ID: 932759534

View in Genome Browser
Species Human (GRCh38)
Location 2:74430316-74430338
Sequence GCAGCTGGGGGAACACATCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 208}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932759534_932759540 1 Left 932759534 2:74430316-74430338 CCTGGATGTGTTCCCCCAGCTGC 0: 1
1: 0
2: 0
3: 23
4: 208
Right 932759540 2:74430340-74430362 GCAGCAGGAACACAGCCCAGCGG 0: 1
1: 0
2: 7
3: 47
4: 476
932759534_932759541 12 Left 932759534 2:74430316-74430338 CCTGGATGTGTTCCCCCAGCTGC 0: 1
1: 0
2: 0
3: 23
4: 208
Right 932759541 2:74430351-74430373 ACAGCCCAGCGGTGCAAGTCTGG 0: 1
1: 0
2: 1
3: 7
4: 92
932759534_932759547 22 Left 932759534 2:74430316-74430338 CCTGGATGTGTTCCCCCAGCTGC 0: 1
1: 0
2: 0
3: 23
4: 208
Right 932759547 2:74430361-74430383 GGTGCAAGTCTGGGGACAAAGGG 0: 1
1: 0
2: 0
3: 14
4: 192
932759534_932759543 14 Left 932759534 2:74430316-74430338 CCTGGATGTGTTCCCCCAGCTGC 0: 1
1: 0
2: 0
3: 23
4: 208
Right 932759543 2:74430353-74430375 AGCCCAGCGGTGCAAGTCTGGGG 0: 1
1: 0
2: 1
3: 22
4: 295
932759534_932759546 21 Left 932759534 2:74430316-74430338 CCTGGATGTGTTCCCCCAGCTGC 0: 1
1: 0
2: 0
3: 23
4: 208
Right 932759546 2:74430360-74430382 CGGTGCAAGTCTGGGGACAAAGG 0: 1
1: 0
2: 0
3: 12
4: 137
932759534_932759542 13 Left 932759534 2:74430316-74430338 CCTGGATGTGTTCCCCCAGCTGC 0: 1
1: 0
2: 0
3: 23
4: 208
Right 932759542 2:74430352-74430374 CAGCCCAGCGGTGCAAGTCTGGG 0: 1
1: 0
2: 2
3: 5
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932759534 Original CRISPR GCAGCTGGGGGAACACATCC AGG (reversed) Exonic
900457243 1:2783265-2783287 GCAGCTGAGGGAACATCTCCTGG + Intronic
901532808 1:9864095-9864117 GCAGCTGGGGGAACCTTCCCTGG + Intronic
901679820 1:10906476-10906498 GCAGGTGGGGGAAGAGTTCCAGG - Intergenic
901846940 1:11989300-11989322 GCAGCTGGGGGCCTACATCCAGG + Exonic
902066657 1:13693747-13693769 GAATCTGGGGAAACAAATCCAGG + Intergenic
903700693 1:25246487-25246509 GCAGATGGAGGGACAGATCCAGG - Exonic
904263558 1:29304899-29304921 TCAGGAGGGGGAACACAGCCAGG + Intronic
904517275 1:31065951-31065973 GCACCTGGGAGAACACGGCCTGG + Intronic
904772183 1:32886568-32886590 GGAGCTGGGGGCCCACGTCCAGG + Intronic
906216641 1:44044864-44044886 CCAGATGGAGGGACACATCCAGG + Intergenic
906640947 1:47439920-47439942 GCCTCTCGGGGAACACATTCCGG + Exonic
910167348 1:84341483-84341505 GCAGCTGGGGAAAAAAATCAAGG - Intronic
913550881 1:119915880-119915902 CCAGCTGAGGGCACCCATCCTGG - Exonic
913691603 1:121284939-121284961 GAAGCTGGCAGAACACTTCCTGG + Exonic
913975065 1:143449526-143449548 GCAGCTGGGCAAACACCTTCCGG + Intergenic
914069457 1:144275142-144275164 GCAGCTGGGCAAACACCTTCCGG + Intergenic
914109698 1:144691212-144691234 GCAGCTGGGCAAACACCTTCCGG - Intergenic
915118844 1:153616207-153616229 AGAGCTGGGGGATCAGATCCTGG - Intronic
918940509 1:190989957-190989979 GCAGCTGAGGGAATGCCTCCCGG - Intergenic
920098466 1:203501512-203501534 GCACATGGGCGAACACACCCGGG - Intronic
920658000 1:207890677-207890699 GCAGCTGAGGGAAAACAACTGGG + Intronic
920679761 1:208063529-208063551 GCAGCTGGGGGAATCCAAGCCGG + Intronic
923132777 1:231091940-231091962 GCAGCTGAGAGACCACATTCAGG - Intergenic
1063884943 10:10567814-10567836 GCAGCTGGGGAAATAAATCCTGG + Intergenic
1067081019 10:43212216-43212238 GCTGTTGTTGGAACACATCCCGG + Intronic
1071747499 10:88438486-88438508 TCAGATGGGGGAACAAATGCTGG - Intronic
1072881236 10:99232061-99232083 GCAGCTGGGTGAGAACAACCTGG + Intronic
1073030056 10:100519104-100519126 GCTGATGGGGGTTCACATCCCGG - Intronic
1073187412 10:101624955-101624977 GGAGCTGTGGGAAGACATCTTGG + Intronic
1073930872 10:108574654-108574676 GTAGGAGGGGGAATACATCCAGG + Intergenic
1074703082 10:116109567-116109589 CCCTCTGGGGGAACACAGCCCGG - Intronic
1075419774 10:122292044-122292066 GCAGCCGAGGAAACACACCCTGG + Intronic
1075452817 10:122564149-122564171 GCAGCTGGGGGAGCCCATCATGG + Intronic
1075691386 10:124397195-124397217 GCAGCTCGGGACACACTTCCAGG - Intergenic
1076245593 10:128945204-128945226 GCATCTGGGTGACCCCATCCGGG + Intergenic
1076618490 10:131771980-131772002 GCAGCTGGGGGCACAGAGCCTGG + Intergenic
1076709070 10:132321147-132321169 GTAGCTGTGGGAGGACATCCAGG - Intronic
1076846454 10:133071750-133071772 CCAGCTGGGAGGCCACATCCTGG - Intronic
1076984112 11:223224-223246 ACAGCTGCTTGAACACATCCAGG + Intronic
1078937597 11:15965318-15965340 ACAGCAGGGGTAAGACATCCAGG - Intergenic
1079566283 11:21887341-21887363 GCAGCTTGGGGACTACATGCTGG - Intergenic
1080394233 11:31875156-31875178 CCAGCTGGGGGCCCAGATCCTGG - Intronic
1080777801 11:35402384-35402406 TCAGGTTGGTGAACACATCCAGG + Intronic
1081921950 11:46786583-46786605 CCAGCTGGGGGAACCCAGCTTGG + Intronic
1084205080 11:67586454-67586476 AGAGCAGGGGGAACGCATCCAGG - Exonic
1084554510 11:69867948-69867970 GCTGCTGGCGGAGCACATGCTGG - Intergenic
1088622220 11:111697632-111697654 GCAGATTGGGGATCAAATCCTGG - Intronic
1090042035 11:123299843-123299865 GCAGCAGGGTGAACAGCTCCAGG - Intergenic
1093564659 12:20588498-20588520 ACAGCTGCGGAAACACATTCAGG + Intronic
1095048132 12:37532976-37532998 GCAGCCTGGGGAACACAGGCGGG - Intergenic
1096038402 12:48492885-48492907 GCAGCTGGGGAGACATGTCCAGG + Intronic
1097003756 12:55900501-55900523 AGAGCAGGGGGAACACATCCAGG - Intergenic
1097848636 12:64390496-64390518 GCCGCCGCAGGAACACATCCAGG + Exonic
1101440829 12:104703269-104703291 GCAGCTGCGGGAACAAGTCTGGG - Intronic
1101603587 12:106231481-106231503 GCAGCTGGGAGGAGACATACAGG - Intergenic
1102651909 12:114448278-114448300 GCAACTTGGGGTACACAACCGGG + Intergenic
1102949934 12:117024705-117024727 GCAGGTGGGGTGTCACATCCTGG - Intronic
1104281095 12:127378428-127378450 GCCGCTTGGTGAACACCTCCTGG - Intergenic
1104371727 12:128229334-128229356 GCACGTGGGAGAACACATGCTGG - Intergenic
1106113797 13:26799879-26799901 GGAAATGGGGGCACACATCCTGG - Intergenic
1106424683 13:29614904-29614926 GAAGCAGGGAGAACACATCAAGG + Intergenic
1107322642 13:39205776-39205798 GCAGCTCAGGGAACAGCTCCAGG - Intergenic
1107410023 13:40150078-40150100 GCAGCTCACGGAGCACATCCAGG + Intergenic
1111956352 13:94762942-94762964 GCAGCTGGGGTAACCAATTCTGG + Intergenic
1112197599 13:97241170-97241192 GCAACTGGGTCAGCACATCCAGG - Intronic
1113397051 13:109957675-109957697 GGAGCTAGAGGATCACATCCAGG + Intergenic
1115694706 14:35884159-35884181 GCGGCTGGGAGAAGAAATCCAGG - Intronic
1117670334 14:58099772-58099794 GCAGCTGCGGGAGAATATCCTGG + Intronic
1120170887 14:81246695-81246717 GCAGCTGTGTGCCCACATCCTGG - Intergenic
1121688226 14:95855607-95855629 GCAGCTCAGGGGACACAACCAGG + Intergenic
1122765711 14:104068161-104068183 ACAGCTGCAGGAGCACATCCAGG - Intergenic
1124394993 15:29293576-29293598 GGACCTGGGGGAACCCTTCCTGG - Intronic
1125745933 15:41997132-41997154 GCAGCTGGAGGAAGACCTGCAGG - Exonic
1126098458 15:45105672-45105694 GCAGCAGCGGGAACGCATCCTGG - Exonic
1127965933 15:63922980-63923002 GCTGCTGCGAGAAGACATCCAGG - Intronic
1129343646 15:74902756-74902778 GCAGCTGCCGGCTCACATCCTGG + Exonic
1129889695 15:79063781-79063803 TCAGCTCTGGGACCACATCCTGG + Intronic
1132345138 15:101103485-101103507 GCTGCTGGGAGAACTCATTCTGG - Intergenic
1132604258 16:787161-787183 GCAGCTGCGGGGGCACATCCAGG - Exonic
1132663403 16:1071340-1071362 GGAGCTGGAGGAACACAGCCAGG + Intergenic
1132809036 16:1788864-1788886 GCTGCTGGTGCGACACATCCTGG - Exonic
1133046864 16:3092877-3092899 GCAGCTGGGGGAAGTCAAGCTGG - Intronic
1134879037 16:17728180-17728202 TCTGCAGGGGGAACAGATCCTGG + Intergenic
1137915201 16:52422550-52422572 CCAGCAGGGAGAACACAGCCTGG - Intergenic
1141995111 16:87631942-87631964 GCAGGTGGGAGAAGACATCGAGG - Intronic
1143631683 17:8143612-8143634 GCAGCTGGGGGCACAGATGTGGG + Exonic
1143929000 17:10400746-10400768 GGAGCTGGGGGAAGAAATCGAGG - Exonic
1144783531 17:17819612-17819634 GCTGCTGGGGGACCACACTCTGG + Exonic
1144873103 17:18382551-18382573 GGAGCTGGAGGAACAGATCGCGG + Exonic
1145411392 17:22669160-22669182 GCAGCCTGGGGAACACAGGCAGG - Intergenic
1145921615 17:28614104-28614126 CCAGCAGGGGGAACACACCCGGG - Exonic
1147543684 17:41381979-41382001 GGAGCTGGAGAAACTCATCCAGG - Exonic
1147933825 17:43999849-43999871 GCAGCAGAGGGAAGACTTCCTGG + Intronic
1149958756 17:61083221-61083243 GGAGATGGGGGAATACATGCAGG - Intronic
1150241551 17:63637965-63637987 CCTGCTGGGGGAACAGATCCTGG - Intronic
1152319824 17:79602471-79602493 GCAGCTGGGGGCACGCAGCCAGG + Intergenic
1152466363 17:80468807-80468829 GCAGGTGCGGGAACACATGTCGG + Exonic
1156390418 18:36645065-36645087 GCAGCTGTGGGAGCACATGGAGG + Intronic
1159701938 18:71640197-71640219 AGAGCTGGGGGAACACAGTCAGG - Intergenic
1161505345 19:4640622-4640644 GCTGCTGGGGGATCAGATGCAGG + Intronic
1161688938 19:5719760-5719782 GCAGGTGCGGAAACACATCGGGG + Exonic
1161841633 19:6685056-6685078 GCAGTTGGAGGGACACATCAAGG + Exonic
1162578592 19:11513921-11513943 GCAGCTGGTTGTACACAGCCAGG + Exonic
1163478492 19:17540426-17540448 GCAGCTGCGGGTCCACCTCCCGG - Exonic
1163719608 19:18892776-18892798 GGAGCTCAGGGAAGACATCCTGG - Intronic
1165904851 19:39187582-39187604 GGGGCTGGGGGAGCAGATCCTGG - Intergenic
1166320646 19:42016551-42016573 GCAGCAGAGGGAACACAGACTGG + Intronic
1167299842 19:48672125-48672147 GCAGATGGGGGAACAGATGTTGG + Intronic
1168092864 19:54096988-54097010 CCAGCTCGGAGGACACATCCCGG + Exonic
1168295518 19:55375717-55375739 ACAGATGGGGAAACAAATCCAGG + Intergenic
926541117 2:14182628-14182650 GCAGCTGGGGCCACACTTCAAGG + Intergenic
929123161 2:38500008-38500030 GCTGCTGGCGGATCACATGCCGG - Intergenic
931604206 2:64035685-64035707 GCAGCTGGAGCAGCAGATCCTGG + Intergenic
931891414 2:66676819-66676841 GAAGCTGAGAAAACACATCCAGG + Intergenic
932759534 2:74430316-74430338 GCAGCTGGGGGAACACATCCAGG - Exonic
934169672 2:89330062-89330084 GCAGCTGGGGCACCACAGCAGGG + Intergenic
934197620 2:89852523-89852545 GCAGCTGGGGCACCACAGCAGGG - Intergenic
934290059 2:91684760-91684782 GCAGCTGGGCAAACACCTTCCGG + Intergenic
937773716 2:125751275-125751297 GCAGCTGAGAGCACACATCATGG - Intergenic
940874265 2:158884390-158884412 CCAACAGGGGGAACACAGCCTGG + Intergenic
941116770 2:161480614-161480636 GAAGCTGGGTGACCACATCCTGG + Intronic
942743258 2:179203462-179203484 CCAGGTGGGTGAACACATCAAGG + Intronic
945303833 2:208239789-208239811 GCAGCCAAGGGAACACATCTGGG + Intronic
948186346 2:236024366-236024388 GTAGCTCGGGGCACAGATCCAGG + Intronic
948508564 2:238448025-238448047 TCAGCTGAGGAAACACCTCCCGG - Exonic
948516901 2:238509806-238509828 GCAGCTGACGAAACACACCCTGG - Intergenic
948893904 2:240919457-240919479 GCAGCTGAGGAAACAGCTCCAGG + Intronic
1168847092 20:952667-952689 GCAGCTGGGGCACCACACCCAGG + Intergenic
1169220687 20:3820647-3820669 GCTGCAGGGGCAACACATTCAGG + Exonic
1170555141 20:17508918-17508940 GCAGGTGGGAGAGCACCTCCCGG + Exonic
1171289134 20:23970302-23970324 GTAGCTGGGGGAACACCTGGAGG + Intergenic
1171359210 20:24575033-24575055 GAGGCTGGGGAAGCACATCCAGG - Intronic
1171542674 20:25976446-25976468 GCAGCCTGGGGAACACAGGCGGG - Intergenic
1172474355 20:35226379-35226401 GGCCCTGGGGGAACATATCCGGG - Intergenic
1173273796 20:41560439-41560461 GCAGGTCAGGGAAGACATCCCGG - Intronic
1173374646 20:42472416-42472438 GCTGCTGGTTGAACACATACTGG + Exonic
1173431019 20:42987209-42987231 GCAGCTGGGGGAGAAGCTCCTGG - Intronic
1173607733 20:44343533-44343555 GCCCCTGGGATAACACATCCTGG + Intronic
1173718767 20:45235414-45235436 GCAGCTGTGTGACCACATCCTGG - Intergenic
1175239053 20:57533354-57533376 GCAGCTGGGGAAACTCATACAGG + Intergenic
1175891017 20:62315978-62316000 CCAGCTGGAGGCGCACATCCAGG - Exonic
1176056653 20:63152502-63152524 GCAGCTGGAAAAACACAACCAGG + Intergenic
1176390135 21:6159011-6159033 GCAGCGGGGGGACCTCCTCCAGG + Intergenic
1179110821 21:38443512-38443534 TCAGTTGGTGGAACACAGCCTGG - Intronic
1179733331 21:43379229-43379251 GCAGCGGGGGGACCTCCTCCAGG - Intergenic
1179982026 21:44900614-44900636 GCGTCTGGGGGAACACAGCTGGG - Intronic
1180801326 22:18633477-18633499 ACAGCTGGAGGAATCCATCCAGG - Intergenic
1180852562 22:19029017-19029039 ACAGCTGGAGGAATCCATCCAGG - Intergenic
1181162893 22:20968141-20968163 CCAGCTGGGGGAACTGCTCCAGG - Intronic
1181220395 22:21361784-21361806 ACAGCTGGAGGAATCCATCCAGG + Intergenic
1181472356 22:23148524-23148546 GCAGCTTAGGGAATCCATCCTGG + Intronic
1181757207 22:25032401-25032423 CCAGCTGGGGGAAGACACCCAGG - Intronic
1182317911 22:29460051-29460073 GCAGCCTGGGGAGCAGATCCAGG + Intergenic
1182472201 22:30555504-30555526 GCAGGTGCAGGAGCACATCCTGG - Exonic
1184441555 22:44519731-44519753 CCAGGTGGGTGAACACATCCAGG - Intergenic
1184942146 22:47776848-47776870 GCAGCTGCGGGAATGCAGCCTGG - Intergenic
1185284197 22:49993138-49993160 GCAGCTGGGGGACCAAGTCTGGG - Intergenic
1185323083 22:50210757-50210779 GGAGCTGGGGGAGGCCATCCTGG + Exonic
950441800 3:13014886-13014908 GCTCCTGGGGGGACACATACTGG + Intronic
953347009 3:42184774-42184796 GGAGCAGGTGGAACACATCAGGG + Exonic
953903187 3:46854755-46854777 GCATCTGAGGGAAGACGTCCTGG - Intergenic
954070771 3:48141427-48141449 GCTGCTGAGGGAAGACTTCCTGG + Intergenic
959619104 3:108380860-108380882 TCAGCTGGAGGAACATGTCCCGG - Exonic
964659612 3:159105758-159105780 GCAGCTTGGTGAACACATGTGGG + Intronic
966276776 3:178182477-178182499 GCAGCAGTGTGAACACATGCGGG + Intergenic
966888283 3:184388606-184388628 CCAGCTGGGGGACCCCATGCAGG + Exonic
968561350 4:1284714-1284736 GCTGCAGGGGGTCCACATCCTGG - Intergenic
968661478 4:1800535-1800557 ACAGCTGGGGGAACTCACCCTGG + Intronic
970169493 4:13275581-13275603 GCAGCTGGGGCATCACATTTAGG - Intergenic
973259926 4:48152678-48152700 GCAGCCTGGGGACCAAATCCTGG - Intronic
973683917 4:53350151-53350173 GAAGATGGGGGAACAGATGCTGG - Intronic
975089915 4:70389735-70389757 GGAGGTGGTGGAACAAATCCTGG - Exonic
976092367 4:81471718-81471740 CCGGCTGGGGGACCACAGCCCGG - Intronic
976203482 4:82602133-82602155 GCCGAAGGGGGAACAAATCCAGG - Intergenic
979347439 4:119605176-119605198 GGAGCTGTGGGAGCACAGCCAGG - Intronic
980247954 4:130271857-130271879 GCAGGTGGGGATACACATCCTGG + Intergenic
980957162 4:139441029-139441051 GCAACTGGGGGAAAATATGCGGG - Intergenic
985548586 5:522081-522103 GCAGCTGTGGGAGCTCATCGCGG - Intronic
985592528 5:772977-772999 GCCGCTGTGGGAAGACAGCCAGG + Intergenic
985739486 5:1606734-1606756 GCAGCTGGGGGAGAACAGCTGGG + Intergenic
989983159 5:50666862-50666884 GCAGCTGGGCGGTCACATCTGGG + Intronic
990425337 5:55682577-55682599 ACAGCTTGGGGAACACAGCAAGG + Intronic
992199429 5:74369109-74369131 TCTGCTGGAGGAACACATGCAGG + Intergenic
996855584 5:128002631-128002653 GCAGCTGGTGAAGCACAACCTGG - Intergenic
997292973 5:132750617-132750639 GCAGCTGGGGGATCAAGACCCGG + Intronic
997364810 5:133319049-133319071 GCAGGTGGGGGAAACCATCCAGG + Intronic
997957073 5:138287168-138287190 GTATCTGGGAGGACACATCCAGG - Exonic
998102011 5:139442322-139442344 GCAGCTGAGGGAACTGATCAGGG + Intronic
1001124153 5:169004323-169004345 CCAGCTGGGGGAAGATGTCCAGG - Intronic
1002522618 5:179800050-179800072 GCAGCTGGAGGATGACATCGTGG - Exonic
1002791699 6:441912-441934 GGGGCTGGGGGAACACAGGCAGG - Intergenic
1003394474 6:5741463-5741485 GCAGCTGGGGGAGCCTTTCCAGG + Intronic
1007219082 6:40264412-40264434 ACAGCTGGGAGAACCCAACCTGG - Intergenic
1007481355 6:42152289-42152311 GCAGTTGGGGATCCACATCCAGG + Intergenic
1007660868 6:43485224-43485246 GAATCTGATGGAACACATCCAGG + Intronic
1008507623 6:52246395-52246417 GCAGCTGGGGCAGCAGAGCCAGG + Intergenic
1010217374 6:73415846-73415868 CCAGCAGGGGGAACATATTCAGG + Intronic
1017822553 6:158060045-158060067 GGGGCTGGGGGAACTCACCCAGG - Intronic
1018074413 6:160198808-160198830 GCAGCTGGTGGATAACATTCTGG + Intronic
1019451136 7:1099031-1099053 CCAGCTGCAGGAACACAGCCCGG - Intronic
1019613980 7:1950625-1950647 GCAGCTGGGGGCAGACATTGAGG - Intronic
1020049167 7:5070643-5070665 GCAGCCTGGGCAACACAGCCAGG + Intronic
1022958124 7:35400136-35400158 GCTGCAGGGCGAGCACATCCAGG - Intergenic
1023960370 7:44921603-44921625 GCACCTGGGGGAGCACCTACTGG + Intergenic
1025294048 7:57761545-57761567 GCAGCCTGGGGAACACAGGCGGG - Intergenic
1026993054 7:74598584-74598606 TCAGCCTGGGGAACACAGCCAGG + Intronic
1027056331 7:75052436-75052458 GGAGCTGGGTCAACCCATCCCGG - Intronic
1032081385 7:128860151-128860173 GGAGCTGGGGGCACTGATCCAGG - Intergenic
1033313733 7:140281138-140281160 TTGGCTGGGGGAGCACATCCAGG + Intergenic
1033901296 7:146144179-146144201 CCAGCTGGGGCAACAAAGCCAGG - Intronic
1034265693 7:149779632-149779654 GCAGCTGATGGCACACGTCCTGG - Intergenic
1034282032 7:149861296-149861318 GCAGCTGCGGGATGACCTCCTGG - Exonic
1034336903 7:150329794-150329816 GCAGCTGGGGGAAATCACTCAGG - Exonic
1035053167 7:156015789-156015811 TCAGCTGGGCCAACACACCCCGG + Intergenic
1037294002 8:17381682-17381704 TCATCTGGGGGAAGAGATCCAGG + Intronic
1037342243 8:17858527-17858549 GCTTCTGGGGGTACACATGCAGG - Intergenic
1039563141 8:38529032-38529054 GAAGATAGGGGAACACGTCCTGG + Intergenic
1040284990 8:46094976-46094998 GCAGCTGTGGGGACACAGGCGGG + Intergenic
1047969811 8:130074922-130074944 GGAGCTGAGGGAGCACATCAGGG + Intronic
1049433980 8:142577794-142577816 CCAGCTGGTGGAACACAGCCAGG - Intergenic
1054727001 9:68662758-68662780 GCAGCCCGGGGAACTCATTCCGG + Intergenic
1057307430 9:93920440-93920462 GATGCTGGGGGAACAGATTCTGG + Intergenic
1057698901 9:97348864-97348886 GGAGCAGAGGGAACACAGCCAGG - Intronic
1060722971 9:125990440-125990462 TCAGCTGGGGGAACTCTTCTGGG + Intergenic
1062006182 9:134239626-134239648 GCAGCAGTGGGAACACAGGCGGG - Intergenic
1062158324 9:135066428-135066450 GCAGTTGGGGGGACACATGCAGG + Intergenic
1062158335 9:135066481-135066503 GCAGTTGGGGGGACACGTGCAGG + Intergenic
1062158393 9:135066708-135066730 GCAGTTGGAGGGACACATGCAGG + Intergenic
1062158429 9:135066851-135066873 GCATTTGGGGGGACACATGCAGG + Intergenic
1186238029 X:7534733-7534755 ACAGCTGGAAGAACACATGCTGG + Intergenic
1201144832 Y:11058548-11058570 GCAGCTGGGAGAGAACATTCTGG + Intergenic
1201457173 Y:14181305-14181327 ACAGCTGGAAGAACACATGCTGG + Intergenic