ID: 932760450

View in Genome Browser
Species Human (GRCh38)
Location 2:74436173-74436195
Sequence GGATCCGTGAGTGCTGGGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 164}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932760450_932760461 14 Left 932760450 2:74436173-74436195 CCAGTCCCAGCACTCACGGATCC 0: 1
1: 0
2: 1
3: 16
4: 164
Right 932760461 2:74436210-74436232 CCATTGCGAGAGGCGCGCAGAGG 0: 1
1: 0
2: 0
3: 2
4: 49
932760450_932760457 4 Left 932760450 2:74436173-74436195 CCAGTCCCAGCACTCACGGATCC 0: 1
1: 0
2: 1
3: 16
4: 164
Right 932760457 2:74436200-74436222 CCAGCCCGCTCCATTGCGAGAGG 0: 1
1: 0
2: 0
3: 7
4: 48
932760450_932760462 23 Left 932760450 2:74436173-74436195 CCAGTCCCAGCACTCACGGATCC 0: 1
1: 0
2: 1
3: 16
4: 164
Right 932760462 2:74436219-74436241 GAGGCGCGCAGAGGCGCGCGAGG 0: 1
1: 0
2: 1
3: 36
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932760450 Original CRISPR GGATCCGTGAGTGCTGGGAC TGG (reversed) Intronic
901614935 1:10531138-10531160 GGATCCGAGAGTGCTCTGCCTGG + Intronic
902968507 1:20029690-20029712 TGATACGTAAGTGCTGGGAAGGG - Intronic
904312193 1:29636037-29636059 GGATCCTTGAGTGCTGGGTGTGG + Intergenic
904312289 1:29636669-29636691 GGATCCATGAGTGCTGGGCCAGG - Intergenic
904497533 1:30895622-30895644 GGAACTGTGAGTTCTGGGGCCGG + Intronic
906142182 1:43540383-43540405 GGGTGAGTGAGTGCTGGGGCAGG + Intronic
906182857 1:43836734-43836756 GGCTCCGTGACTGCCGGGGCTGG - Intronic
915090129 1:153418482-153418504 GGGTCAGTGAGCGCTGGGAGGGG - Intronic
915095364 1:153458611-153458633 GGGTCAGTGAGTGCTGGGAGGGG + Intronic
915358073 1:155268532-155268554 GGGGCCGTGAGAGCTGGGAGTGG + Intronic
918362273 1:183771623-183771645 TGATACGTGAGTGCTGGGAAGGG + Intronic
921116249 1:212093944-212093966 TGATACGGGAGTGCTGGGAAGGG - Intronic
922604709 1:226882349-226882371 GGATGCCTGGGTGCTAGGACAGG + Intronic
923055773 1:230425521-230425543 GGAGGCGTGGGTGCTGGGGCGGG - Intronic
924697963 1:246419649-246419671 TGATACGGGAGTGCTGGGAAGGG - Intronic
1062916961 10:1247935-1247957 AGATCCTTGATTGCTGGGATGGG + Intronic
1069872073 10:71539292-71539314 GGGTCCAGGAGGGCTGGGACTGG - Intronic
1069901391 10:71708505-71708527 GTCTCCTTGAGTTCTGGGACAGG - Intronic
1070984293 10:80674553-80674575 GAATCCGTGGGTGCAGGTACTGG + Intergenic
1071353293 10:84767895-84767917 TGATACGGGAGTGCTGGGAAGGG - Intergenic
1073149866 10:101304332-101304354 GGATATGGGGGTGCTGGGACAGG - Intergenic
1073221785 10:101880626-101880648 GGAGCTGTGAGTGGTGGGAGGGG - Intronic
1075632056 10:124006418-124006440 GGATCCCTGAGTGTGGAGACAGG - Intergenic
1076208997 10:128625673-128625695 GGATCCGGGAGTCCTGCCACTGG - Intergenic
1076696362 10:132249208-132249230 GGTTGCGGGAGTGCTGGGAGTGG + Intronic
1077059250 11:610527-610549 GGATGCTTGAGGGCTGGGCCGGG - Exonic
1080383969 11:31799701-31799723 GCATCCGTGAGCTCTCGGACCGG - Intronic
1080393980 11:31873260-31873282 GAATCCTTGAGGGCAGGGACTGG + Intronic
1082679635 11:56152419-56152441 GAATCCGGGAGTGCTGAGTCAGG - Intergenic
1083240422 11:61383960-61383982 GCCTCCCTAAGTGCTGGGACCGG - Intergenic
1085684002 11:78605423-78605445 TGATACGGGAGTGCTGGGAAGGG + Intergenic
1090027830 11:123182832-123182854 GGGTGCGTGAGTGCTGGGTGAGG - Intronic
1096134266 12:49186562-49186584 AGATCCCAGGGTGCTGGGACAGG - Intronic
1096144639 12:49269714-49269736 AGATCCCAGGGTGCTGGGACAGG + Intronic
1096399947 12:51297623-51297645 GGATTCGTCAGAGCTGGGCCAGG + Intronic
1097323663 12:58252274-58252296 TTATCCGAGGGTGCTGGGACAGG + Intergenic
1103153959 12:118667505-118667527 GGCTCTGTGAGGGCAGGGACAGG - Intergenic
1103739698 12:123082884-123082906 AGAACAGTGAGTGCTGGGGCTGG - Intronic
1104056622 12:125235632-125235654 GGATCAGTGATTGCTGGGGCTGG - Intronic
1109138594 13:58683752-58683774 TGATCCGGGAGTGCTGGGAAGGG - Intergenic
1111292683 13:86188372-86188394 TGATACGGGAGTGCTGGGAAGGG + Intergenic
1118216066 14:63809577-63809599 GGAGCCTGGAGTGCTGGGCCTGG - Intergenic
1118924921 14:70183449-70183471 AGATCCGTGAAGGCTGAGACAGG - Intronic
1121005947 14:90490828-90490850 GAATGTGTGAGTGCTGGGAGTGG + Intergenic
1121606400 14:95243520-95243542 GGAGGAGTGAGTGCTAGGACTGG - Intronic
1121782083 14:96628433-96628455 AGAGCCGTGAGGGCGGGGACAGG + Intergenic
1127342996 15:58066200-58066222 GGTTCGGTGGGTCCTGGGACGGG - Exonic
1132867247 16:2099606-2099628 GGACCCGGGAGTACTGGGAATGG - Intronic
1133673761 16:8049752-8049774 GGTTCCATGAGAGGTGGGACTGG - Intergenic
1134524527 16:14933509-14933531 GGACCCGGGAGTACTGGGAATGG + Intronic
1134536093 16:15027997-15028019 TGATACGGGAGTGCTGGGAAGGG - Intronic
1134712116 16:16331996-16332018 GGACCCGGGAGTACTGGGAATGG + Intergenic
1134719973 16:16375289-16375311 GGACCCGGGAGTACTGGGAATGG + Intergenic
1134947453 16:18336596-18336618 GGACCCGGGAGTACTGGGAATGG - Intronic
1134954713 16:18376698-18376720 GGACCCGGGAGTACTGGGAATGG - Intergenic
1136398493 16:30005488-30005510 GGACTCGTGTGTGCTGGCACGGG - Exonic
1136612106 16:31372504-31372526 GCCTCCGTGAGTCCTGGCACTGG + Exonic
1138110702 16:54321489-54321511 GGATCCATGAGTCCTGGGATGGG + Intergenic
1138492063 16:57382637-57382659 GCATCCGTGTGCGCTGGCACGGG - Exonic
1138559039 16:57789079-57789101 TGATACGTGTGTGGTGGGACTGG - Intronic
1139614880 16:68082940-68082962 GGAATGGTGAGGGCTGGGACAGG - Intergenic
1141202771 16:81910529-81910551 GGATCCGGCAGTGCTGGACCCGG - Exonic
1142354807 16:89597334-89597356 GGATCCTGGTGTGCTGGGCCTGG - Intergenic
1143381065 17:6496638-6496660 AGATCCTTAAGGGCTGGGACTGG + Intronic
1143452292 17:7043249-7043271 GGAGCCGTGAGTGGAGGGATGGG - Intronic
1147325545 17:39667906-39667928 GGAAGGGTGGGTGCTGGGACGGG + Intergenic
1149995059 17:61401946-61401968 GGCTTCGTGAGTGTTGGGGCAGG + Exonic
1151477913 17:74354280-74354302 CGCTCAGTGAGTGCAGGGACAGG - Exonic
1152913714 17:83020798-83020820 GGATCTGTGAGGACGGGGACTGG + Intronic
1153665367 18:7363473-7363495 GGACCAGTGAGTACTGGTACTGG - Intergenic
1153922924 18:9807093-9807115 GGCTGCGTGAGAGCTGGGGCTGG + Intronic
1155806451 18:30176091-30176113 TGATACGGGAGTGCTGGGAAGGG - Intergenic
1156766586 18:40663414-40663436 TGATTTGTGAGTGCTGGGAAGGG - Intergenic
1157345156 18:46822785-46822807 GTATACGTGAGTGCTGGGGAGGG + Intronic
1157577647 18:48754430-48754452 GGGTGAGTGATTGCTGGGACTGG - Intronic
1160686715 19:440191-440213 GGATGCGTGGGTGCCGGGGCTGG + Intronic
1160855057 19:1213443-1213465 GAATGCGTGGGTGCCGGGACTGG - Intronic
1160898026 19:1411943-1411965 GAATCCCTGAGAGCTGTGACAGG + Intronic
1161107539 19:2452064-2452086 GGATCACTGAGTGCTGGGGGCGG - Intronic
1161140496 19:2644639-2644661 GGATGCGTGGGTGCCGAGACTGG - Intronic
1161300125 19:3538456-3538478 GGATTCGTGGGTGCCGGGACTGG - Intronic
1161328527 19:3675067-3675089 GGATGCATGGGTGCTGGGGCTGG + Intronic
1161794047 19:6376271-6376293 GCATATGTGAGTGCTGGGAAAGG + Intronic
1161879459 19:6937594-6937616 AGATCCTTGAGGTCTGGGACTGG - Exonic
1162452621 19:10764068-10764090 GCATCAGTGATTGCTGGGGCCGG + Intronic
1163417109 19:17193447-17193469 GGAGCTGTGGGTGCTGGGACGGG - Intronic
1163617000 19:18335334-18335356 TGATACGGGAGTGCTGGGATGGG + Intergenic
1167566697 19:50261456-50261478 GGATCTGTGAGGGGTGGGAGAGG - Exonic
1168277405 19:55285298-55285320 GGAACCTTGAGTGTTGGGACAGG + Intronic
1168571592 19:57475512-57475534 GGTTCTGTGAGTGCTGGGCTTGG - Intronic
926082871 2:10002996-10003018 GGAGCCGTGAGAGCAGGGAGTGG - Intergenic
926303101 2:11618160-11618182 GGATGGGTGACTCCTGGGACAGG + Intronic
926303110 2:11618192-11618214 GGATGGGTGACTCCTGGGACAGG + Intronic
926303119 2:11618224-11618246 GGATGGGTGACTCCTGGGACAGG + Intronic
927511677 2:23647922-23647944 GCATCTCTGAGTGCTGGTACCGG - Intronic
927696651 2:25244138-25244160 GAATTTGTGAGTGCTGGGCCTGG - Exonic
927982653 2:27384105-27384127 GGATCCCAGACTGCTGAGACTGG + Intronic
929428909 2:41870427-41870449 GGAACAGTGTGTGCTGGGATTGG - Intergenic
929944574 2:46360834-46360856 GGAGCCGAGAGTGCTGGGGGTGG - Intronic
932760450 2:74436173-74436195 GGATCCGTGAGTGCTGGGACTGG - Intronic
934762465 2:96864221-96864243 GGCTCGGTGAGTGCTAGGGCAGG - Exonic
939017419 2:136918934-136918956 GCATGCGTGAGTGATGGGTCTGG + Intronic
939044556 2:137234608-137234630 GGCTCCCAGAGTGCTGGGATTGG + Intronic
942104439 2:172618895-172618917 GCATCAGTGAGTACTGGGAAGGG + Intergenic
942789260 2:179740110-179740132 GGATTCTTGGGTGCTGGGAGAGG - Intronic
948029106 2:234801713-234801735 GGGTCCTTGAGAGCTGGCACAGG - Intergenic
948181977 2:235989451-235989473 GGAGAGGTGGGTGCTGGGACAGG + Intronic
1172179314 20:32991184-32991206 GGATCCACAGGTGCTGGGACTGG + Intronic
1172529733 20:35621651-35621673 GGCTCCTTGAGGGCAGGGACTGG - Intergenic
1176413090 21:6459285-6459307 GGACCTGTGAGAGCTGGGGCAGG - Intergenic
1178922285 21:36746659-36746681 GGATCCGTGGCTCCTGGGACAGG - Intronic
1179688585 21:43067607-43067629 GGACCTGTGAGAGCTGGGGCAGG - Intronic
1180867398 22:19127327-19127349 GGAGCCCAGAGTGCTGGGATGGG + Intergenic
1181955164 22:26582989-26583011 GCCTCCCAGAGTGCTGGGACTGG - Intronic
1184109781 22:42387895-42387917 GGAGCCGTGAGGCCAGGGACAGG - Intronic
1184248843 22:43249030-43249052 GGAAGGGTGAGTGGTGGGACAGG + Intronic
1185385067 22:50528015-50528037 GCCTCCCAGAGTGCTGGGACAGG + Intronic
950267416 3:11584903-11584925 GGATCCCTGGGTGCTGGGAGAGG - Intronic
952875516 3:37941365-37941387 GCATCTTTGTGTGCTGGGACCGG + Intronic
954800055 3:53181871-53181893 AGTTCAGTGAGTGCTGGGGCTGG + Intronic
958154886 3:89743863-89743885 GGATCCAGGAGTGCTGCGGCAGG - Intergenic
958661085 3:97068322-97068344 GGATCAGGGAGGGTTGGGACAGG + Intronic
961215563 3:125157580-125157602 GGAGCTGAGTGTGCTGGGACAGG - Intronic
962706860 3:138052035-138052057 GGCTCCTTGAGTGCAGGTACAGG + Intergenic
968494256 4:906774-906796 GGTTCCGTGGGTGGTGGTACTGG - Intronic
968753715 4:2403620-2403642 GGGTCGGTGAGTGCTGAGAGGGG - Intronic
969390528 4:6888873-6888895 GAAGACGTGAGTCCTGGGACTGG + Intergenic
969866690 4:10080918-10080940 GGATCTGTGAGTGCTGGGGATGG + Intronic
973344739 4:49042356-49042378 GGATCCCTGATTTCTGGGTCTGG + Intronic
976088325 4:81429399-81429421 TGATACGGGAGTGCTGGGAGGGG + Intronic
979860162 4:125683180-125683202 TGATACGGGAGTGCTGGGATGGG - Intergenic
979862260 4:125708045-125708067 TGATACGGGAGTGCTGGGAAGGG - Intergenic
985095530 4:186409086-186409108 GGATCAGTAAGTCCTGGGAGAGG - Intergenic
988830078 5:34978530-34978552 AGATCAGTGATTGCTGGGGCTGG + Intergenic
990336181 5:54774964-54774986 GGCTCTGTGAGTGCTGGGAGAGG - Intergenic
994329632 5:98490226-98490248 TGATACGGGAGTGCTGGGAAGGG + Intergenic
997139351 5:131362182-131362204 TGATACGGGAGTGCTGGGAAGGG - Intronic
997284071 5:132665812-132665834 CCACCCGTGAGTGCTGGGAAGGG - Intergenic
997429956 5:133830695-133830717 GGAGCAGGGAGTGCTGGGACTGG - Intergenic
998463369 5:142325182-142325204 TAACCCGTGATTGCTGGGACTGG + Intronic
1000280043 5:159774277-159774299 CGCTCCATGAGAGCTGGGACAGG - Intergenic
1001827126 5:174753964-174753986 GGAGCCATTAGTGCTGGGCCGGG + Intergenic
1001940054 5:175733960-175733982 TGATCCGGGAGTACTGGGAAAGG + Intergenic
1004442277 6:15664918-15664940 GGATCTGTTAGGGCTGGGATTGG + Intergenic
1004953700 6:20702917-20702939 TGATACGGGAGTGCTGGGAAGGG - Intronic
1006025753 6:31145612-31145634 GGATCAGAGAGAGCTGGGTCAGG + Intronic
1007482041 6:42156675-42156697 GGTGCCATGAGTGCTGGGAACGG - Intronic
1007673148 6:43573707-43573729 GCCTCCCAGAGTGCTGGGACAGG - Intronic
1015463005 6:133515062-133515084 GGATCAGTGAGGGCAGAGACTGG + Intronic
1016986215 6:149897785-149897807 GGATCCCTGAGTGCTTGGTGTGG + Intronic
1019411784 7:909748-909770 GGACTCGTGAGTCCTGGGGCAGG + Intronic
1019418499 7:937890-937912 AGATCCGGGGGTGCTGGGTCTGG - Intronic
1019943363 7:4308389-4308411 GGATCTGTGGGTGCTGGTGCAGG - Intergenic
1020016244 7:4833820-4833842 GGGCCCATGAGTGCTGGAACAGG - Intronic
1025635982 7:63319062-63319084 GGGTCCCTGAGTGCTGGAAAAGG - Intergenic
1025646714 7:63429118-63429140 GGGTCCCTGAGTGCTGGAAAAGG + Intergenic
1028228646 7:88279413-88279435 GGATCCGCCAGGGCTGGGAAAGG - Exonic
1029449600 7:100633399-100633421 GGATCCGTGAGTGCGCGCGCGGG - Exonic
1029845806 7:103411163-103411185 GGATTGGTTAGTGCTGGGAGAGG - Intronic
1030314540 7:108101154-108101176 GGATCCCTGAGTCCTGGGAGAGG + Intronic
1034843228 7:154419046-154419068 GGATCAGTGACTGCTGGAAATGG + Intronic
1035465789 7:159075719-159075741 GGGTCCGTGGGTGCTGGCCCTGG - Intronic
1035477703 7:159155345-159155367 GGAGCCGAGTGTGCTGGGAAAGG + Intergenic
1037128294 8:15376782-15376804 AGATGCGTGTGTGCTGGTACTGG - Intergenic
1038502952 8:28060694-28060716 GGAGCGGTGAGGGGTGGGACTGG - Intronic
1039188121 8:34940252-34940274 GGATCCCTGAGTAAGGGGACAGG + Intergenic
1039429364 8:37513647-37513669 GGCTCCCAAAGTGCTGGGACTGG - Intergenic
1040787308 8:51181173-51181195 TGATACTTGAGTGCTGGGAAGGG + Intergenic
1044306507 8:90646093-90646115 GGCTCCGTGGGTGCTGGGGCAGG - Intronic
1045691810 8:104767108-104767130 GCCTCCCTAAGTGCTGGGACAGG + Intronic
1045861437 8:106818784-106818806 TGATACGGGAGTGCTGGGAAGGG + Intergenic
1047642212 8:126832873-126832895 GGATCAGGCTGTGCTGGGACTGG - Intergenic
1049250051 8:141583443-141583465 GGAGCCGTGAGTGTCGGGAAGGG + Intergenic
1053218611 9:36293166-36293188 GGCTCCGTGAGGGATGAGACTGG - Intronic
1053305602 9:36982417-36982439 GGCTCCCTGAGGGCTGAGACTGG - Intronic
1055583567 9:77732847-77732869 GGATCAGGGAGAGCAGGGACAGG + Intronic
1057825971 9:98372190-98372212 GGATCCCTGAAGGCTGGAACAGG + Intronic
1061325745 9:129863087-129863109 GGAGCCCTGAGTGCTCGCACAGG - Intronic
1061369369 9:130189462-130189484 GGATCCCTGAGTGCCGGGGTCGG + Intronic
1061706309 9:132456031-132456053 GGAAATGTGAGTGCTGGGCCTGG + Intronic
1061753657 9:132798055-132798077 GGATCCCTGTGCGCTGGGAGAGG - Intronic
1188224130 X:27575526-27575548 TGATACGGGAGTGCTGGGAAGGG - Intergenic