ID: 932760893

View in Genome Browser
Species Human (GRCh38)
Location 2:74438589-74438611
Sequence CAGATCATGCAGGGCCTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1031
Summary {0: 2, 1: 4, 2: 67, 3: 240, 4: 718}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932760893_932760906 26 Left 932760893 2:74438589-74438611 CCTTCAAGGCCCTGCATGATCTG 0: 2
1: 4
2: 67
3: 240
4: 718
Right 932760906 2:74438638-74438660 CTACTATATTCCAGCCACACTGG 0: 1
1: 0
2: 16
3: 107
4: 558

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932760893 Original CRISPR CAGATCATGCAGGGCCTTGA AGG (reversed) Intronic
901702898 1:11054871-11054893 CACATCATTCAGGGCCTGGAGGG + Exonic
901883110 1:12205383-12205405 CAGATCAGACAGGGCCTGGTAGG + Intronic
902406154 1:16184731-16184753 CTGGTCATGCAGAGCCTTGGTGG - Intergenic
902408565 1:16199760-16199782 CAGACCATGAAGGGCCTTGTAGG - Intronic
902882828 1:19384188-19384210 CAGGTCTGGCAGGGTCTTGAAGG - Intronic
902908960 1:19580936-19580958 CAGATAGTGTAGGGCCTTGTAGG - Intergenic
902954873 1:19918742-19918764 CACAGCATTCAGGACCTTGAGGG - Intergenic
903008757 1:20315778-20315800 GGGAACGTGCAGGGCCTTGAAGG + Intronic
903052168 1:20609531-20609553 CAGATCACACAGGGCCTTACAGG + Intronic
903234565 1:21941397-21941419 TAGATCATGCCAGGCCTTGTGGG - Intergenic
903320572 1:22540727-22540749 CAGAGTATGCAGGGCCTTCTAGG + Intergenic
903926027 1:26831373-26831395 CAGATCATGCCTGGCCTAGAAGG + Intronic
904053485 1:27655362-27655384 TAGATCACGCAGGGCCTTGTAGG + Intergenic
904277241 1:29392509-29392531 CAGACTATGCAGGGCCCTGGAGG - Intergenic
904730430 1:32586788-32586810 CAGATCATATAGGGCCTTTTAGG + Intronic
905017780 1:34789341-34789363 CAGATCTTGCGGGCCCTTGAAGG - Intronic
905043023 1:34976168-34976190 CAAATCAGACAGGGCCTTGTAGG + Intergenic
905071621 1:35230813-35230835 CAGATCATGAATGGTCTTGAAGG + Intergenic
905280624 1:36846755-36846777 CAGACCATGCAGAGCCTTTTGGG + Intronic
905341538 1:37281797-37281819 CAGATTATGCAGGGCCTGGGAGG - Intergenic
905546876 1:38807207-38807229 CAGATCAGGAAGGGTCTTGTGGG + Intergenic
905654396 1:39676783-39676805 CCGATCATGCAGGACCTGGAGGG + Intergenic
905730647 1:40297025-40297047 TAGATTTTGCAGGGCCTTGTAGG + Intergenic
905843310 1:41204438-41204460 CAGATCATGCAGGACTATGTGGG - Intronic
906100292 1:43255975-43255997 CAGATTGTGCAGGACCGTGAAGG + Intronic
906175767 1:43770931-43770953 CAGAATATGAAGGGCCTTGTAGG - Intronic
906469174 1:46113225-46113247 CAGATCATGAAAGGCCCCGAAGG - Intronic
906784017 1:48598116-48598138 CAGATCACACAGGGCCTTGAAGG + Intronic
906824068 1:48959864-48959886 CAGATCATGTAGGGCCTTGTAGG + Intronic
907021249 1:51068599-51068621 CAGATCATGAAGGGTCTTGTGGG - Intergenic
907123075 1:52024688-52024710 TAGATCATGTAGGGCCTTATAGG - Intronic
907469595 1:54664605-54664627 CCGACCAGGCAGGGCATTGAGGG + Intronic
907530221 1:55088037-55088059 CAGATCAAGCAAGGCCTTGTGGG + Intronic
907638346 1:56159100-56159122 CAGATCATGCAGGGATCTGTAGG + Intergenic
907772947 1:57484221-57484243 CAGATCATCCTGGGCCTTGGGGG + Intronic
907931502 1:59005327-59005349 CAGATCATGCAGGGCTGTACAGG + Intergenic
907952162 1:59194151-59194173 CAGAGCATGCATGACCTTGTTGG - Intergenic
907965899 1:59329530-59329552 CAGGCCATGTAGGGCCCTGAAGG - Intronic
909480829 1:76127901-76127923 TGGGTCATGCAGGGCCTTAAAGG - Intronic
909884482 1:80923802-80923824 CAGATGATCCCAGGCCTTGAAGG - Intergenic
910322641 1:85965902-85965924 CAGGTCATGTAGGGCCTTGCAGG + Intronic
910662560 1:89689340-89689362 CAGATCACGTAGGGCCTTCTAGG + Intronic
910791395 1:91054761-91054783 CAGATGGTGCAGGGCCTTGCAGG + Intergenic
910902319 1:92134354-92134376 CAGATCATGGAGGGTCTTGCAGG - Intronic
911189998 1:94938591-94938613 CAGATGAAGCAGGGTTTTGAAGG + Intergenic
912179034 1:107195542-107195564 CAAATTATGTAGGGCCTTGTGGG - Intronic
912210407 1:107550849-107550871 TTCATCATGCAGGGCCTTGTAGG + Intergenic
912373853 1:109194369-109194391 CTGGTCAGGAAGGGCCTTGAGGG - Intronic
912630187 1:111240084-111240106 AAGTTTATGCTGGGCCTTGAAGG + Intronic
912698478 1:111858748-111858770 CAGATCATGGAAGGCCTTGTAGG - Intronic
912976386 1:114334823-114334845 CAATTCATGGAGGGCCTTAATGG + Intergenic
913286902 1:117234880-117234902 TAGATCATGTAGGGCCTTGTGGG + Intergenic
914695077 1:150069922-150069944 CAGACCATGCTGCACCTTGAAGG - Intronic
915024950 1:152818873-152818895 GAGACCAGTCAGGGCCTTGAAGG - Intergenic
915113312 1:153578647-153578669 CAAATCATGCAGAGCCTTGTAGG + Intergenic
915165840 1:153947208-153947230 CAGAACATGCATGGCACTGAAGG + Intergenic
915276168 1:154789680-154789702 CAGGACAGGCAGGGCCTTGGGGG + Intronic
915643338 1:157247384-157247406 TAGATGGTGCAGGGCCTTGCAGG - Intergenic
915647245 1:157281683-157281705 CAGATGGTGCAGGGCCTTGCAGG + Intergenic
915663410 1:157422880-157422902 CAGACGGTGCAGGGCCTTGCAGG - Intergenic
915900337 1:159842119-159842141 CAGATCATGCAGGGTCTGATAGG + Intronic
915923991 1:160002365-160002387 CAGATCCTGCAGGGTCTTGTAGG - Intergenic
916357811 1:163932990-163933012 CACGTCATGAAGGGCCTTGTAGG - Intergenic
916910997 1:169346283-169346305 CAGATCTTGGAGGGCTTTGTGGG - Intronic
917063556 1:171067089-171067111 CAGATCCTGCATGGCCTCAAAGG - Intergenic
917087731 1:171320419-171320441 CAGATCTTGGAAGGCCTTGTGGG + Intronic
917427280 1:174928058-174928080 CAGATCTTGAAGGGCCTTATAGG - Intronic
917811005 1:178658425-178658447 GAGAACCTGCAGGGCTTTGAGGG - Intergenic
917948722 1:180005687-180005709 TAGATCATGCAGGGCCATCTAGG - Intronic
918119097 1:181521970-181521992 CACATCATTCAGGGCCTCGTTGG + Intronic
918126160 1:181585855-181585877 CAGATCATGTGGAGCCCTGAAGG + Intronic
918316179 1:183324500-183324522 CAAACCATGCAGGGCCTTCTGGG - Intronic
918327211 1:183421320-183421342 CAGATCATACAGGGCCTTGTAGG + Intergenic
918413264 1:184282470-184282492 CAGATCCTGCAGGGCCTTTCAGG + Intergenic
919436665 1:197571310-197571332 CAGATCATACAAGGCTTTGAAGG - Intronic
919525906 1:198650183-198650205 CAGGTCCCACAGGGCCTTGATGG + Intronic
919733753 1:200931316-200931338 CAGATCATGAAGGGTCTTGTGGG - Intergenic
919754315 1:201057158-201057180 CAGATCATCTAGGCCCTTGAAGG - Intronic
919947426 1:202329851-202329873 CAGATCATGCGGGGTCTTATGGG + Intergenic
920034885 1:203059371-203059393 CAGTTCAGGAAGGGCCTTGCTGG - Intronic
920679617 1:208062560-208062582 AAGAGCATTCAGGGCCTGGATGG - Intronic
920844122 1:209579249-209579271 CAGATCGTGCAAGGCCTTGAAGG - Intergenic
922011613 1:221594431-221594453 CAGATTACGCAGGGCCTCGGAGG + Intergenic
922249404 1:223834143-223834165 TAGCTCAGGCAGGGCCTTGTAGG + Intronic
922366708 1:224872039-224872061 CAGATTCTGCAGGGCCTTGAAGG + Intergenic
922429080 1:225529220-225529242 CAGATCATGCAGGACCTTGCAGG - Intronic
922518978 1:226229875-226229897 CAGATCATGCATGGCTTTATAGG + Intergenic
922593144 1:226793999-226794021 GAAATCATGCAGCTCCTTGAAGG + Intergenic
922922266 1:229316015-229316037 CAGATAATGCAGTGCTTAGAGGG - Intergenic
922945593 1:229511140-229511162 GAGACCATGAAGGGCCTTGTAGG + Intergenic
923403237 1:233636139-233636161 CAGATCATGTAGGACCTTATGGG + Intronic
923616870 1:235545442-235545464 CAGGGCAGGCAGGGCCTTGGAGG + Intergenic
923664723 1:235989946-235989968 CAGATCCTATAGGGCTTTGAGGG + Intronic
923884608 1:238140651-238140673 CAGATAATGAAGGGCCTTATAGG + Intergenic
924173995 1:241370917-241370939 CAGATAATTTAGGGTCTTGAAGG - Intergenic
924532376 1:244904343-244904365 CACACCATGCAGGGCTTTGCTGG - Intergenic
924553255 1:245097931-245097953 CCGAGCATGAAGGGCCTTGTGGG + Intronic
924623931 1:245685135-245685157 CTGGTCAGGCAGGGCCTGGATGG + Intronic
924654178 1:245958320-245958342 CAGATTGTGAAGGGCCTTCATGG - Intronic
924721502 1:246627274-246627296 AAGATCATGTAGGGCCTTGTAGG - Intronic
1063437593 10:6047114-6047136 CAGGGCATGCAGGGATTTGAGGG - Intronic
1064561519 10:16599216-16599238 CATACCATGCAGGGCCATGCGGG + Intronic
1065626970 10:27639585-27639607 AAGATCATGCAGAGCCTCGTAGG + Intergenic
1065679196 10:28211839-28211861 CAGATCACACAGGGCCTGAAAGG + Intronic
1066123263 10:32312181-32312203 CAGATCATGCAGAGTCTTAGGGG + Intronic
1069173363 10:65260485-65260507 CAGATCAGGCAGGGCCTTACAGG + Intergenic
1069200849 10:65614420-65614442 TAGCTCATGTAGTGCCTTGAAGG + Intergenic
1069750354 10:70741365-70741387 CAAATCAGGGATGGCCTTGATGG - Intronic
1069777052 10:70933348-70933370 CAGTTCATGCTGAGCCTGGAGGG - Intergenic
1069838639 10:71325551-71325573 CAGATCATGGGGGGAGTTGAGGG - Intronic
1069914760 10:71780614-71780636 CAGATGTTGTCGGGCCTTGAGGG + Intronic
1069927440 10:71860558-71860580 CAGCTCATGCAAGGCCTTCTTGG - Intergenic
1070658464 10:78287619-78287641 CAGATCTTGCAGGGACTTCATGG - Intergenic
1070831807 10:79422397-79422419 CAGAGCAGGCTGGTCCTTGAAGG - Intronic
1071172943 10:82889011-82889033 CAGATCGGGAAGGTCCTTGAAGG + Intronic
1071420927 10:85498305-85498327 CAGATCATGTAGAGCTTTGCAGG - Intergenic
1071986950 10:91061535-91061557 CAGATCATGGGGGACCTTGTAGG - Intergenic
1072005674 10:91244462-91244484 CAGATTATGAAGGGCCATGTAGG + Intronic
1072185410 10:93033061-93033083 CAAATCATGTAAGGCCTTGAGGG + Intronic
1072565727 10:96615234-96615256 CAGATCACAAAGGGCCTTGTAGG + Intronic
1073147357 10:101289606-101289628 CAGGTGGTGCAGGCCCTTGAGGG - Intergenic
1073451141 10:103610091-103610113 TAGGACATGCAGAGCCTTGAAGG - Intronic
1073559808 10:104487104-104487126 CAGACCATGCAGAGCCTGAATGG + Intergenic
1074726533 10:116315897-116315919 CAGATCCAGCAGGGCCTTGAAGG - Intergenic
1074918554 10:117983181-117983203 CAGATCATGCAGGGCTCTCTAGG - Intergenic
1074936630 10:118188289-118188311 CAGAAGATGCTGGGCCTTGGGGG + Intergenic
1075258041 10:120940618-120940640 CAGAGCACGCAGGGCCTTGATGG - Intergenic
1075462524 10:122627018-122627040 CAGATCATTCAGGGCCTTGTGGG + Intronic
1075554695 10:123421901-123421923 CAGAGCACAAAGGGCCTTGAAGG - Intergenic
1077126775 11:942997-943019 CAGAACGTGCTGGGCCTTGAAGG + Intronic
1077649366 11:3956078-3956100 CAGATCATTCTGGGCCTTGCAGG + Intronic
1077900825 11:6486984-6487006 TGGATCATGCAGGGCCTTGTAGG - Intronic
1077906917 11:6541625-6541647 CAGATCATGCAAAGTCTTGTGGG + Intronic
1078422667 11:11224938-11224960 CAGAGGATCCAGGGTCTTGATGG - Intergenic
1078525466 11:12097562-12097584 CAGATCCTGCAGGGAGATGAGGG + Intronic
1078627571 11:12971555-12971577 TAAATCATACAGGGCCTTGTAGG - Intergenic
1078729127 11:13959984-13960006 CAGATCAAGCAGAGCCTTGGAGG + Intergenic
1079004823 11:16784130-16784152 CAGATCACTTAGGGCCTTGACGG - Intronic
1079281499 11:19090900-19090922 CAGGCCATGAAGGACCTTGAAGG - Intergenic
1079346397 11:19656504-19656526 CAGATCATGCCCAGGCTTGAAGG + Intronic
1079504323 11:21136328-21136350 CAGGTCATGTAGGGCCATGTGGG + Intronic
1079619970 11:22542025-22542047 CAGATCATGCAATGCCTTGTGGG + Intergenic
1080068706 11:28052333-28052355 CAGATCACATAGGGCCTTGTAGG - Intronic
1080373176 11:31676063-31676085 CAGGTCATGTAGGGTCTTGGTGG - Intronic
1080504654 11:32900590-32900612 TAGATCATGCAGGGCTTTGTAGG - Intronic
1080580369 11:33637445-33637467 CAGATCATGCAGGGTCTTAAAGG - Intronic
1080742687 11:35080858-35080880 CAGGTCAGGGAGGGCCGTGAGGG - Intergenic
1080931213 11:36813343-36813365 CATATCGTGTAGGGCCTTGTAGG - Intergenic
1081925050 11:46819387-46819409 CAGATCATGCAGGACTATGAAGG + Intronic
1082742583 11:56927046-56927068 CAGATCAGGCCTGGCCTTGTTGG - Intergenic
1082758854 11:57106476-57106498 CAAATCACGTAGGGCCTTGTAGG + Intergenic
1082773124 11:57224242-57224264 CAGGTCATGTAGGACCTTGAAGG - Intergenic
1083338976 11:61946296-61946318 CAGCTGAGGCAGGGCCTAGAAGG + Intergenic
1083432500 11:62621639-62621661 AGGATCATGCGGGGCCTTGCAGG + Intronic
1084942061 11:72618213-72618235 CAGAGCAGGCAGTGCCTGGATGG - Intronic
1084977538 11:72810860-72810882 CAGATCAAGCAGGGCCTTGAAGG + Intergenic
1085021535 11:73213254-73213276 CAGGTCACACAGGGCCCTGAAGG + Intergenic
1085063697 11:73472456-73472478 CAAATCATGCAGGGCCTCATAGG + Intronic
1085263925 11:75225198-75225220 CAGGCCATGCTGGGCCTTGCAGG - Intergenic
1085285388 11:75356606-75356628 GAGACCATGCTGGGCCTGGAGGG + Intergenic
1085336182 11:75698241-75698263 AAGGTTATGCAGGGCCTTGAAGG - Intergenic
1085358017 11:75857266-75857288 CAGATCATGAAAGGCCTTCTAGG - Intronic
1086239904 11:84677004-84677026 CAGATCATGAAGGGCCCTAGAGG + Intronic
1086304966 11:85469977-85469999 CAGATCTTGTAGAGCCTTGTAGG - Intronic
1086513715 11:87588567-87588589 TAGACCATGCAGGGCCTTCATGG + Intergenic
1087017846 11:93571930-93571952 CACATCAGGCAGGACCTTAAAGG + Intergenic
1087049500 11:93871132-93871154 CAGCTCATCCAGGGACCTGATGG + Intergenic
1087670863 11:101105155-101105177 CAGATGCTGTAGGGCCTTGAAGG + Intronic
1087779875 11:102290770-102290792 CAGGACAAGCAGAGCCTTGAAGG - Intergenic
1088280055 11:108126432-108126454 CAGATCATGCAGGTTCTTGGAGG + Intronic
1088673685 11:112168971-112168993 CAGATAATACAGGACCTTGAAGG + Intronic
1088859105 11:113783304-113783326 CAGACCTTGTAGGGCCTTGTAGG + Intergenic
1089852893 11:121515589-121515611 CAGATCCTATAGGGCCTTCAGGG + Intronic
1089893666 11:121906066-121906088 CAGATCGTAAAGAGCCTTGAAGG - Intergenic
1090772631 11:129934650-129934672 CAGATCAGGTAGGGCCTTATGGG - Intronic
1090868890 11:130725680-130725702 CTGACCATGGAGGGCCTTGCAGG + Intergenic
1091156387 11:133377924-133377946 CAGTTCCTGCAGGACCTTCAGGG + Intronic
1091427790 12:406502-406524 CAGATCATACAGGACCTTGTCGG + Intronic
1091461808 12:648731-648753 CAGATCATGATGGACCCTGAAGG - Intronic
1091704277 12:2683461-2683483 CAGATGAGACAGGGCTTTGAGGG - Intronic
1091761248 12:3088705-3088727 GGGATCAGGCTGGGCCTTGAGGG + Intronic
1091985417 12:4907318-4907340 CAGATCATGCAGGGCCTCTAAGG - Intergenic
1092147984 12:6227975-6227997 CAGATCCTGCAGGTCATTGCAGG + Intronic
1092391985 12:8088720-8088742 CAGATCACGCAGGGCCTTGTGGG - Intronic
1092737353 12:11595093-11595115 CCGATCATGCAGGACATTGTAGG - Intergenic
1092995243 12:13943496-13943518 CAGTTCACGTAGGGCTTTGAAGG - Intronic
1093318405 12:17680485-17680507 CAGATTGTGTGGGGCCTTGAAGG + Intergenic
1093354673 12:18152232-18152254 CAGTTCATGGAGGGCTTTGCAGG - Intronic
1093474502 12:19539687-19539709 TAGATCACGCAGGGCCTTAGAGG + Intronic
1093495538 12:19752817-19752839 AAAATCATACAGGGCCTTGTGGG - Intergenic
1093547405 12:20365379-20365401 AAGATCATGAAGGTCCTTGTAGG + Intergenic
1093829432 12:23737631-23737653 CAAATCATATAGGGCCTTGCAGG - Intronic
1094055506 12:26265432-26265454 TAGATCATGAAGGACCTTGCAGG + Intronic
1094099328 12:26744200-26744222 CAGCTCATATAGGGCCTTGTGGG - Intronic
1094141763 12:27188852-27188874 CACATCTTGCAGGGACTTGTAGG - Intergenic
1094173140 12:27515321-27515343 CAGATCACTTAGGGTCTTGAAGG - Intergenic
1095282177 12:40366092-40366114 CAGCTCATGCAGCACCTTGTAGG - Intronic
1095700504 12:45186220-45186242 CAGATCATGTAGGGCCTTACAGG + Intergenic
1095909270 12:47409372-47409394 CAGATCATGGAGGGCCTGGAAGG - Intergenic
1095926404 12:47583850-47583872 CAGACCATGTAGGGCCTTGGGGG + Intergenic
1096256982 12:50069032-50069054 CAGGTCACTCAGGGCCTTAAAGG - Intronic
1096684068 12:53276389-53276411 CAGATCACACAGGGCCTTATAGG + Intronic
1096971964 12:55673925-55673947 CAGATCACACAGGGCCTTATGGG + Intergenic
1097159035 12:57032753-57032775 CAGATCATGATGGGCCTTGTAGG + Intronic
1097414380 12:59296217-59296239 CAGGTGGTGCAGGGCCTTGTAGG + Intergenic
1097574744 12:61377438-61377460 AAGATCTTGCAGGGCCTTTTCGG + Intergenic
1097834560 12:64260112-64260134 GAGGTCATTAAGGGCCTTGAAGG + Intergenic
1097962317 12:65544862-65544884 CAGATCATGAAGGGACTTCTAGG - Intergenic
1097970727 12:65630194-65630216 CAGATGCTGCGGGACCTTGAGGG + Intergenic
1098107202 12:67081645-67081667 CAGATTATGCAAAGCCTGGATGG + Intergenic
1098216946 12:68230725-68230747 AAGATCATGCAGAGCCTTTTAGG + Intergenic
1098384853 12:69907948-69907970 CAGAGCAGGGAGGGCCTTGCAGG - Intronic
1098641938 12:72849525-72849547 CAGATAATACAGGACCTTGTAGG + Intergenic
1099203363 12:79700875-79700897 CAGATCATACAGGGTCTTAAAGG - Intergenic
1099210901 12:79787267-79787289 CAGATCATGCAGTGCCTTATAGG - Intronic
1099901645 12:88718030-88718052 CACATCATGCAGACGCTTGAAGG - Intergenic
1101006547 12:100406440-100406462 CAGATCATGGCAGGCCTTGTCGG + Intronic
1101548125 12:105736062-105736084 CAGCTCATGTAGTGCATTGAAGG + Intergenic
1101701289 12:107176672-107176694 CAGATCATGTGAGGCTTTGAAGG + Intergenic
1101761126 12:107660034-107660056 CAGCTCATGCTGGCCCTTGGTGG - Intergenic
1101798769 12:108002320-108002342 CTGATCCTGTAGGACCTTGAGGG - Intergenic
1101897339 12:108766657-108766679 CAGACCATGCCAGGCCTTGTAGG - Intergenic
1102478489 12:113204275-113204297 CAGATCACACAGGGCCTTTGAGG - Intronic
1102510903 12:113414753-113414775 CACATCACGCAGAGCCTTGGAGG - Intronic
1102596584 12:113997385-113997407 CAGATCATGCAGGGACATGCAGG + Intergenic
1103143380 12:118571900-118571922 CAGATCATTCTGGGCCTTCTAGG - Intergenic
1103172597 12:118834282-118834304 CAGATCATGCAGGGACATGTTGG + Intergenic
1103215873 12:119201066-119201088 CAGATCATGTGGGACTTTGAAGG - Intronic
1103252086 12:119508681-119508703 CAGAGCACGCAGGGCCTTTGTGG + Intronic
1103268088 12:119647902-119647924 CTGATCATGTAGGGCTTTGCGGG - Intergenic
1103387847 12:120547753-120547775 CAGATCATGTGGGGCTTTGAAGG + Intronic
1103813545 12:123634818-123634840 CAGGTCATGCAGGGCCTTATTGG + Intronic
1104072345 12:125356703-125356725 CAGACCACGCAGGGCCTTGTAGG - Intronic
1104081105 12:125431135-125431157 CAGCTACTGCAGGGCTTTGAGGG + Intronic
1104657160 12:130581900-130581922 CAGGTCATGCAGAGCCTTTCGGG - Intronic
1104749066 12:131227042-131227064 CAGCTCAGGCAGGTCCTAGAAGG + Intergenic
1105737832 13:23289763-23289785 CAGATTATGCAGGGATTTGCTGG + Intronic
1106041704 13:26099831-26099853 CAGATCAAGCAAGTCCTTGCTGG + Intergenic
1106310082 13:28546444-28546466 TAGATCATGCAGAACCTTGTAGG + Intergenic
1106446374 13:29835923-29835945 TAGATCATGCAGGACCCTGAAGG + Intronic
1106518938 13:30479930-30479952 CAGATTAGGGAGGGCCCTGAGGG - Intronic
1106929243 13:34646089-34646111 CAGATTATGGAGAACCTTGACGG + Intergenic
1107053548 13:36078425-36078447 CAGATCATCAAGGGCTTGGAGGG - Intronic
1107175219 13:37391953-37391975 CAGATCATGTAGGGCTTTGCAGG + Intergenic
1107975423 13:45683828-45683850 GAGGTCATGTAGGGCCTTGAGGG - Intergenic
1108126939 13:47254853-47254875 CAGATCATGTTGGGCCTTGAAGG + Intergenic
1108161549 13:47645463-47645485 CAGATCATGCAGGGCCCTGTAGG - Intergenic
1109278321 13:60326431-60326453 CAGATCATTTAGGGCCTTATAGG + Intergenic
1109339931 13:61043120-61043142 GAGATCATTCAGGACATTGAAGG + Intergenic
1109482119 13:62969587-62969609 CAGGTTATACAGGACCTTGAAGG - Intergenic
1110003249 13:70232800-70232822 CAGGTCATACATGGACTTGAAGG + Intergenic
1110145740 13:72188207-72188229 CAGACCATGCAGGGTCTTAAAGG - Intergenic
1110391942 13:74984256-74984278 AAGATCATAGAGGGCCTTGAGGG - Intergenic
1111073422 13:83200127-83200149 CAGTTCACACAGGGCCTTGAAGG - Intergenic
1111698974 13:91661843-91661865 CAGATCATTCAGGGCCCTGTGGG + Intronic
1112209828 13:97364726-97364748 CACACCATGCATGGCCTTGGAGG + Intronic
1112743787 13:102504964-102504986 CACACCATGCAGGGCCATGCAGG + Intergenic
1113028808 13:105971303-105971325 CAGATCAAGTAGGGCCTTCCAGG - Intergenic
1113288345 13:108878515-108878537 CAGATCACACACGGACTTGAAGG - Intronic
1114620000 14:24089993-24090015 CAGATCATGCAGAGCCTGGGAGG + Intronic
1115732666 14:36287994-36288016 CAGATCATGTAGGGCCCTGTAGG + Intergenic
1115775164 14:36706993-36707015 CAGATCATACTGGCCCTTGTAGG - Intronic
1116901523 14:50366457-50366479 CAGATCCTACAGGGCCTTGCAGG + Intronic
1117050132 14:51851538-51851560 TTGATCAGGCAGGGTCTTGATGG - Intronic
1117322394 14:54636373-54636395 GGAATCATGCAGGGCCTTGTAGG + Intronic
1117344616 14:54820033-54820055 CAGGTCATGAAGGGTCTTGTGGG - Intergenic
1117611160 14:57484728-57484750 CAGGTCATGCAGGGCCTGACAGG + Intronic
1117767876 14:59101726-59101748 CACATCATACAGGGGCTTGCAGG - Intergenic
1117769480 14:59118636-59118658 CAGATCATTTGGGGCCTTGTAGG - Intergenic
1117803624 14:59468288-59468310 CAAATCATGCAGTGCCTTGTAGG - Intronic
1117937138 14:60919245-60919267 CAGATCACTCAGGGTCTTGTGGG + Intronic
1118221238 14:63856195-63856217 CAGATCATGCAGGGCCTTTCTGG + Intronic
1119116544 14:72027107-72027129 CTGATCCTTCAGGGCCTTGTGGG + Intronic
1119215926 14:72869010-72869032 CTGGTCATGAAGGGCCTTGATGG - Intronic
1119557558 14:75565421-75565443 CAAATCTTGCAGGGCCTTGTGGG - Intergenic
1119626468 14:76181154-76181176 CAGATTATGCAGGGTATTGCAGG - Intronic
1119718926 14:76878135-76878157 CAGGTCAGGTGGGGCCTTGAGGG + Intergenic
1120013670 14:79445814-79445836 CAGATCATGGAGGGCCTTTGGGG + Intronic
1120159631 14:81131481-81131503 CAGATCATGTGTGGCCTTGTAGG - Intronic
1120991312 14:90379928-90379950 CAGATTATGGAGGGCCCTGAAGG + Intergenic
1121240614 14:92427407-92427429 CAGACCGTGCAGGGCCTTGAAGG + Intronic
1121538520 14:94707852-94707874 CCCATCCTGCAGGGCCTTAAAGG + Intergenic
1121661363 14:95637667-95637689 CAGGTCATAAAGGGCCTTAAAGG + Intergenic
1121691931 14:95884255-95884277 CAGATCGTGCAGGGCCCTGAGGG - Intergenic
1121752101 14:96365506-96365528 CACATCATGTAGGGCCTCGTAGG + Intronic
1121805929 14:96822832-96822854 GAGATCAAGTAGGGCCTTGAAGG - Intronic
1122146141 14:99689943-99689965 CAGGTCATGTAGAGCCTTGTGGG - Intronic
1122286466 14:100655379-100655401 CAGAACATGCAGGGCCTCCTTGG - Intergenic
1123412947 15:20074210-20074232 CAGGACACGCAGGGCCTGGATGG - Intergenic
1123522289 15:21081323-21081345 CAGGACACGCAGGGCCTGGATGG - Intergenic
1123672381 15:22672122-22672144 CAGACCGTGCAGGGGCTTGCGGG + Intergenic
1124324427 15:28745415-28745437 CAGACCGTGCAGGGGCTTGTGGG + Intergenic
1124528305 15:30478457-30478479 CAGACCGTGCAGGGGCTTGCGGG + Intergenic
1124770352 15:32529246-32529268 CAGACCGTGCAGGGGCTTGCGGG - Intergenic
1125102745 15:35933822-35933844 CAGATCATCCAGGGCCTTGTTGG + Intergenic
1125306356 15:38320392-38320414 CAGCTCATGCAGGGCCTAGTAGG + Intronic
1125530083 15:40407334-40407356 CAGCTCCTGCAGGGCCTAGTAGG + Intronic
1125841612 15:42806502-42806524 CAGATAATGCAGGGCCTTGTAGG - Intronic
1125896733 15:43308781-43308803 CAGATCATGCAGAGCTTTGGGGG - Intergenic
1125900629 15:43343337-43343359 CAGATCATGTGGGACCTTGTAGG - Intronic
1126559227 15:50025333-50025355 CAGACCCTGCAGGGCCTTCAAGG - Intronic
1126564941 15:50085103-50085125 AAGATTAGGCAGGGCCCTGAAGG - Intronic
1126635972 15:50780172-50780194 CAGATTATGAAAGGCCTAGAAGG + Intergenic
1127345054 15:58086447-58086469 CATATCATGCATGACCTTGGTGG + Intronic
1127387430 15:58477907-58477929 CAGATCATAGAGGGACTTGTGGG - Intronic
1127826464 15:62708407-62708429 CAGAGCAGGAAGGGCTTTGATGG + Intronic
1128581049 15:68810175-68810197 CAGACCATGCAGCACCTTGTTGG + Intronic
1129085278 15:73083072-73083094 CAAATAATTCAGGGCCTTGTTGG + Intronic
1129196401 15:73969786-73969808 CAGCTCATGTAGGGCCTGGTAGG - Intergenic
1129624534 15:77182792-77182814 CAGATCATGCAAGGCCTTTTAGG + Intronic
1130318449 15:82817360-82817382 CAGACCATGCAGGGGCTTGTGGG + Intronic
1130358684 15:83159852-83159874 CAGATTATTTAGGGCCTTGAAGG + Intronic
1130518458 15:84644294-84644316 TAGATCGTGCAGGGACGTGAAGG - Intronic
1130665596 15:85866771-85866793 CAGACCATGCAGGGCTGTGAAGG - Intergenic
1130898942 15:88192627-88192649 CAGCTTGTGCAGGACCTTGAGGG - Intronic
1131386317 15:92011063-92011085 CTGGTCATGTAGAGCCTTGAAGG - Intronic
1131585593 15:93689604-93689626 CAGTTTATGCAGGGCTTTGAAGG + Intergenic
1131623843 15:94097060-94097082 CAGAACATTCAGGGCCTTGTAGG + Intergenic
1132321619 15:100929744-100929766 CAGGGCAGGCAGGGCCTTGCAGG + Intronic
1132345048 15:101102998-101103020 CAGACCAGACAGGGCCTTGCAGG - Intergenic
1132828304 16:1915777-1915799 CAGCTCATCCAGGCTCTTGAGGG - Intronic
1133722334 16:8506716-8506738 CAGATGATGAAGGGCCTGGCAGG + Intergenic
1133801576 16:9090216-9090238 CAGATCCTGCAGGGGTTTGCAGG + Intergenic
1134036155 16:11032830-11032852 CAGGTCATGAAGGGCCTTGAAGG + Intronic
1134819910 16:17238627-17238649 CTGGTCATGCAGGACCTTGTAGG - Intronic
1135781381 16:25304445-25304467 TAGATCATTTAGGGCCTTGCTGG + Intergenic
1135846147 16:25920365-25920387 CAGATCATGGAGGGCCCCGTAGG - Intronic
1136056730 16:27695311-27695333 CAGGTCATGCAGGGCCTTGCAGG - Intronic
1136596421 16:31253254-31253276 CAGGTCATGCAGGTCCTTGTAGG + Intergenic
1136629466 16:31481082-31481104 CACATCATGAAGGCCTTTGACGG + Intergenic
1137306708 16:47207711-47207733 CAGAACTTGCAGGGCCCTGGGGG + Intronic
1137340011 16:47592339-47592361 CAGATCGGGAAGGGCCTTGCAGG - Intronic
1137358118 16:47786427-47786449 CAGATCATGTGGGGCCTTGCAGG - Intergenic
1137989207 16:53135240-53135262 CAGATTATACAGGGCCTTGTGGG + Intronic
1138044357 16:53705312-53705334 CAGATCATGCAGGATCTTGTAGG - Intronic
1138320344 16:56105993-56106015 CAGATCATGAGGGGCCTTAGAGG + Intergenic
1138356336 16:56383970-56383992 CAGAACATGCAGGGTCTTATAGG - Intronic
1138378613 16:56584538-56584560 CAGGTCATGTAGGGCCTGAATGG + Intergenic
1138679525 16:58674955-58674977 CAGATCCTGTTGGGCCTCGAGGG - Intronic
1138797255 16:59983940-59983962 CAGATCATAAAGGGTCTTGTAGG + Intergenic
1139477596 16:67210413-67210435 CAGAGCCTGCAGGGCCTCGGGGG + Exonic
1139510992 16:67428530-67428552 CAGATAAAGCAGGGCCTGGCAGG - Intergenic
1139607908 16:68033012-68033034 CTGATCATGCAGGGCCTTGTGGG + Intronic
1139608211 16:68035310-68035332 CAGATCATGTAGAGCCTTGTAGG - Intronic
1139739250 16:69021172-69021194 TAGATCATGAAGGGCCTTGCAGG - Intronic
1140476792 16:75242978-75243000 CAGGACACGCAGGGCCTGGACGG - Exonic
1141183951 16:81773903-81773925 CCCATCATGCAGGACTTTGATGG + Intronic
1142501702 17:336713-336735 CAGATCATGGACGGCCTTGAGGG - Intronic
1142957833 17:3533226-3533248 CAGAGTATGCAGGGCTTTGTGGG - Intronic
1142981064 17:3671956-3671978 CAGATCATGGAGGGCAGTAATGG + Exonic
1143347701 17:6262136-6262158 CAGATCTTGGAGGGTCTTGTGGG - Intergenic
1143971815 17:10801389-10801411 CAGATCTGGCAGGGCCTCGAGGG - Intergenic
1144212119 17:13024513-13024535 CACAACATGAAGGGCCTTGGAGG + Intergenic
1144444606 17:15315301-15315323 CAGATCATGCAGGGCCCTAATGG + Intronic
1144761661 17:17710737-17710759 CAAATGAGGCAGGGCCTTGTGGG - Intronic
1145005116 17:19333191-19333213 GAGCTCCTGCAGGGCCTTCAAGG - Intronic
1145222115 17:21097891-21097913 CAGATCAGGAAGAGCCTTGTGGG + Intergenic
1145266374 17:21381428-21381450 CAGACTGTGCAGGGCCCTGAGGG - Intronic
1145842042 17:28003400-28003422 CAGATCATGTAGGGCCCTAAAGG + Intergenic
1146241602 17:31233918-31233940 CAGATCAGGTAGAGCCTTGTAGG - Intronic
1146791803 17:35755074-35755096 TAGATCATGCAGGGCCTTGTAGG + Intronic
1146894592 17:36532476-36532498 CAGATGCTGCAGGTGCTTGAGGG + Intronic
1147218948 17:38917036-38917058 CCGATTATGCAGGGACTTGTGGG + Intronic
1147449911 17:40497757-40497779 CAGATCCCGTAGGGCCTTGCAGG + Intronic
1147620507 17:41863605-41863627 CAGATCCCGTAGGGCCTTGATGG - Intronic
1147863693 17:43539171-43539193 CAAGTCATGCAGAGCCTTGGAGG - Intronic
1148697790 17:49571424-49571446 CAGACCATGCAGGGCTTTACGGG - Intergenic
1149029219 17:52065005-52065027 CAGCTCATAGAGGGCCTTGTGGG - Intronic
1149388279 17:56164070-56164092 CAGATCATGAGAGGCCTTGGGGG - Intronic
1149451861 17:56755934-56755956 CAAATCATGCAGGAGCTTGGGGG - Intergenic
1149679937 17:58499148-58499170 CAGGTCATTGAGGGCATTGAAGG - Intronic
1149777373 17:59368685-59368707 TGGATCATGCAAGGCCTAGAAGG + Intronic
1150013117 17:61524834-61524856 CAGATATTGCATGGTCTTGATGG - Intergenic
1150323585 17:64237327-64237349 TGGGTCATGCAGTGCCTTGAAGG + Intronic
1150577435 17:66442555-66442577 CTGATGATACAGGGCCTTGTAGG - Intronic
1150650219 17:67005291-67005313 CATGTCATGCAGGGCCATGGGGG + Intronic
1150944671 17:69731965-69731987 CAGAACCTGCAGGGCCTTTGGGG + Intergenic
1151295743 17:73184982-73185004 CAGGCCACGCAGGGACTTGAAGG + Intergenic
1151947809 17:77329098-77329120 CAGGTCGTGCCGGGCCTTGGAGG + Intronic
1152264798 17:79288031-79288053 CAGAGCAGGCAGGGCCTCGTGGG - Intronic
1152381937 17:79946685-79946707 GAGCTGATGGAGGGCCTTGAAGG - Intronic
1153200602 18:2643684-2643706 AAGATCATGCAGGGCCTTGGAGG - Intergenic
1153464539 18:5374625-5374647 CAGATGATGCAGAGCTTTGAAGG - Intergenic
1154415633 18:14173992-14174014 CAGAACAGGCAGGGCCATGGTGG + Intergenic
1154955977 18:21255127-21255149 CAGATTATGAAGAGCCTTGAAGG - Intronic
1155337522 18:24780036-24780058 CAGATCACACAGGACCTTGTAGG - Intergenic
1155442937 18:25880976-25880998 CAGATCATGTAGGGTCTAGAGGG + Intergenic
1155833220 18:30544220-30544242 CAGACCATGCAAGGTCTTGTAGG - Intergenic
1155966317 18:32038652-32038674 CAGATCATGTGAGGTCTTGAAGG + Intronic
1156294143 18:35774635-35774657 CAGATGATACAGGGCCTTCTAGG - Intergenic
1156410859 18:36827569-36827591 CAGATCTTACAGGGACTTGTGGG + Intronic
1156809684 18:41232408-41232430 CAGATTATGTAGGGCCTTGTGGG - Intergenic
1158903538 18:61988352-61988374 CAGGTCATGTGGGGCCTTGCAGG + Intergenic
1160676335 19:393339-393361 CAGGTCATTCAGGGCCTGGTGGG + Intergenic
1160940496 19:1618473-1618495 CAGGTCATGCGGGGCCTTGTGGG - Intronic
1161266991 19:3368714-3368736 CAGACCAGGCTGGGCCTTGGGGG - Intronic
1161274924 19:3410570-3410592 CGGGCCATGCAGGGCCTTGTGGG + Intronic
1161277459 19:3426640-3426662 CAGGTTGTGCAGGGCCTTGTGGG - Intronic
1161286468 19:3471056-3471078 CAGGTCATTCAGGGCCTTGTGGG + Intergenic
1161300028 19:3538044-3538066 CAGGGCGTGCAGGGCCTTGTGGG + Intronic
1161301596 19:3545370-3545392 CAGGTCGTGCAGGGCCTGGTGGG - Intronic
1161451769 19:4350299-4350321 CAGGTCATGCAGGGCTCTGTAGG + Intronic
1161621412 19:5299225-5299247 CAGGTCATGCAGGGCCTTGTGGG - Intronic
1161634238 19:5377234-5377256 CAGGTCATGCAGGGCCTTGTGGG + Intergenic
1161644489 19:5444680-5444702 TAGGTCATGCAGGGCCTTGTGGG - Intergenic
1161649363 19:5474819-5474841 CAAGTCATGCAGGGCTTTGCGGG + Intergenic
1161650382 19:5480608-5480630 CAGGTCGTGCAGGGCCTGGTAGG + Intergenic
1161657167 19:5523396-5523418 CAAATCATGCAGGCCTTTGTGGG - Intergenic
1161741104 19:6021713-6021735 CGGGTCCTGCAGGGCCTTGTGGG + Intronic
1161875438 19:6905022-6905044 CAGATTCTGCAGGGTCTTGGTGG + Intronic
1162148624 19:8629428-8629450 CAGGTCATGAAGGGCCTTGTGGG + Intergenic
1162365358 19:10245408-10245430 CAGGTCCTGCGGGGACTTGAGGG + Intergenic
1162429932 19:10622276-10622298 CAGGTCATGCAAGGCTTTGTGGG + Intronic
1162456542 19:10788421-10788443 CAGGTTGTGCAGGGCCTTGTGGG + Intronic
1162536433 19:11265230-11265252 TTGATCATGCTGGGCCTTGTGGG - Intergenic
1162544698 19:11321693-11321715 CAGATCATGCAGGGCCCCGGGGG + Intronic
1162829965 19:13278260-13278282 CAGATCGTGCAGGGGCTTGAGGG - Intronic
1162837869 19:13333163-13333185 CAGATCAAGCAGGGGCTTATAGG - Intronic
1163000130 19:14362063-14362085 CAGATCCTGCAGGGCCCTGTGGG + Intergenic
1163017802 19:14467481-14467503 CAGATCTTGCAGGGCCTCGGAGG + Intronic
1163406996 19:17128991-17129013 CAGTGCCTGCATGGCCTTGACGG + Intronic
1163477078 19:17532753-17532775 CACACCATGTAGGGCTTTGAGGG + Intronic
1164494461 19:28746606-28746628 CAGATCCTGCAGAGCCCTGGAGG - Intergenic
1164519646 19:28968838-28968860 CTGGTCATGCAAGGCATTGATGG + Intergenic
1165083999 19:33329985-33330007 TGGATCATGCTGGGCCTTGTAGG - Intergenic
1165322674 19:35095980-35096002 CAGATCCTGTAGGGCCTTGTGGG + Intergenic
1165475905 19:36030699-36030721 CAGATCTGGAAGGGCCTTCAAGG - Intronic
1165649172 19:37470557-37470579 CAGATTATGCAGGGCCCTGCAGG - Intronic
1165661326 19:37582989-37583011 CAAATCATGTAGGACCTTGTTGG - Intronic
1165736976 19:38183150-38183172 CAGACCATGGAGGGTCTTGAGGG + Intronic
1166082390 19:40452162-40452184 CATATCAGGTGGGGCCTTGAGGG - Intronic
1166341151 19:42138001-42138023 CAGATCGCACAGGGCCTTGCAGG + Intronic
1166833263 19:45651072-45651094 CATATCTTGCAGGGCCTCAAAGG + Intergenic
1167243427 19:48359220-48359242 CAGATCGTACTGGGCCTTGTGGG - Intronic
1167297230 19:48658469-48658491 TAGATCATGCAGGGCTTTGTGGG + Intergenic
1167325087 19:48819479-48819501 CAGATCAGGCAGGGCCTTGAAGG - Intronic
1167490637 19:49790999-49791021 CAGACCCTGCAGGGCCTTGTTGG - Intronic
1167564535 19:50248176-50248198 CAGATCATGCAGGGTCTTAGGGG + Intronic
1167611195 19:50508438-50508460 CAGACCACGCAGGGCCTTGTGGG - Intronic
925937121 2:8774755-8774777 CAGATCATAAAGGGCTTTGTAGG + Intronic
926363612 2:12113175-12113197 CAGATCGTGCTGGGCCTTGTGGG + Intergenic
927238303 2:20898392-20898414 CATATCCTGCAGGGCCTTGCAGG - Intergenic
927601805 2:24449298-24449320 CAGATCATGTAGATCCTTGTAGG - Intergenic
928067605 2:28182114-28182136 CTGATCATGTAGGGCCTTACAGG + Intronic
928255996 2:29723133-29723155 CAGATCCTGTGGGGCCTTTAGGG - Intronic
928405387 2:31010710-31010732 CTGATCAGGCAGGGCCTTGGGGG - Intronic
928440788 2:31290228-31290250 CAGGTCATGCAGGGCCTTAAAGG - Intergenic
928443929 2:31316348-31316370 CAGAGCATGCAGGCACTTGCAGG - Intergenic
929369571 2:41206218-41206240 CAGAAAATACAAGGCCTTGAAGG + Intergenic
929642355 2:43594631-43594653 CAGATTATTTAGGGCCTTGAAGG - Intronic
929742817 2:44621684-44621706 CAGATCATATATGGCCTTGTAGG + Intronic
929893908 2:45941518-45941540 CAGAGAAAGCAGGGCCGTGAAGG + Intronic
929982254 2:46692464-46692486 CAGATCATGCAGAACTTTGAAGG - Intergenic
930099493 2:47591889-47591911 CAGAAAAAGCAGAGCCTTGAGGG - Intergenic
930277971 2:49335852-49335874 CAGATCATGCATGGCCATGCAGG + Intergenic
930656541 2:54012881-54012903 CAGAGCACTCAGGGCCTTGTAGG - Intronic
930886598 2:56333458-56333480 CAGATCACACAGGGCCCTGATGG + Intronic
931065191 2:58578264-58578286 CAGATCATGCTGGACCTTGTGGG + Intergenic
931294294 2:60906514-60906536 CAGATTATGAAGGGCTTTAAAGG - Intronic
931339211 2:61382280-61382302 CAGATTATTCAGGACCTTGTAGG - Intronic
931361292 2:61580023-61580045 CAGAACATTTAGGCCCTTGAGGG + Intergenic
931648195 2:64444430-64444452 CAGCTCCTACAGGGCCTTGAAGG + Intergenic
931973690 2:67619089-67619111 CAGATCATGGAGGGGTTTGTGGG + Intergenic
932066112 2:68562778-68562800 GAGATTATGAAGGACCTTGAAGG + Intronic
932480060 2:72033677-72033699 CACAGCATGCAGGGCCCTGTCGG - Intergenic
932612484 2:73210165-73210187 CAGATCACCCAGGACCTGGAAGG - Intronic
932760893 2:74438589-74438611 CAGATCATGCAGGGCCTTGAAGG - Intronic
933583810 2:84158470-84158492 CAGATCATGTAGGTCACTGAAGG + Intergenic
933599653 2:84316624-84316646 CACTTCAAGCAAGGCCTTGAAGG + Intergenic
933780509 2:85797417-85797439 CAGGTGGTGCGGGGCCTTGAAGG - Intergenic
933806913 2:86005205-86005227 CAGACCATGCAAGGCCTTAGAGG + Intergenic
935853379 2:107247764-107247786 CAAATGATGCTGGGCCCTGAAGG + Intergenic
936351079 2:111713088-111713110 CAGAGCATGCAGAGCCCTGCAGG + Intergenic
936599647 2:113883300-113883322 CAGAACATGGAGGGCTTTGTAGG + Intergenic
937205048 2:120231026-120231048 CCGGTCAGCCAGGGCCTTGAAGG - Intergenic
937208111 2:120249811-120249833 CAGATGATGCAGGGGCTTCTCGG - Intronic
937487843 2:122334458-122334480 CAGATCATACAGGGTCTTACTGG - Intergenic
938047902 2:128139726-128139748 CACATCATTCAGGGACTTGCAGG + Intronic
938382936 2:130846752-130846774 CAGCTGGTGCAGGGCATTGATGG + Intronic
938548878 2:132361289-132361311 CAGATCCTGCAGTGCCTTCCTGG - Intergenic
939399129 2:141668678-141668700 CAGATTATACATGGACTTGAAGG - Intronic
939829390 2:147054009-147054031 CAGGTCACACAGGGACTTGAAGG - Intergenic
939901697 2:147858439-147858461 CATATCATACAGAGCCTTTAAGG - Intronic
940224612 2:151388755-151388777 CAGATCATGATGGGCCTTCTAGG - Intergenic
940415683 2:153417298-153417320 CAGATGATGTAGGGCCTTGCAGG + Intergenic
940508865 2:154587227-154587249 CAGAACATTCAGGGCATTCAGGG + Intergenic
940579815 2:155564270-155564292 CAAATTAAGTAGGGCCTTGAAGG + Intergenic
940736042 2:157453633-157453655 TAGAACATGCAGGACCTTGAAGG - Intronic
940810140 2:158233664-158233686 CAGTTCATGCAGGGGTTTGGAGG + Intronic
941043992 2:160652296-160652318 CAGAGCATGCAGGGCCTTCTAGG - Intergenic
941083157 2:161085967-161085989 GAGATCATATAGGGCCCTGAAGG + Intergenic
941721972 2:168821869-168821891 CAGATCATGCAGAGCTTTGCAGG + Intronic
941801916 2:169669325-169669347 CAGATCATACAGAGCCTTGGAGG + Intronic
941880563 2:170476414-170476436 CAGGTCATACATGGGCTTGAAGG + Intronic
942111349 2:172685391-172685413 CAGAACATGCAGAGCCTTGAAGG - Intergenic
942428134 2:175880757-175880779 TAGATCATGCAGGACCTTCACGG + Intergenic
943040028 2:182793275-182793297 CAGATCATAGAGGGCTTTGCAGG + Exonic
943626824 2:190210620-190210642 CAGAGCATACAGAGCCTTGAAGG - Intronic
944325777 2:198401825-198401847 CAGATCATGCAGGACCTTGTAGG - Intronic
944395529 2:199262213-199262235 CAGATCATGTAGGGCCTTGCAGG + Intergenic
944505898 2:200410480-200410502 CAGATCGTACAGGGCCTACAAGG - Intronic
945679785 2:212899895-212899917 CAGATCATTCAGGGCCTTATGGG + Intergenic
946111507 2:217422097-217422119 CAGACCATGACAGGCCTTGAAGG - Intronic
946268585 2:218569607-218569629 CACATCATACAGGGCCGTGCAGG - Intronic
946460688 2:219865894-219865916 TAGATCTTGCAGGACCTTGAAGG - Intergenic
947087133 2:226466027-226466049 CAGACCATGTAGGGCATTGCAGG - Intergenic
947659636 2:231856912-231856934 CAAAGCACGCAGGTCCTTGAGGG + Intergenic
948202820 2:236142203-236142225 CAGATCACGTAGGACCTTGCAGG - Intergenic
948486330 2:238283604-238283626 CAGATCACGGAGTGCCTTGCGGG + Intronic
948791421 2:240379368-240379390 CAGAACATGTGGGGCCTTGCAGG - Intergenic
949030468 2:241794514-241794536 CTGATCAGGCAGGGCCATCAGGG - Intronic
1168914286 20:1473736-1473758 CAGCTCATGCAGGGCCCTACAGG + Intronic
1168958152 20:1849054-1849076 CAGATCACACAGGGCCTTGAAGG - Intergenic
1169815290 20:9650176-9650198 CAGATCATCCAGTCCCTTGTAGG - Intronic
1170301539 20:14889730-14889752 CAGATTATGTAGGGCCTTGGAGG + Intronic
1170385225 20:15809208-15809230 CACATCATGCAGTGTCTTGCAGG - Intronic
1170464442 20:16610140-16610162 CAGATCATGTAAGGCCTTTGTGG - Intergenic
1170733237 20:18991789-18991811 CAGAATATGCAGGGCCTTCTAGG - Intergenic
1171006556 20:21471514-21471536 CAGGCCTTGGAGGGCCTTGAAGG + Intergenic
1171152030 20:22835697-22835719 CAGATCCTGCAGGGCCTTGCAGG + Intergenic
1172012695 20:31855475-31855497 TAGATCATGAATGTCCTTGAAGG + Intronic
1172012810 20:31856295-31856317 CAGTTCATGGATGGCTTTGAGGG + Intronic
1172294277 20:33797378-33797400 GACATCATGTAGGGACTTGAGGG + Intergenic
1172399550 20:34638076-34638098 CAGACCAGGCAGGGCCATGTGGG - Intronic
1172441986 20:34972208-34972230 CAGATCATTCAGAGCCTTGAAGG - Intergenic
1172518223 20:35550651-35550673 CATATCATGCAGGGCTTGCAGGG + Intronic
1172807105 20:37619913-37619935 CAGAACATGCAGGACCTCGTAGG + Intergenic
1172836866 20:37878717-37878739 CGGATCTTACAGGGCCTTGAGGG + Intergenic
1172940849 20:38653441-38653463 CAGATGGTGCAAGGCCTTGATGG + Intergenic
1172972378 20:38883014-38883036 TAGATCATGCAATGCCTTGGAGG + Intronic
1173007356 20:39150605-39150627 CAGATCAGGCAGGGGCCTAATGG + Intergenic
1173029075 20:39337940-39337962 CAGATCATGGAGGACCTTCCAGG - Intergenic
1173209269 20:41019484-41019506 CAGTTCATGCAGGGTCTCTAAGG - Intergenic
1173338655 20:42134847-42134869 CAGATCATGCAAGACATTGCAGG - Intronic
1173387617 20:42603531-42603553 TAGATCTTGCTGGGCCTTGTGGG + Intronic
1173559552 20:43993150-43993172 CGGATCATGCAGGACTTTGCAGG + Intronic
1173587446 20:44193615-44193637 CAGATCATGGAGGGCCTGGTAGG - Intergenic
1173688529 20:44940965-44940987 CAGATCATGCAGGGTCTCCTAGG - Intronic
1173749401 20:45465037-45465059 AAGATCATGAAGGACCCTGAAGG - Intergenic
1173759052 20:45543761-45543783 CAGACAATGAAGGGCCTTGTGGG - Intronic
1173833034 20:46104955-46104977 CAGATCTCGCAGGGCCTTGAAGG - Intergenic
1173916722 20:46713546-46713568 CAGATCCTGCAGAGTCTTGAAGG + Intronic
1173946359 20:46953933-46953955 CAGCTCACACAGGGCCTTGTAGG - Intronic
1173953698 20:47013716-47013738 GAGCCCATGCAGGGCCTTGGGGG + Intronic
1174065339 20:47860644-47860666 CACACCATTCAGGGCCTTGCAGG - Intergenic
1174115299 20:48222837-48222859 CAGATCCTGCAGGCCCTTGTGGG + Intergenic
1174117577 20:48237864-48237886 CAGGCCATGGAGGGCCTTGCAGG - Intergenic
1174163935 20:48571283-48571305 CAGGCCATGGAGGGCCTTGCAGG + Intergenic
1174173201 20:48629589-48629611 GAGCTCATCCAGGGCATTGATGG + Exonic
1174199675 20:48798484-48798506 CAGAGCATGCAGGGCCTTCCAGG - Intronic
1174201341 20:48808690-48808712 CAGATTGCACAGGGCCTTGAGGG - Intronic
1174276751 20:49409621-49409643 CAGATCGGGCAGAGCTTTGAAGG + Intronic
1174277371 20:49413752-49413774 CAGATCAGACAGGGTCTTGAAGG - Intronic
1174413823 20:50353734-50353756 CAGACCAGGCAGGGCCTTGCGGG + Intergenic
1174466715 20:50723489-50723511 CAGATCATGCAGCCTCTTGCAGG - Intergenic
1174562158 20:51439137-51439159 CAGGTTGTGCAGGGCCTTGAGGG - Intronic
1175024665 20:55889156-55889178 CAGATTGTGCAGGGCCTTGTGGG + Intergenic
1175082585 20:56433433-56433455 AAAATCACACAGGGCCTTGATGG + Intronic
1175467943 20:59205267-59205289 CAAATCCTGCAGGGCCTGGGTGG - Intronic
1175625333 20:60484562-60484584 GAGATGATGCAGGGCTTGGAGGG - Intergenic
1176857695 21:13985284-13985306 CAGAACAGGCAGGGCCATGGTGG - Intergenic
1176866904 21:14058915-14058937 CAGAACAGGCAGGGCCATGGTGG + Intergenic
1176958184 21:15129999-15130021 TAGATCATGCAGGATCTTGAAGG + Intergenic
1176981027 21:15381119-15381141 CAGGTCATACACGGACTTGAAGG - Intergenic
1177863100 21:26478499-26478521 CAACTCATGCAGTACCTTGAAGG + Intronic
1177963982 21:27704156-27704178 CAAATTATGCACGGCCTTGCAGG - Intergenic
1178097778 21:29234413-29234435 CAGATCACACATGGGCTTGAAGG + Intronic
1178142655 21:29701522-29701544 CAGATCACAGAGGGCCTTAAGGG + Intronic
1181830265 22:25555008-25555030 CAGACCCTGCAGGGCCTTGGAGG - Intergenic
1181888521 22:26040848-26040870 CAGATGATGTAGGGCCTTGTAGG + Intergenic
1182147182 22:28003788-28003810 CAGAGAATGCATGTCCTTGAAGG + Intronic
1182311329 22:29410121-29410143 TAGATCATGCTGGGCCCTGTTGG - Intronic
1182482010 22:30615230-30615252 CAGGACAGGCAGGGGCTTGAGGG - Intronic
1182516847 22:30863885-30863907 CAGACCAGGCAGGGCCCTGAGGG - Intronic
1182642481 22:31779522-31779544 CAGTTCATGCAGGGCCTTCAAGG + Intronic
1182689644 22:32149814-32149836 CGGATCATGCTGGGCCCTGTTGG + Intronic
1183380278 22:37487230-37487252 CAGCTCACGCAGGGCCTTGTGGG - Intergenic
1184020702 22:41819429-41819451 CAGCTGAGGCAGGGCCTTCAGGG + Intronic
1184295534 22:43521829-43521851 CAAATCCTTCAGGGCATTGAAGG - Intergenic
1184419325 22:44370391-44370413 CAGAGCCTGCAGGGCCTTGTGGG + Intergenic
1184617395 22:45647285-45647307 CATATCATTCAGGACCTTCATGG - Intergenic
1184637801 22:45848971-45848993 CAGATCATGCAGGGTCTTCAAGG + Intergenic
1185351286 22:50340811-50340833 CAGGTCATGTAGGGCCCTGTGGG + Intergenic
950076552 3:10191458-10191480 TAGACCATGCAGGGCCTTGTAGG - Intronic
950080646 3:10219741-10219763 CAGACCATGCAGGTACTCGACGG - Exonic
950201657 3:11048682-11048704 CAGATCAGACAGGGCCTTGCAGG - Intergenic
950628385 3:14265142-14265164 CAGTTCAGGCAGGGCTTAGAGGG - Intergenic
950758677 3:15201192-15201214 GAGACCATGTAGGGCCTTGTAGG - Intergenic
950890950 3:16403106-16403128 CAGATGTTGGAGTGCCTTGAAGG - Intronic
951277798 3:20710949-20710971 CAGATCATGCAAGGCCTTGTAGG + Intergenic
952077862 3:29720042-29720064 CAGATCACATAGGGCCTTGTGGG - Intronic
952134931 3:30407833-30407855 GAGATCATGCAGGGTTTTGTGGG - Intergenic
952495621 3:33913564-33913586 CAGATCCTCCAGGGCCTGGTGGG - Intergenic
952498343 3:33935765-33935787 CAGAGCATCCAGGGTCTTGTGGG + Intergenic
952500775 3:33959811-33959833 CAGATCATGTAGAGCCCTGCAGG + Intergenic
952598786 3:35053112-35053134 CAGATCAAGTAGAGTCTTGAGGG - Intergenic
952845297 3:37683080-37683102 CAGATCCCACAGGGCCTTGAGGG - Intronic
953070064 3:39511321-39511343 CAGATAATTCAGGGCCATGTAGG - Intronic
953670314 3:44956887-44956909 CAGATTGTGCAGGGCCTGGTAGG - Intronic
953839130 3:46374691-46374713 TAGATCATGAAGAACCTTGACGG + Exonic
954092969 3:48300238-48300260 AAGATCATGCAGAGCCTGGGAGG - Intronic
954334826 3:49910099-49910121 CAGGTGAGGGAGGGCCTTGAGGG - Exonic
954473081 3:50715783-50715805 AAGATCATGGAGGGCCTTAAAGG + Intronic
954615054 3:51965246-51965268 TGGATCATGAAGGTCCTTGATGG - Intronic
955074928 3:55604614-55604636 CAGAGCATGCCAGGCCTTGTAGG + Intronic
955275044 3:57539306-57539328 CAGATAGTGTAGGGCCTTGTCGG - Intronic
955433536 3:58874494-58874516 CAGAACATGCAGGGTTTTGCGGG - Intronic
955552711 3:60101251-60101273 CACATTATGCAGGGCCTTGCAGG - Intronic
955632687 3:60991346-60991368 CAGATCAGGTGGGGCCTTGCAGG + Intronic
955676322 3:61452753-61452775 CAGATCATTCAGGGTCCTGTAGG - Intergenic
955763053 3:62309992-62310014 CTGATCAAGCAGGGCCTTAGAGG + Intergenic
957127514 3:76180842-76180864 CAGAAAATTCAGGGCCTTGTAGG - Intronic
957225192 3:77434117-77434139 GAGATAATGCAGGGTCTTGTAGG - Intronic
957883811 3:86256591-86256613 TAGATCATGTAGGGCCCTGTAGG + Intergenic
958193852 3:90217855-90217877 AAGATCATCTAGGGCCTTGGGGG - Intergenic
958417213 3:93888919-93888941 AAGATCATCTAGGGCCTTGGAGG - Intronic
958915388 3:100044612-100044634 CAGATTATACAGGGCCTTATAGG + Intronic
959399637 3:105883914-105883936 CAGACCATGCAGGGCTTTGTAGG - Intergenic
959629311 3:108490524-108490546 CAGACCATGCAGTGCATTGCAGG - Intronic
959672186 3:108991103-108991125 CAGGACATCTAGGGCCTTGAGGG + Intronic
959689431 3:109182632-109182654 CAGATCATGCAGGGCCTTGAAGG - Intergenic
960406160 3:117262409-117262431 CAGGTCATGGTGGGCCTTGTAGG - Intergenic
960486954 3:118264949-118264971 CAGATCATGTAGGGCCTTTCAGG + Intergenic
960548342 3:118944311-118944333 CAGATTAAGCAGAGCCTTGAAGG - Intronic
960619752 3:119626552-119626574 CAGACCCTGCCAGGCCTTGAAGG + Intronic
961317357 3:126049679-126049701 CAGATCATGTGGAGCCTTGTGGG - Intronic
961697012 3:128712412-128712434 CAGATAGTGCAGGGCCTTGAAGG + Intergenic
961951076 3:130749779-130749801 CAGATCATGCAAGGTTTTGTGGG - Intergenic
962072713 3:132048360-132048382 TGGATCATGCAGGACCTTGCAGG - Intronic
962206884 3:133442045-133442067 ACAAGCATGCAGGGCCTTGAAGG + Intronic
962230325 3:133659980-133660002 GAGGTCATGTAGGGCCTTGTGGG - Intronic
962435613 3:135363841-135363863 CAGATCTTGCAAGTCCTTGCTGG + Intergenic
962731958 3:138291897-138291919 CAGACCATGAAGAGCCTTGTAGG + Intronic
963086204 3:141438776-141438798 CAGATCATAAAGGGCCCTAAAGG - Intronic
963219171 3:142788060-142788082 CAGACCATGCATGGCCTTGTAGG + Intronic
963407771 3:144889591-144889613 CAGATCATGAATTGCCTTGAAGG - Intergenic
963564176 3:146906960-146906982 CAGCTTATGGAGTGCCTTGAAGG + Intergenic
964155610 3:153581599-153581621 CAGATCATCCAGTGCCTTATAGG - Intergenic
964373950 3:156031269-156031291 CAGATCATGCAGGGCCCTGTTGG + Intergenic
964435996 3:156654412-156654434 CAAATCATGCATGGCCTTGTGGG + Intergenic
964466227 3:156996442-156996464 CACATCATGCAGGGCCTTGCAGG + Intronic
964763722 3:160158380-160158402 TGGATCATGCAGGGCCTTGTAGG - Intergenic
964931140 3:162024898-162024920 CAGGTCATGGAGGGGCTTGCTGG - Intergenic
965247887 3:166298937-166298959 GAGATCGTGCAGGACCTTTAAGG - Intergenic
965405364 3:168261472-168261494 CAGAGCGTGCAAGGCCTTGGAGG + Intergenic
965503084 3:169479486-169479508 CAGACCATGCAAGGCTTTGAAGG + Intronic
965610551 3:170539111-170539133 CAGATTATGTAGGGCCCTGGAGG - Intronic
965676768 3:171205786-171205808 CAGATCATTCAGGGCTTTGCAGG - Intronic
965690112 3:171346851-171346873 CAGATCATCCTGGGCCTTGTAGG + Intronic
966115405 3:176454725-176454747 CAGATCATGTAGAGCCTCAAAGG - Intergenic
966160495 3:176962491-176962513 CAGGTCATGCAGGACCTTGCAGG + Intergenic
966351312 3:179035135-179035157 CAGATCGTGTAGGGCCTTATAGG - Intronic
966351319 3:179035182-179035204 CAGAACATGTAGGGCCTTATAGG - Intronic
966351327 3:179035229-179035251 CAGATCATGTAGGGCCTTATAGG - Intronic
966809023 3:183827117-183827139 CAGACCATGGAGGGTCTTGGTGG + Intergenic
967399369 3:189043457-189043479 CATATCATGCAGGCCCTTTATGG + Intronic
967702578 3:192610704-192610726 CAGATCTTGCAGGGCCTTGCAGG - Intronic
967861639 3:194156330-194156352 CAGTTCACACAGGGCCTTGAAGG + Intergenic
967861645 3:194156363-194156385 CAGTTCACACAGGGCCTTGAAGG + Intergenic
967866413 3:194193680-194193702 CAGGTCATGAAGGACCTAGACGG + Intergenic
968292858 3:197552461-197552483 CAGAACATGGAGGGCCTTGTAGG - Intronic
968329127 3:197849556-197849578 CAAATCAAGCAGGGACTTAAGGG - Intronic
968816676 4:2825039-2825061 CAGAGCAGGCAGGGCAGTGAAGG + Intronic
969298115 4:6281370-6281392 CAGGCCAAGCAGGGCCCTGAGGG + Intronic
969312902 4:6364381-6364403 CAGCTCCTGCAGGGCCTTGGAGG + Intronic
969976531 4:11108185-11108207 CAGGTCATACATGGACTTGAAGG + Intergenic
970015647 4:11509758-11509780 CACTTCATGAAGGGCCTTGTAGG + Intergenic
970275180 4:14391972-14391994 CAGAGCATGCTGGGCCTTGAAGG - Intergenic
970326383 4:14929043-14929065 CAGAGTATGCAGGGCCATAAGGG + Intergenic
970498984 4:16657569-16657591 CAGATAATGTAGGGCCTTGTAGG - Intronic
970926652 4:21460074-21460096 CAGATTTTGCAAGGCCTTGTAGG - Intronic
971130557 4:23804617-23804639 CAGACCATACAGGGCCTTGTAGG - Intronic
971273123 4:25170316-25170338 CAGACCTTGCAGGGCCTTATAGG - Intronic
971379151 4:26081040-26081062 GAGATCATCAAGGGCCCTGAGGG + Intergenic
971470560 4:27021448-27021470 CAGCAAATGCAGGGCCCTGAGGG + Intronic
971947981 4:33306087-33306109 CAGATCACACATGGACTTGAAGG - Intergenic
972028448 4:34418574-34418596 CAGATCATGTAGGGCTGTGTAGG - Intergenic
972154809 4:36146413-36146435 CTGATCATGTAGGGCCTTATCGG - Intronic
972932744 4:44093539-44093561 TAGATCATGTGAGGCCTTGAAGG + Intergenic
973104819 4:46322381-46322403 GAGATCGTGCAGGGCCTTGGAGG - Intronic
973628617 4:52797552-52797574 CAGAGCATGCAGGGCCTCTCAGG + Intergenic
973656030 4:53048718-53048740 CAGATGACCCAGGGCCTGGAGGG - Intronic
973656213 4:53050763-53050785 CAGATGACCCAGGGCCTGGAGGG - Intronic
974003843 4:56536202-56536224 CAGATCAAGTGGGGCCTTGTAGG - Intronic
974010092 4:56598733-56598755 CAGATCATGTAGGGCCTTGTAGG + Intronic
974118816 4:57613115-57613137 CATATTATGCAGGGCTTTGTAGG + Intergenic
974125075 4:57686102-57686124 CAGATAGTGCAGGGCCTTGAAGG - Intergenic
974417191 4:61624051-61624073 CAGATCATGCAAGGTCTTACTGG + Intronic
974422807 4:61699485-61699507 CAGATCTTGTGGGGCCTTGTGGG + Intronic
975204991 4:71635269-71635291 CAGAGCATCCTGGGACTTGAAGG + Intergenic
975621918 4:76305174-76305196 CAGATCCTGTAGGGTCTTAAAGG + Intronic
975854451 4:78608409-78608431 CAGATCATGCAGGACCTTTTTGG + Intronic
976536899 4:86227961-86227983 CACACCATGCAGGGCCATGTGGG + Intronic
976585301 4:86790760-86790782 CAGATAATTCAGGGCCTTCAAGG + Intronic
976604617 4:86970943-86970965 CAGATTGTGGAGGGCCTTGTCGG + Intronic
976683854 4:87788490-87788512 CAGATCATGAAGGGCTTTCTAGG + Intergenic
978103051 4:104866815-104866837 CAGATCATACAGGTCCTTGTAGG - Intergenic
978734877 4:112074414-112074436 TAAATCATGTAAGGCCTTGAAGG - Intergenic
979224359 4:118266807-118266829 CACATCATGTAAGGCCTTGCAGG - Intergenic
979313311 4:119229881-119229903 CAGATCATGGCTGGTCTTGAAGG - Intronic
979412645 4:120397380-120397402 CAGATCATGCAGTGGCTTCTGGG + Intergenic
979864446 4:125736333-125736355 CAGATCATGGAGGTCATTGTAGG + Intergenic
979960134 4:127009064-127009086 CAGGTCATGCATGGCCGTGTTGG + Intergenic
980916245 4:139035749-139035771 CAGATCGGGTAGGGCCTTGCTGG - Intronic
981702296 4:147619934-147619956 CAGATCATGTTGGACCTTGATGG - Intronic
981721695 4:147808417-147808439 CAGATCATGCAGGGTCTTTCAGG + Intronic
981725706 4:147844972-147844994 CAGAGCGTGCCGGGCCTTGTGGG - Intronic
982026988 4:151260799-151260821 TAGAGTATGCAAGGCCTTGAGGG - Intronic
982161155 4:152570807-152570829 CAGATCAAGCATGGCCTTATAGG + Intergenic
984823268 4:183903187-183903209 CAGATCATGCCGGAACTTGCAGG - Intronic
986314409 5:6576652-6576674 CAGGGCATGCTGGCCCTTGAAGG - Intergenic
986351674 5:6885788-6885810 CAAATCACACAGGGCCTTGGGGG + Intergenic
987150211 5:15031204-15031226 CAGACTATGGAGGACCTTGAAGG - Intergenic
987504819 5:18754295-18754317 CAGGTCACACAGGGACTTGAAGG + Intergenic
987783860 5:22472977-22472999 CAGATCAAGTAGGGCCTCAAAGG - Intronic
987960924 5:24807412-24807434 CAGATAATTCAGGGCCTTGAGGG + Intergenic
988815995 5:34835745-34835767 CAGGTCATGGAGGGCCTTATAGG - Intergenic
989100403 5:37817962-37817984 CAGGTCAGGTAGGGCCTTTAGGG - Intronic
989541905 5:42627902-42627924 CAGATCATACAGGGGCTCGAAGG + Intronic
989807195 5:45624110-45624132 CAGATAATGCAGGACCTTATGGG + Intronic
990887189 5:60607940-60607962 CAGATCATGCAGAACTTTGTAGG + Intronic
990911267 5:60854780-60854802 CAGGTCAAGAAGGGCCTTGTAGG - Intergenic
991279807 5:64899787-64899809 GAGAACATGTTGGGCCTTGAAGG - Intronic
991515149 5:67427034-67427056 CAGATCTTGTAGGGCCTTGAAGG - Intergenic
991915045 5:71597297-71597319 CAGATCCTGTATGGCCTTGTGGG + Intronic
991933601 5:71780820-71780842 CAGAGCATGGAGGGCCTGGCAGG - Intergenic
992386754 5:76292079-76292101 CAAATCATCCAGGGCCTTACTGG - Intronic
992969413 5:82040831-82040853 CAGATCATCTAGGGACTTGTTGG - Intronic
993714298 5:91259736-91259758 CAGCTCATGCAGGGCTTTGTAGG - Intergenic
993946214 5:94119901-94119923 CAGATCATGCAGGACTTTATAGG - Intergenic
994407803 5:99367360-99367382 CAAATCATGGAGGGCCTTATAGG - Intergenic
994926555 5:106123145-106123167 CAGTGCATGCAGGGCCTTTAGGG + Intergenic
995095906 5:108235660-108235682 CAGATCATGCGGGGCCTTATAGG - Intronic
995132232 5:108642735-108642757 CAGATCATGCAGAGCCTTCCTGG - Intergenic
995305237 5:110639156-110639178 CAGCACATGCAGAGCCTTGTAGG + Intronic
995313163 5:110736783-110736805 CAGATCTTGCAAAGCCTTGTCGG - Intronic
995449749 5:112287627-112287649 CAGATCATGGAAGGCCTTATAGG - Intronic
995523899 5:113035531-113035553 CAGGTCAAGCAGGGCCTTAGAGG - Intronic
995624190 5:114058718-114058740 CAGATCCTGCAGGGCTTTGCAGG + Intergenic
995640843 5:114255546-114255568 CAGATAAGGCAGGGCCTTGTAGG + Intergenic
996550671 5:124726758-124726780 CAGGTCATGCAGGGCCTTGTAGG - Intronic
996563661 5:124857393-124857415 CAGGTCTTCTAGGGCCTTGAAGG + Intergenic
996843350 5:127872583-127872605 AAGATCAAGCAGGGACTGGATGG - Intergenic
996907614 5:128619533-128619555 CAGATCAGGGAGGGCTTTAAAGG + Intronic
996947379 5:129086553-129086575 TATATCATGTAGAGCCTTGAAGG - Intergenic
997094200 5:130892301-130892323 CACATCATGCAGTGCTTTGCAGG + Intergenic
997448797 5:133965038-133965060 CAGATCATGTAGGATCTTGAAGG - Intronic
997705037 5:135942506-135942528 CAGACCTTGCAGGACCTTGTGGG - Intronic
997739070 5:136237962-136237984 CAGACTACCCAGGGCCTTGAGGG - Intronic
997857195 5:137383008-137383030 CAGACCAGGCAGGGCCCTCAGGG - Intronic
997865954 5:137462992-137463014 CAAATCATTCAGGGGCTTCATGG + Intronic
997898992 5:137746369-137746391 CAGATCATGTAGGGATTTGTAGG - Intergenic
997958890 5:138303413-138303435 CAGATCGTGTAGGGCCTTGTAGG - Intronic
997984462 5:138491938-138491960 CAGATCGTGCATGGCTTTGCTGG + Intergenic
998155507 5:139784573-139784595 CAGATGATGGAGGGCGTTGTAGG - Intergenic
998189916 5:140014873-140014895 CAGATCAAATAGGGCCTTGTGGG - Intronic
998190161 5:140016912-140016934 GAGATCACACAGGGCCTTGGAGG + Intronic
998269876 5:140696990-140697012 CAGAACAAGCAGGCCCTGGAGGG + Exonic
998375336 5:141686936-141686958 CAGGCCATGCAGGCCCTTGGAGG + Intergenic
998449292 5:142221840-142221862 CAGATCACACAGGGCTTTGGAGG + Intergenic
998692627 5:144604021-144604043 CAGATCAAGTAGGACCTTGCAGG + Intergenic
998754534 5:145361706-145361728 CAGATCATGAGGAGCCTTGTGGG - Intergenic
998855390 5:146390079-146390101 CAGTCCACGCAGGGCCTTGTGGG - Intergenic
998885694 5:146691681-146691703 CAGGTCATGAAGGGCCTTTTAGG - Intronic
998895334 5:146792839-146792861 CAGATGATGTAGGGTCTTGCAGG + Intronic
998962950 5:147508547-147508569 CAGAAAATGCAGGGCCTGGCAGG - Intronic
998971375 5:147596152-147596174 TAGACCATGCAGGGCTTTGTTGG + Intronic
999139137 5:149345838-149345860 GAGGTCATGCATGGCCTGGAAGG + Intronic
999216179 5:149937322-149937344 CAGATCCAGCAGGGCTTTGGAGG + Intronic
999411270 5:151351936-151351958 TGGATCATGCAGGACCTTGTGGG - Intergenic
999412721 5:151366441-151366463 CAGCTCATGGAGGGCCTAGAAGG + Intergenic
999549653 5:152672510-152672532 CACATCATGTAAGGCCTTGTAGG - Intergenic
999559162 5:152781166-152781188 CAGATCATGTAGGGCCTTGCAGG - Intergenic
1000348271 5:160332488-160332510 CAGATCACACAGGGCCCTGTAGG - Intronic
1000978985 5:167796312-167796334 TAGATCATGCAGCCCCTTGTAGG - Intronic
1000999136 5:167988703-167988725 CAGATCATGCAGAGAGTTGAAGG + Intronic
1001017359 5:168153624-168153646 CAGATAATGCAGGGCCTTTGAGG + Intronic
1001186808 5:169581941-169581963 CACTTCAAGCAGGGCCTTGAAGG - Intergenic
1001238671 5:170051266-170051288 CAGATCATGGATGGCCTTGCAGG - Intronic
1001264928 5:170267355-170267377 CAGCTCAGGCAGGGCCTCGCAGG - Intronic
1001286042 5:170424828-170424850 CATATCATAAAAGGCCTTGAGGG - Intronic
1001313267 5:170626057-170626079 CAGACCCTGCAGGGCCTTGCAGG + Intronic
1001517127 5:172363771-172363793 CAGATCAGGCAGGGCCTTTGGGG + Intronic
1001948719 5:175801066-175801088 GAGATCATGCAGGCCCTTCTAGG + Intronic
1002123158 5:177021616-177021638 CAGATTGTACAGGGCCTTGTTGG + Intronic
1002441840 5:179268397-179268419 CAGAGCCTGCAGGGCCTGGCAGG - Intronic
1002693402 5:181066630-181066652 CAGGCCAGGGAGGGCCTTGAAGG - Intergenic
1002693698 5:181070283-181070305 CAGGTCAGGGCGGGCCTTGAAGG - Intergenic
1002988741 6:2217799-2217821 CAGTTCATCCAGGGCTTTGGGGG - Intronic
1003236011 6:4295632-4295654 CAGATCCTACAGGGCCTGAAAGG + Intergenic
1003365993 6:5475587-5475609 CCCATGATGCAGAGCCTTGAAGG - Intronic
1003455600 6:6278791-6278813 CAGATCAAGCAGGGCTTTGTAGG + Intronic
1005627861 6:27680369-27680391 CAGATTATCCAGGCCGTTGACGG + Intergenic
1006786613 6:36672039-36672061 CAGATCATTTAGGGACTAGAAGG - Intergenic
1006887044 6:37390512-37390534 CAGATTTTGTAGGGCCTTGTAGG + Intronic
1007219930 6:40270389-40270411 GAGATCAGGCAGGGCCTTGCAGG - Intergenic
1007468091 6:42069180-42069202 CAGATCTTACAGGGTCTTAAAGG + Intronic
1007528078 6:42514341-42514363 CAAATCATGCAGGGGCTTGCAGG + Intergenic
1007683178 6:43648547-43648569 ACAATCATGCAGGGCCTTGTGGG + Intronic
1009296869 6:61961780-61961802 AAAATCATACAGGGCCTTGAAGG + Intronic
1009926525 6:70127252-70127274 CAGGTCATGCAGAGATTTGAAGG + Intronic
1010944649 6:81959822-81959844 CATATCATACATGGCCTTGGAGG - Intergenic
1011772870 6:90694392-90694414 AAGATCATGCAGGACTCTGAAGG + Intergenic
1012188126 6:96247298-96247320 CAGATCATGTAGGACTTTGTAGG + Intergenic
1012397032 6:98810453-98810475 CAGATCATACAGGGCATTGTAGG - Intergenic
1012649393 6:101734676-101734698 CAGATCCTACAGGGCCCTGAAGG + Intronic
1012783456 6:103592231-103592253 CAGATCATGTATGGCCTTGTAGG - Intergenic
1013327526 6:109062417-109062439 CACACCATGGAGGGCCTTGCAGG + Intronic
1013439512 6:110148605-110148627 CAGATTAGGTAGGACCTTGAAGG + Intronic
1013702529 6:112790611-112790633 CAAACCATGAAGGGCCTTGAAGG - Intergenic
1013852101 6:114528451-114528473 CAGGTCATGCAGAGCTTTGTGGG - Intergenic
1014805788 6:125827849-125827871 CAGATCATGCAGGGCCTTCTTGG + Intronic
1015228636 6:130887519-130887541 CAGATCATGCAGGGCCTTGGAGG - Intronic
1015303450 6:131679974-131679996 CCAATCCTGCAGGGCCTTGCAGG + Intronic
1015374277 6:132492084-132492106 CAGGTCAGGTAGGGCCTTGCAGG - Intronic
1015692154 6:135937336-135937358 CAGATCAGGAAGGGCCCTGCAGG - Intronic
1015809094 6:137143292-137143314 CAGATCATACAGCGCCTTGGAGG + Intergenic
1015857557 6:137641265-137641287 CAAATCCTGCAGGGCTTAGATGG - Intergenic
1015911097 6:138168440-138168462 CAGATCATGAAAGTCCTTGTTGG + Intronic
1015940921 6:138451107-138451129 TAGATCATGTAGGGTCTTGGAGG - Intronic
1016329351 6:142940578-142940600 AAGGTAATGCAGGGCCTTGAAGG - Intronic
1017076031 6:150619593-150619615 CAGATGATGAAGGGCATAGAAGG + Intronic
1017321980 6:153105077-153105099 CAGATCACACTGGGCCTTGAGGG + Intronic
1017365169 6:153627497-153627519 CAGATTATGAAGGGTCTTGTAGG + Intergenic
1017397118 6:154014267-154014289 CACATCTTGTAGGGCCTTGTAGG + Intronic
1017714736 6:157201020-157201042 CAGAACAGGCAGGGCCCTGGCGG + Exonic
1018122640 6:160651174-160651196 CAGGTTCTGCAGGGCTTTGAAGG - Intronic
1018684038 6:166289518-166289540 TAGATCATGCAGAGTCTTGTAGG - Intergenic
1018852968 6:167654467-167654489 CAGATCCATCAGGGCCTTGGCGG - Intergenic
1018955545 6:168407940-168407962 CAGGGCGTGCAGGGCCTCGAAGG - Intergenic
1019375364 7:688502-688524 CAGATCACGCAGGGCCTTGCTGG - Intronic
1019856741 7:3616367-3616389 CAGGTTGTGCAGGGCCTTGCAGG - Intronic
1020147224 7:5653940-5653962 CAGACCAGGCAAGGCCTTGAAGG + Intronic
1020524060 7:9235835-9235857 CAGATCATGCAGCAACTTGTTGG + Intergenic
1021248518 7:18294623-18294645 CAGATCGTGCTGGGCCTAGTAGG + Intronic
1021874190 7:25033098-25033120 CAGGTCATGCAGGGCCTGATGGG + Intergenic
1021937575 7:25646410-25646432 CACCTCATGCAGGGCCTTTTGGG - Intergenic
1022144620 7:27524661-27524683 CAGATCATATGGGGCCTTGCAGG - Intergenic
1022146478 7:27547071-27547093 CACATCATGTAGGGCTTTGTAGG - Intronic
1022312573 7:29210948-29210970 CGGATCATGGAGGGCCTCGTAGG + Intronic
1022477005 7:30717577-30717599 AAGGTCATGCAGGGCCCTGTGGG + Intronic
1022481176 7:30744108-30744130 CACATCCTGTGGGGCCTTGAGGG - Intronic
1022491826 7:30826589-30826611 CAGATCATGGAGAGCCTTGCAGG + Intronic
1022606271 7:31817440-31817462 CAGATCATGCAGGGCTTTGGAGG + Intronic
1022656950 7:32328446-32328468 CAGATCATGCAGGGACTTGGAGG - Intergenic
1023066687 7:36384934-36384956 CAGATCATGCATGGCCTTGTAGG + Intronic
1023143833 7:37129517-37129539 CAGATAATGCAGGTCTGTGAAGG - Intronic
1023564529 7:41510475-41510497 TAGCTGATGCAGGGCCTTGAAGG - Intergenic
1024197951 7:47078439-47078461 CAGATCACGAAGGGCCCTGTTGG + Intergenic
1025070009 7:55889628-55889650 AAGATCATAAAGGGCTTTGAGGG - Intronic
1025256714 7:57388837-57388859 CAGACCAGGCAGGGCCTTGCAGG - Intergenic
1026241768 7:68581716-68581738 CAGATCATGTAGGGTCTTGTAGG - Intergenic
1027645335 7:80790488-80790510 CAGATCATGCAGAGGCCTGTAGG - Intronic
1027681605 7:81229646-81229668 CAGATCATGTAGAGCTTTGTAGG + Intergenic
1028250423 7:88533626-88533648 CAGAGCATGCAAGGTCTTGCAGG - Intergenic
1028433811 7:90778595-90778617 CAGATCACGAAGGGCCTTCTGGG - Intronic
1028510578 7:91621008-91621030 CAGAGCATGGAGGGCCTGGGAGG - Intergenic
1028981752 7:96974964-96974986 CAGATCCTGAAGGGCCTTGTAGG - Intergenic
1029360975 7:100088604-100088626 CAGATCAGGCAGGGCCTTGCAGG + Intergenic
1029468342 7:100740185-100740207 CAGATCACATAGAGCCTTGAAGG + Intronic
1030487526 7:110189091-110189113 CAGATCATGCAGGACTTTGTAGG + Intergenic
1030729664 7:112971644-112971666 TAGACCATGCAGAGCCTTGTAGG + Intergenic
1030871211 7:114758430-114758452 CAAATTTTGCAGGGCCTTGTGGG - Intergenic
1031026599 7:116686193-116686215 CAGAGCATGTAAGGCCTTGTAGG - Intronic
1031417965 7:121516084-121516106 CAGATCTTGTAGGATCTTGAAGG - Intergenic
1031560477 7:123232172-123232194 CAGATTATCCAGGACCTTGTAGG - Intergenic
1031584522 7:123518464-123518486 TAGATCATTTAGGACCTTGAAGG - Intronic
1032159197 7:129497787-129497809 CAGTTTGTGCTGGGCCTTGAAGG + Intergenic
1033133732 7:138767767-138767789 CAGATCATGGAGGACCCTGGGGG - Intronic
1033733603 7:144201182-144201204 CAAATCATGAAAGGCCTTGTAGG + Intergenic
1033749447 7:144349790-144349812 CAAATCATGAAAGGCCTTGTAGG - Intergenic
1034100652 7:148447116-148447138 CAGACCCTGCAGATCCTTGATGG - Intergenic
1034550661 7:151818640-151818662 CAGATCTTGCAGGACAGTGAGGG - Intronic
1035160216 7:156944614-156944636 CAGATCCTGCAGCTCCTGGACGG + Intergenic
1036094810 8:5711874-5711896 AGGATCATGCAGTCCCTTGAGGG - Intergenic
1036227659 8:6973418-6973440 CAGATCATGCCGGTTCATGAAGG - Intergenic
1036230113 8:6992577-6992599 CAGATCATGCTGGTTCATGAAGG - Intergenic
1036232565 8:7011680-7011702 CAGATCATGCTGGTTCATGAAGG - Intronic
1036505280 8:9349238-9349260 CAGATCATGCAGGGTCTTATCGG - Intergenic
1036987682 8:13554893-13554915 CCAATCATGTAGGGCCTTGCAGG - Intergenic
1037316464 8:17604047-17604069 CAGACCATGGAGGGCCTTGTTGG + Intronic
1037462960 8:19131548-19131570 CAGGTCAGGCAGGGCCTTGTTGG + Intergenic
1037561203 8:20076080-20076102 CAGATACTGCAGGGTCTTGTAGG - Intergenic
1037754840 8:21704024-21704046 CTTGTCATGCAGGGCCTTGCAGG - Intronic
1038464031 8:27743407-27743429 CAGTCCATGCAGGCCCTTGCTGG - Intronic
1038821129 8:30952738-30952760 CAGAGCATGCAGGGCCATGAAGG + Intergenic
1038892017 8:31736104-31736126 CAGATGATAAAGGGCATTGAAGG - Intronic
1038893251 8:31751522-31751544 TAGATCAGGCAGTGCTTTGATGG + Intronic
1039174614 8:34789611-34789633 AAGATTATGCACTGCCTTGAAGG + Intergenic
1039605500 8:38877095-38877117 GAGAGCATTCAGGGCCTTGTAGG + Intergenic
1039969222 8:42307325-42307347 CAGATTATGAAGGGCCTTCAGGG + Intronic
1041031614 8:53742093-53742115 CTGATCGTGTAGGGCCTTGTAGG - Intronic
1042096903 8:65226144-65226166 CAGATCACGCAGGGCCTTGTAGG + Intergenic
1042150798 8:65781368-65781390 CAGATCATGCTGGACCTTTGTGG + Intronic
1042557050 8:70042550-70042572 CAGAGCCTGGAGGGCCTTAAAGG + Intergenic
1042939810 8:74096282-74096304 CAGATCATGCAGAGCCTCATTGG - Intergenic
1043207906 8:77470867-77470889 AAGATCAGGTAGGACCTTGAAGG + Intergenic
1043325125 8:79040735-79040757 CAGATCATGCATTAACTTGAAGG + Intergenic
1043737830 8:83769190-83769212 CAGAGCCTGCAGGGGCTAGAGGG + Intergenic
1043877610 8:85503785-85503807 CAGATCATGTAAGGCCTTGGGGG - Intergenic
1044462363 8:92460279-92460301 CAGATCATGGCCGGCCTTGAGGG - Intergenic
1044934473 8:97279448-97279470 CAGATCATACAGGGCCTTGCAGG - Intergenic
1045025839 8:98085724-98085746 CAGGTCATGGAGGGCCCTGCAGG - Intronic
1045227389 8:100262568-100262590 CAGATCATGTGGGGCCTTTTGGG + Intronic
1045624730 8:104030495-104030517 CAGGTCATGTAGGGCCTTATAGG - Intronic
1045663092 8:104458270-104458292 CAGGTCATGCAGGACCTTATGGG - Intronic
1045697686 8:104828856-104828878 CAGATTGTGTAGGGCCTTGTAGG - Intronic
1045977382 8:108145074-108145096 CAGATCATGCAGGACCCTCTTGG + Intergenic
1046582005 8:116104490-116104512 CAGATCATTCAAGGTCTTGCAGG - Intergenic
1046814417 8:118568383-118568405 CAGATCATGCAGGATCTGGTAGG + Intronic
1047236810 8:123048845-123048867 CACATCATATAGGGCCTGGAAGG - Intronic
1047285027 8:123480345-123480367 CAGATCATGCAGGGTCTTTGTGG + Intergenic
1047971867 8:130091502-130091524 CCGATCATGCAGGGCCCTGTGGG + Intronic
1048012312 8:130467769-130467791 CAGATTATGTAGAGCCTTGCAGG + Intergenic
1048704083 8:137130827-137130849 CAGGTCATGAAGGGCATTGTAGG + Intergenic
1049122628 8:140752963-140752985 CAGACCACACAGGGCCTTCAAGG + Intronic
1049558800 8:143297153-143297175 CATCTCATGCAGGGTTTTGATGG - Exonic
1050046960 9:1556874-1556896 CACATCCTGCAGGGCCTCCAAGG + Intergenic
1051564829 9:18485759-18485781 CAGATCATGCAGGGTGTTGCAGG + Intronic
1052972247 9:34384017-34384039 TGGATCATGGAGGGCCTTGTAGG - Intronic
1052975362 9:34406082-34406104 CAGAGCAGGCAGGGCATTCAGGG + Intronic
1053051920 9:34969126-34969148 CAGACCATGCAGGGCCTCACAGG + Intronic
1053099921 9:35363177-35363199 CAGATCATGGAGAGCCGTGACGG + Intronic
1053752023 9:41266636-41266658 CAGATCCTGCAGCGCCTTCCTGG + Intergenic
1054257544 9:62830966-62830988 CAGATCCTGCAGCGCCTTCCTGG + Intergenic
1054333769 9:63784756-63784778 CAGATCCTGCAGCGCCTTCCTGG - Intergenic
1055134197 9:72808142-72808164 CAGATCATCCAGGGTACTGAAGG - Intronic
1055660122 9:78494872-78494894 CAGATCATGCAAGGCTTTGTGGG + Intergenic
1055697547 9:78903014-78903036 CAGATGATGGAGGGCTGTGAAGG + Intergenic
1056148073 9:83754715-83754737 CTGATCCTGGAGGGCCTTGAAGG + Intronic
1056183363 9:84107308-84107330 CAGTGCATGCAGTGCCATGACGG + Intergenic
1057030270 9:91769763-91769785 CAGATCATGAAGGTACTGGAGGG - Intronic
1057389092 9:94628012-94628034 CTGATCATGCAGGGGCAGGAAGG + Intronic
1057885072 9:98823698-98823720 CAGATCTGGAAGGGCCTTGGAGG + Intronic
1058007659 9:99935958-99935980 CAGATCATGGAGAGCCTTGCAGG + Intronic
1058532821 9:105924057-105924079 CAGATCCTGCAAGGCCTTGTGGG - Intergenic
1058547251 9:106073758-106073780 CAGATCATGGATGATCTTGAGGG - Intergenic
1058934184 9:109752648-109752670 CATATTATGAAGGACCTTGAAGG + Intronic
1059189496 9:112310964-112310986 CATAGCATGCAGGGCCTTAACGG + Intronic
1059348245 9:113646795-113646817 CAGATCACGCAGGGCCTTGAAGG - Intergenic
1059385689 9:113962507-113962529 CAGCTCATGCAGAGCCTTGCAGG - Intronic
1059457743 9:114410438-114410460 CAGAGCAGGCAGGGAGTTGAGGG + Intronic
1059566768 9:115390337-115390359 CAAATCATGAAAGGCCTTGCAGG + Intronic
1059566832 9:115390924-115390946 CAGATTATGGAAGGCCTTGCAGG + Intronic
1059575613 9:115485187-115485209 AGGATCAAGCATGGCCTTGAAGG - Intergenic
1059592187 9:115673675-115673697 CAGATCATGCATGGCTTTGTAGG - Intergenic
1059917027 9:119115332-119115354 CAGATCATGAAGAACCTTCATGG - Intergenic
1060185304 9:121560466-121560488 CAGATTTTGCAGGGCCTGGCAGG + Intergenic
1060437191 9:123604106-123604128 CAGCCCATCCAGGGCCTTGGAGG - Intronic
1060463655 9:123882931-123882953 CAGATCATGTAGGACTTTGTAGG - Intronic
1060846667 9:126842771-126842793 CAGATCTGGAAGGGCCTTGGAGG - Intergenic
1061138508 9:128750581-128750603 CAGAGCATGCGGGGCCGTGGCGG + Intronic
1061342689 9:129995836-129995858 TAGATCACCCAAGGCCTTGAAGG + Intronic
1061666780 9:132164675-132164697 CAGAGCCTGCCTGGCCTTGAAGG - Intronic
1186524786 X:10238394-10238416 CAGATGCTTCAGGGTCTTGAAGG + Intergenic
1186722695 X:12322577-12322599 CAGGTCATTCAGGGCCTTGTAGG + Intronic
1187202257 X:17146181-17146203 CAGATCGTACAGGGCCTTGTGGG - Intronic
1187248494 X:17575270-17575292 CAGGTCATGCAGGGCCTTGCAGG - Intronic
1187366025 X:18666506-18666528 CAGTTCCTGCAGGGCCTCGTGGG + Intronic
1188179356 X:27034816-27034838 TTGATCACGCAGGGCTTTGAAGG + Intergenic
1188232150 X:27677663-27677685 CAGGTCATGCAGGACCTTGCAGG + Intronic
1188458027 X:30389444-30389466 AAGATCATGCAAGGCCTTGCAGG + Intergenic
1188661365 X:32762743-32762765 CAGATCACACAGGGTCTTGCTGG + Intronic
1188696858 X:33204245-33204267 CCAATCATTCAGAGCCTTGAAGG - Intronic
1188799176 X:34505914-34505936 CAGACCATGCATGGCCTTATAGG - Intergenic
1189019155 X:37316672-37316694 CAGATCAAGGAGGGCTTTGCAGG - Intergenic
1189105991 X:38235819-38235841 CAGATCAAACAGGGCCTTTTTGG - Intronic
1189406834 X:40732931-40732953 CACATCATGTAAGGCCTTAAAGG + Intronic
1189537986 X:41956206-41956228 CAGATCATGTAGGGCCTTGTAGG - Intergenic
1189550437 X:42087184-42087206 CAGCCCTTGCAGGGCCTTTAAGG - Intergenic
1190019938 X:46864893-46864915 GAGATAATGAAGGGCCTTGTAGG + Intronic
1190311757 X:49122017-49122039 TAGACCAGGCAGGGCCTTGTAGG - Intronic
1190522466 X:51294303-51294325 CAGATGTTGTAGGGCCTTGTAGG + Intergenic
1191024947 X:55904208-55904230 TAGATCATACAAGGCCTTGTAGG + Intergenic
1192143245 X:68662469-68662491 CAGATCACGAAGGGCCTTATAGG - Intronic
1192273832 X:69610180-69610202 CAGATCATGTAGGGCCTTGTAGG + Intergenic
1192280119 X:69676116-69676138 CAGATCATGTAGGGCTTTGTAGG + Intronic
1192340777 X:70261663-70261685 CAGATCATGAAGGTCCTTGGAGG + Intergenic
1192498048 X:71629373-71629395 CAGATCATGGAAGGCCTTAATGG - Intergenic
1192555211 X:72083863-72083885 CAGATCGTGCAGGGCCTTCTAGG - Intergenic
1192596001 X:72408850-72408872 CAGATCATGTAGGGTGTTGTAGG + Intronic
1193624707 X:83803842-83803864 TAGATCATGTAGGGCCTTGTAGG + Intergenic
1193882173 X:86936667-86936689 CAGCACATGCAGGGCCCAGAGGG - Intergenic
1194349887 X:92813117-92813139 CAGATCATGCAGGGTTTTACAGG + Intergenic
1194713699 X:97265761-97265783 CAAATCATGTAGGTCCTTGTTGG + Intronic
1194790684 X:98145735-98145757 CAGATCCTGCATGGACTTGTAGG - Intergenic
1195251443 X:103051918-103051940 CAGATCTTACAGGGCCTGAAGGG + Intergenic
1195408582 X:104544271-104544293 CAGATCATAAAGGACCTTGTGGG - Intergenic
1195476259 X:105289262-105289284 CAGATCATGTAGGGCTATGCAGG + Intronic
1195677004 X:107514234-107514256 GAGATCACGCAGGGCCTTATGGG + Intergenic
1195700832 X:107704426-107704448 CAGATCACGCAGGCACTTGTAGG + Intergenic
1195879571 X:109578320-109578342 CACATTACGCAGGGCCTTGTAGG - Intergenic
1195898587 X:109773607-109773629 CAGATCACACAGGGCCTTGTAGG + Intergenic
1196003794 X:110813914-110813936 CAGATCATGTAGGGCTTTGAAGG + Intergenic
1196004040 X:110816648-110816670 CAGATCATGCTAGGCCTTGCAGG + Intergenic
1196017824 X:110958228-110958250 GAGACCATGCAGAACCTTGAAGG + Intronic
1196764657 X:119231952-119231974 CAGATCCTGTAGGGCCTTGTAGG + Intergenic
1196799930 X:119533300-119533322 CAGGCCATGTAGGGCCTTGCAGG - Intergenic
1196848785 X:119917956-119917978 CAGATCACACAGGGCCTTGTAGG - Intronic
1196873468 X:120135565-120135587 CACACCATGCAGGGGCTGGAAGG - Intergenic
1196930134 X:120673835-120673857 CATACCATGCAAGGCCTTGGAGG + Intergenic
1197098869 X:122627768-122627790 AAGATTATGTAAGGCCTTGAAGG - Intergenic
1197173684 X:123462333-123462355 CAGATCTTGTAGGGCCCTGTAGG - Intronic
1197374840 X:125670052-125670074 AAGATCATGCAAGGTATTGAAGG - Intergenic
1197415909 X:126172532-126172554 CATATCATGCTGGGCCTGGTAGG - Intergenic
1197712919 X:129684952-129684974 CAGATCAGGCAGGGCCTTCTAGG + Intergenic
1197741707 X:129900057-129900079 CAGATCATGTAGGGCCTTGTAGG - Intergenic
1197865516 X:131012553-131012575 CAGATCATGTAGGGCTGTGGAGG + Intergenic
1197881749 X:131173841-131173863 CAGATCATGTAGGGCCTTTTAGG + Intergenic
1198163009 X:134026129-134026151 CAGATCTTATAGGGCCTTGTAGG + Intergenic
1198320441 X:135514398-135514420 CAGATCATGCAGGGCCTAGTTGG - Intergenic
1198321885 X:135526341-135526363 CAGATCATGAACGGCCATGGAGG - Intronic
1198380840 X:136081973-136081995 CAGATCATGTAAGGCCTTGTAGG - Intergenic
1198411346 X:136372561-136372583 CAGACCCTGCAGGGCCTCGTAGG - Intronic
1198448235 X:136739922-136739944 CAGATCCTGGAGGACCTTGGAGG + Intronic
1198710430 X:139495661-139495683 CAGATCATGGAGGTCCTTGTAGG - Intergenic
1198778558 X:140208263-140208285 CAGATCAGGTAGGGGCTTGTGGG + Intergenic
1198789394 X:140327128-140327150 CAGATCATGAAGGGCCTCGTGGG + Intergenic
1198791548 X:140352344-140352366 CAGATCACACAGGGCCTTGTAGG + Intergenic
1198802002 X:140457672-140457694 CAGGTCATGCAGGGCCCTGCAGG - Intergenic
1198832835 X:140769276-140769298 CAGATCATGGAGGGCCTCATAGG + Intergenic
1199319321 X:146419809-146419831 CAGCTCATTCAGGGCCTGGTAGG + Intergenic
1199339047 X:146654450-146654472 CAGATTATGTTGGGCCTTGTAGG + Intergenic
1199429832 X:147746265-147746287 CAGGTCATGGAGGGCCCTGCTGG - Intergenic
1199509187 X:148601024-148601046 CAGATACTGTAGGGCCTGGAAGG + Intronic
1200052635 X:153443066-153443088 CAGAGCATGGAGGGCTTTGGTGG - Intergenic
1200057111 X:153467435-153467457 CACAGCATGCAAGGCCCTGAGGG + Intronic
1200118902 X:153781280-153781302 CAGATGCTGCAGGGCCTTCTGGG + Exonic
1200658206 Y:5929745-5929767 CAGATCATGCAGGGTTTTACAGG + Intergenic
1200757379 Y:7002540-7002562 CAGACCCTGCAGTGCCTTGTAGG + Intronic
1201503152 Y:14667949-14667971 CAGATCATTCAGGTCCCTGTTGG + Intronic