGGGCCGGGCGGCGGCCGCGG - Exonic
987373719 5:17216738-17216760 CGGGGGAGGCGCGGTCGCCGAGG - Intronic
992663610 5:78984903-78984925 CGGGGGCGGCGCGGGCGGCGGGG + Intronic
992939919 5:81751435-81751457 CGCGGGCGGCGCGGGGGGAGGGG - Intronic
995224723 5:109689846-109689868 CGGGGGCGGTGCCGGTGCCGCGG + Exonic
996379062 5:122845563-122845585 CGTGGGCGGAGCGGCGGCCGCGG + Exonic
997282256 5:132656490-132656512 CGCTGGCGCGGCGGTTGCGGCGG - Intronic
1001395899 5:171419593-171419615 CGCGGGCGGCGAGGGGGCGGGGG - Intergenic
1002670307 5:180861233-180861255 CGCTGGCGGCCGGGTTCCCGCGG - Exonic
1002927248 6:1611576-1611598 CGGCGGCGGCGCGGGGGCCGCGG + Exonic
1003482567 6:6546715-6546737 CTCTGGCTGCGCGGTGGCCGCGG - Intergenic
1003645419 6:7910260-7910282 AGCGGGGGGCGCGGGCGCCGCGG - Intronic
1004395568 6:15244838-15244860 CGCGGGGTGGGCGGTGGCCGGGG - Intergenic
1005327883 6:24720256-24720278 TGCGGGCGGAGCGGTGGCGGCGG + Exonic
1006814255 6:36839824-36839846 CGCTGGCGGCGGGGGTGGCGGGG + Exonic
1008013348 6:46491293-46491315 TGGGGGCGGCGCGGTGCCCGCGG + Exonic
1008545260 6:52577511-52577533 TGAGGGCGGCGCGGGTGCGGCGG + Intergenic
1012998333 6:105994884-105994906 CGGGGACGGCGCGCTTGTCGCGG + Intergenic
1019111980 6:169724132-169724154 CGCGGGCGGCGCGCTGGCGACGG - Intronic
1019474295 7:1236613-1236635 CGCGGGCGGCACGGCGGGCGCGG - Exonic
1020270221 7:6590251-6590273 CGCGCTCGGCGCGGGGGCCGCGG + Exonic
1020274366 7:6615684-6615706 CGGGGGCGGGGCGGGCGCCGCGG - Exonic
1021845282 7:24757416-24757438 CGCAGGGGGCGCGGCTGCCGGGG - Intronic
1022715122 7:32891810-32891832 GGCGGGCGGCGCGGCTCCCGGGG - Exonic
1024521090 7:50304541-50304563 CGCGGGCGGCGCTGTGCGCGCGG + Intronic
1027232581 7:76281484-76281506 CGCGGGCGGCGTGGGTGCGGCGG - Exonic
1029206082 7:98870064-98870086 GGCGCGCGGCGCGGCTGACGTGG - Intronic
1029735707 7:102464827-102464849 CGCGGACGGCGCGATGGCGGCGG - Exonic
1033033204 7:137846736-137846758 CGCAGGCGGCGCCGCTGCAGGGG + Exonic
1033390778 7:140924989-140925011 CGCGGGTGACGCCGTTGCCGCGG - Intergenic
1034174750 7:149091267-149091289 CGCCGGGGGCGCGGAGGCCGTGG + Intergenic
1034414717 7:150958392-150958414 CGCGGGCGCCCCGGGGGCCGTGG - Exonic
1034414721 7:150958401-150958423 CGCGGGCGGCGCGGGCGCCCCGG - Exonic
1034911684 7:155003019-155003041 CGCGGGCAGGGCCGTTGGCGGGG - Exonic
1035475895 7:159144353-159144375 CGCGGGCTGCGCGTTTCACGGGG - Intronic
1038554252 8:28494991-28495013 CGCGGGCTGTGGGTTTGCCGTGG + Intronic
1040474573 8:47764755-47764777 CGTGGGCGGCCCTGTCGCCGGGG - Intergenic
1041244786 8:55879920-55879942 CGCGGCCGCCCCGCTTGCCGCGG - Exonic
1042902962 8:73746729-73746751 CGCCGGCGGCGCGGAAGTCGGGG + Intronic
1043463952 8:80486950-80486972 CGCGGGCGGCGCTGGCGGCGGGG - Exonic
1045098976 8:98825968-98825990 GGCGGGCGGGGCCGGTGCCGCGG + Intronic
1048553962 8:135457583-135457605 CGCGGGCGGCGCGGTTAGGCGGG - Exonic
1049218343 8:141417827-141417849 GGCGGGCGACCCGGCTGCCGGGG - Intronic
1049616472 8:143577780-143577802 AGCGGGCGGCGCGGCGGCCACGG - Intronic
1050437778 9:5628659-5628681 TGGGGGCGGGCCGGTTGCCGGGG - Intergenic
1058851261 9:109013632-109013654 CGCGGGCGGGGCAGAGGCCGGGG - Intergenic
1059145575 9:111896748-111896770 GGCGGGCGCCGCGGTTCCGGGGG + Exonic
1060634561 9:125189734-125189756 CGCCGCCGCCGCTGTTGCCGCGG - Exonic
1060856058 9:126915329-126915351 CGGGGCCGGCGGGGCTGCCGTGG + Intronic
1060897312 9:127225796-127225818 CGCGAGGGGCGCGGGGGCCGCGG - Intronic
1061583940 9:131554664-131554686 CGCGGGCGGCGCGGGAGCTGCGG - Intergenic
1062022543 9:134326291-134326313 CGCGGGCCGAGCGGTGGCGGCGG + Intronic
1062372186 9:136245699-136245721 CGCGGGCCGCACGGCTGCCGCGG - Exonic
1062421072 9:136483052-136483074 CGTCGGCGGCGCGGCGGCCGCGG - Intronic
1203772010 EBV:54233-54255 CCTGGGCGGGGCGGTTGCCTGGG + Intergenic
1185736649 X:2500945-2500967 CGCGGGCGGCGCGGAAGCGGCGG - Exonic
1187419544 X:19122528-19122550 CGGGGGCGGCGCCGAGGCCGCGG - Exonic
1190285189 X:48957081-48957103 CGGGGTTGGCGCGGTTGGCGGGG - Exonic
1195668280 X:107449681-107449703 CGCGGGCGGCACCATCGCCGTGG - Intergenic
1199772624 X:150984106-150984128 GGCGGGCGGAGCGGTCGGCGGGG + Intronic
1200173646 X:154097301-154097323 CGCGGGCGCCCCTGTCGCCGGGG - Intronic
1200787676 Y:7274215-7274237 GGAGGGCGGCGCGGCAGCCGCGG - Intergenic