ID: 932763711

View in Genome Browser
Species Human (GRCh38)
Location 2:74457429-74457451
Sequence GCTGCTGAAGCGCGAGGAGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 2, 2: 1, 3: 25, 4: 244}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932763700_932763711 21 Left 932763700 2:74457385-74457407 CCTGTAGCTGAGGGCTGCCCACC 0: 1
1: 0
2: 1
3: 7
4: 168
Right 932763711 2:74457429-74457451 GCTGCTGAAGCGCGAGGAGCGGG 0: 1
1: 2
2: 1
3: 25
4: 244
932763707_932763711 -7 Left 932763707 2:74457413-74457435 CCCTCACAGAGGAGATGCTGCTG 0: 1
1: 0
2: 3
3: 33
4: 297
Right 932763711 2:74457429-74457451 GCTGCTGAAGCGCGAGGAGCGGG 0: 1
1: 2
2: 1
3: 25
4: 244
932763703_932763711 3 Left 932763703 2:74457403-74457425 CCACCTCCCGCCCTCACAGAGGA 0: 1
1: 0
2: 2
3: 27
4: 337
Right 932763711 2:74457429-74457451 GCTGCTGAAGCGCGAGGAGCGGG 0: 1
1: 2
2: 1
3: 25
4: 244
932763699_932763711 27 Left 932763699 2:74457379-74457401 CCGCTGCCTGTAGCTGAGGGCTG 0: 1
1: 0
2: 4
3: 28
4: 258
Right 932763711 2:74457429-74457451 GCTGCTGAAGCGCGAGGAGCGGG 0: 1
1: 2
2: 1
3: 25
4: 244
932763706_932763711 -4 Left 932763706 2:74457410-74457432 CCGCCCTCACAGAGGAGATGCTG 0: 1
1: 0
2: 3
3: 31
4: 323
Right 932763711 2:74457429-74457451 GCTGCTGAAGCGCGAGGAGCGGG 0: 1
1: 2
2: 1
3: 25
4: 244
932763708_932763711 -8 Left 932763708 2:74457414-74457436 CCTCACAGAGGAGATGCTGCTGA 0: 1
1: 0
2: 2
3: 39
4: 300
Right 932763711 2:74457429-74457451 GCTGCTGAAGCGCGAGGAGCGGG 0: 1
1: 2
2: 1
3: 25
4: 244
932763705_932763711 -3 Left 932763705 2:74457409-74457431 CCCGCCCTCACAGAGGAGATGCT 0: 1
1: 0
2: 1
3: 25
4: 251
Right 932763711 2:74457429-74457451 GCTGCTGAAGCGCGAGGAGCGGG 0: 1
1: 2
2: 1
3: 25
4: 244
932763704_932763711 0 Left 932763704 2:74457406-74457428 CCTCCCGCCCTCACAGAGGAGAT 0: 1
1: 0
2: 0
3: 9
4: 143
Right 932763711 2:74457429-74457451 GCTGCTGAAGCGCGAGGAGCGGG 0: 1
1: 2
2: 1
3: 25
4: 244
932763701_932763711 4 Left 932763701 2:74457402-74457424 CCCACCTCCCGCCCTCACAGAGG 0: 1
1: 0
2: 3
3: 53
4: 369
Right 932763711 2:74457429-74457451 GCTGCTGAAGCGCGAGGAGCGGG 0: 1
1: 2
2: 1
3: 25
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932763711 Original CRISPR GCTGCTGAAGCGCGAGGAGC GGG Exonic
900364776 1:2306642-2306664 GCTGCGGGAGCGCGAGGCCCGGG + Exonic
900647861 1:3717188-3717210 GCTGCCGGGGAGCGAGGAGCGGG + Intronic
900669430 1:3841571-3841593 GCTGCTGAATCAACAGGAGCTGG - Intronic
901387969 1:8923635-8923657 GCTGAAGTAGCGCGAGAAGCAGG - Intergenic
901646006 1:10717068-10717090 GCTGCTGGAGGGACAGGAGCAGG + Intronic
902410063 1:16207139-16207161 GCGGCAGCAGCGCGAGGAGGAGG - Exonic
905183108 1:36178546-36178568 GCAGCGGGAGCGCGAGGAGCAGG + Exonic
905960699 1:42040258-42040280 GCTGCTGGAGTGCCAGGAGGAGG + Intergenic
906946135 1:50295903-50295925 GCTGCTCAGGCACGAGTAGCTGG + Intergenic
908574948 1:65449575-65449597 GCTGCTGCAGCTGAAGGAGCTGG + Intronic
914950736 1:152111185-152111207 GCGGCTGAAGCGCGAGCATGAGG - Exonic
914950739 1:152111224-152111246 GCGGCTGAAGCGCGAGGAGGAGG - Exonic
914950749 1:152111299-152111321 GCTGCTGAAGAGCGAGGAGCAGG - Exonic
914950755 1:152111341-152111363 GCGGCTGAAGCGCGAGGAGCCGG - Exonic
914950761 1:152111395-152111417 GCGACTGAAGCGCGAGGAGGTGG - Exonic
914950772 1:152111500-152111522 GCGGCTGAAGCGCGAGCAGGAGG - Exonic
914950788 1:152111644-152111666 GCGGCTGAAGCGCCAGGAGGAGG - Exonic
914950807 1:152111773-152111795 GCAGCTGAAGCGCGACCAGGAGG - Exonic
914950817 1:152111860-152111882 GCGGCTGAAGCGCGAGCAGGAGG - Exonic
914950824 1:152111926-152111948 GCAGCTGAGGCGCGAGCAGGAGG - Exonic
914950837 1:152112109-152112131 GCAGCTGAGGCGCGAGCAGGAGG - Exonic
914950842 1:152112148-152112170 GCAGCTGAGGCGCGAGCAGGAGG - Exonic
914950846 1:152112184-152112206 GCAGCTGAGGCGCGAGCAGGAGG - Exonic
915129974 1:153689200-153689222 GCAGCTGAAGCGTGGGGAGACGG + Exonic
915536710 1:156540806-156540828 GCTGCTGAAGCTCCAGGAAGAGG - Exonic
915950741 1:160188452-160188474 GCTACTGAAACCTGAGGAGCTGG - Intergenic
915980864 1:160419202-160419224 ACTGCTGTGGCGGGAGGAGCTGG + Exonic
916717441 1:167457125-167457147 CCTGCTTTAGCGCTAGGAGCTGG + Intronic
921850936 1:219931295-219931317 GCTGAGGAAGCTGGAGGAGCTGG + Intronic
922346275 1:224699364-224699386 GCTGCCGAAGGGCCAGGAGAAGG - Intronic
924482110 1:244445141-244445163 GCTGCTGAAATTCCAGGAGCAGG + Intronic
1064129381 10:12695423-12695445 AGTGCTGAAGCTCAAGGAGCTGG - Intronic
1065140370 10:22714083-22714105 GCTGCTGCGGGGCGGGGAGCCGG - Intronic
1071888686 10:89978761-89978783 GCTGCAGAAGCGAGAGGAGGAGG + Intergenic
1072042966 10:91627107-91627129 GCAGCTGATGAGGGAGGAGCTGG - Intergenic
1073100788 10:101005622-101005644 GCTGCAGGAGCGCGAACAGCTGG + Exonic
1073175556 10:101554544-101554566 GCTGCTTAAGAGAGAGGATCAGG + Exonic
1073403570 10:103277703-103277725 CCTGCTGGAGCGCGACGGGCTGG + Exonic
1075032135 10:119030416-119030438 GCTGCTGAAGCCCGAGCTGCAGG + Exonic
1077324836 11:1959231-1959253 GCTGCAGAGGAGCGCGGAGCAGG + Intronic
1077807525 11:5604557-5604579 GAAGCTGAAGAACGAGGAGCAGG + Exonic
1078057131 11:8018176-8018198 GAGGCTGGAGCGCGAGGAGGGGG - Intergenic
1078144308 11:8712640-8712662 GCTGCTGGAGTGGCAGGAGCGGG - Exonic
1080403147 11:31955531-31955553 GCTGCTGAAGTGTGAGCAGGAGG + Intronic
1082997911 11:59267503-59267525 GCTGCTGAAGACCTAGGAACAGG - Intergenic
1083890125 11:65591833-65591855 GCTGCTGAGCCGCGAGCTGCGGG + Exonic
1084377112 11:68784900-68784922 GCTGCTGAAGCCCCGGGAGATGG - Exonic
1084563240 11:69915695-69915717 ACTGCTGAAGCGGCAGGGGCTGG - Intergenic
1084652035 11:70495141-70495163 CCTGCTGCAGCCGGAGGAGCTGG - Intronic
1091316465 11:134617490-134617512 GCAGCTGAAGCTGGAGCAGCTGG - Intergenic
1202807816 11_KI270721v1_random:14408-14430 GCTGCAGAGGAGCGCGGAGCAGG + Intergenic
1091450783 12:570786-570808 TCTGCTGATCCTCGAGGAGCAGG + Intronic
1093547790 12:20368861-20368883 GCCGCTGACGCTGGAGGAGCCGG - Intergenic
1094437064 12:30432300-30432322 GCTGCTGCAGAGCAAGTAGCTGG + Intergenic
1096114893 12:49050107-49050129 GCTCCTGGACCCCGAGGAGCTGG - Exonic
1096495495 12:52037264-52037286 GCTGCAGGAGCGCGAGGAGGAGG + Intronic
1096983714 12:55743349-55743371 GCAGCTCCAGGGCGAGGAGCAGG - Exonic
1098898017 12:76084630-76084652 GCAGCAGCAGCGGGAGGAGCAGG + Exonic
1100442411 12:94629031-94629053 GCTGCAGAAGAGGGAGGAACAGG - Intronic
1102527121 12:113520073-113520095 GCTGGAGAGGCGCGAGGGGCAGG + Intergenic
1104857909 12:131910442-131910464 GCTGCAGCAGAGCAAGGAGCCGG - Intronic
1104880464 12:132067399-132067421 GCTGCTGAAGCTGAAGCAGCAGG + Exonic
1104927393 12:132320942-132320964 GCAGCTGAGGAGGGAGGAGCTGG + Intronic
1107910489 13:45101017-45101039 GCTGCTGGCATGCGAGGAGCTGG + Intergenic
1110436404 13:75481900-75481922 GCTGCTGAAGCGCGGAGTTCGGG - Exonic
1113817103 13:113180008-113180030 GCTGCTGCTGCACGAGGCGCTGG - Exonic
1114530746 14:23394211-23394233 GCTGCTGAAGAGCGCAGAGACGG - Exonic
1114537085 14:23429796-23429818 GCTGAAGCAGCGGGAGGAGCAGG - Exonic
1118849343 14:69572476-69572498 GCGGCGGGAGCGCGAGGAGCGGG - Exonic
1119188576 14:72663033-72663055 GCTGCTGAAGTTCAAGGCGCTGG - Intronic
1119456872 14:74763623-74763645 GCTCATGAAGCCCGAGGAGGAGG - Exonic
1119776652 14:77253295-77253317 CCTGCTGCAGCCCGAGGAGGAGG + Exonic
1122221122 14:100239559-100239581 GGTGCAGACGCGCGAGGAGGTGG + Exonic
1123099354 14:105785780-105785802 GCTGCTGCAGGCCGAGAAGCAGG - Intergenic
1123681694 15:22768557-22768579 GATGCGGAAGCAGGAGGAGCAGG - Intergenic
1123681792 15:22769058-22769080 GATGCGGAAGCAGGAGGAGCAGG - Intergenic
1123681909 15:22769688-22769710 GATGCAGAAGCAGGAGGAGCAGG - Intergenic
1123681966 15:22770021-22770043 GGTGCAGAAGCAGGAGGAGCAGG - Intergenic
1123899531 15:24862781-24862803 GATGCTGAAGAGTGAGGGGCAGG + Intronic
1125724826 15:41862825-41862847 GCTGCGGAAACACGAGGAGCTGG - Exonic
1127793935 15:62422645-62422667 GCTGCTGGAGTGCCAGGAGATGG - Intronic
1128614948 15:69101621-69101643 ACTGCTGATGCGTGAGGGGCTGG + Intergenic
1129282172 15:74494365-74494387 GATGCTGAGGCGGGAGGATCAGG - Intergenic
1129322218 15:74781834-74781856 GCTGCAGAAGCGCTGGGGGCCGG - Intergenic
1129440650 15:75578850-75578872 GCTGCTGAGGCGCGGGGACGCGG - Exonic
1129476319 15:75786534-75786556 GCTGCTGGAGCTGCAGGAGCTGG + Intergenic
1131195625 15:90352452-90352474 GCTGCTGAGGGGCGTGGAGGGGG + Intronic
1132581408 16:686354-686376 GCTGCTGTAGGGCGGGGACCGGG - Intronic
1132583129 16:694358-694380 GCTGCAGGAGCTGGAGGAGCTGG - Exonic
1132702819 16:1229299-1229321 CCTGCTGGAGCTGGAGGAGCCGG - Exonic
1132705507 16:1241569-1241591 CCTGCTGGAGCTGGAGGAGCCGG + Exonic
1133035192 16:3030463-3030485 GCTGCTGAGGCGGGAGCGGCGGG - Exonic
1133805882 16:9125783-9125805 GCTGCTGAAGCCTGGGCAGCCGG + Intergenic
1136349324 16:29696872-29696894 GCAGCTGGGGCGCGGGGAGCCGG - Intronic
1138459200 16:57138079-57138101 GGCGCTGGAGCGTGAGGAGCAGG - Intronic
1140927699 16:79599584-79599606 GCAGCTGAACCCCGAGGCGCTGG - Exonic
1141470774 16:84236969-84236991 GCTGAGGAAGCTGGAGGAGCTGG - Exonic
1142027676 16:87823332-87823354 GCTGCACAAGCGCGAGAAACAGG + Intergenic
1142440303 16:90093979-90094001 GCAGCAGAAGCGCGAGAAGGAGG - Intergenic
1144579547 17:16450685-16450707 GCGGGTGAAGCAGGAGGAGCTGG + Intronic
1145094044 17:20009460-20009482 GCGGCTGAGGCGCAAAGAGCCGG - Intronic
1147768905 17:42854548-42854570 GCTGCTGGAGATGGAGGAGCAGG + Exonic
1148085559 17:44991815-44991837 GCTTCTGAAGCAGGTGGAGCTGG - Intergenic
1148105951 17:45118959-45118981 GCTGCTGAAGCGGCCGGAGCTGG - Exonic
1148860204 17:50600655-50600677 TCTGCTGAGGAGCCAGGAGCCGG + Intronic
1149517793 17:57293444-57293466 GCTGTTGCAGCGTGAGGAGGAGG - Intronic
1152465486 17:80464033-80464055 GCTCCTTCAGCTCGAGGAGCTGG - Intergenic
1152749152 17:82054603-82054625 GCTGCTGAAGCTGGAGAAGCTGG + Exonic
1152957252 18:49579-49601 GCAGCAGAAGCGCGAGAAGGAGG + Exonic
1153089108 18:1323789-1323811 GCTGCTGAAACTTGAGGACCAGG + Intergenic
1153805595 18:8706253-8706275 GTGGCTGATGCGCGAGCAGCGGG - Intronic
1156460104 18:37316806-37316828 GTGGCTGAAGTGAGAGGAGCAGG - Intronic
1156468467 18:37362590-37362612 GCTGCTGCAGCCTGGGGAGCAGG + Intronic
1156482529 18:37445228-37445250 GCTGCAGAAGCGGGAGCAGAGGG + Intronic
1157752883 18:50194530-50194552 GCTGCGGAACCTCTAGGAGCCGG + Intronic
1158446615 18:57527684-57527706 GCTCCAGAAGCGCAAGGATCAGG + Intergenic
1160408003 18:78656052-78656074 GCTGCTGAAGTGCGTCGTGCTGG - Intergenic
1160583194 18:79899249-79899271 GCTCCTGGAGCGCGCGGGGCTGG + Exonic
1160818333 19:1046540-1046562 CCTGCTGCAGCGGGAGGAGCAGG + Intronic
1160972053 19:1773877-1773899 GCTGCTGGAGCAGGAAGAGCAGG + Intronic
1161316578 19:3620191-3620213 GATGCTGCAGCGCGAGAAGGAGG - Exonic
1162364133 19:10237799-10237821 GCTGCTGGATTGAGAGGAGCCGG - Intergenic
1162475884 19:10899131-10899153 GCTGCTAAAGCCCGCGGAGCCGG - Intronic
1162517214 19:11155668-11155690 GCTGCTGGGGCGCCACGAGCAGG - Exonic
1162523093 19:11193464-11193486 GCTGCGGCAGCTGGAGGAGCAGG - Exonic
1162757042 19:12866740-12866762 CTTGCTGAAGCGCGGAGAGCAGG - Exonic
1164722772 19:30444408-30444430 GTTCAAGAAGCGCGAGGAGCTGG + Exonic
1166839565 19:45688502-45688524 GCTGCAGAAGCGAGAGGAGGAGG - Exonic
927419227 2:22912611-22912633 GCAGCTGGAGCGCCAGAAGCAGG + Intergenic
927484050 2:23476966-23476988 GCTACTGAAGGGACAGGAGCTGG + Intronic
929256131 2:39813486-39813508 ACTGCTGAAGCTTGAGGAGGTGG - Intergenic
931670157 2:64640452-64640474 GCTTCTGAGGAGCTAGGAGCTGG - Intronic
932143190 2:69297368-69297390 GCTGCTGCAGACAGAGGAGCCGG - Intergenic
932763711 2:74457429-74457451 GCTGCTGAAGCGCGAGGAGCGGG + Exonic
932774092 2:74516655-74516677 GGTGCTGGAGCGCGAGAGGCTGG + Exonic
933284778 2:80374136-80374158 GATGCTGAAGTTCGAGGTGCAGG + Intronic
933526319 2:83444851-83444873 GCTGCTGAAGCTGAGGGAGCAGG - Intergenic
934120849 2:88838201-88838223 GCTGATGAAGCAGGAGGAACAGG - Intergenic
934730073 2:96650798-96650820 CCAGCTGCTGCGCGAGGAGCAGG - Intergenic
939612931 2:144332287-144332309 GCGGCTGCGGCGCGGGGAGCCGG - Intronic
940593999 2:155766888-155766910 GTTGCTGAAGCTCGAGTAGGTGG - Intergenic
941443788 2:165574236-165574258 ACTGCAGAAGCGAGAGGAGGGGG + Intronic
942681339 2:178480567-178480589 GCTGCGGAAGCGCGAGCAGGAGG + Exonic
945150520 2:206785540-206785562 GCTGCTGAAGCATGAGGTACAGG + Intronic
946459589 2:219857120-219857142 GCTGCTGAGGAGGGAGGACCTGG - Intergenic
948318730 2:237051964-237051986 CCTGCTGCAGCGCAATGAGCTGG - Intergenic
948350977 2:237340671-237340693 GATGCTGACGGGCGAGGTGCCGG - Exonic
948456408 2:238106525-238106547 GCTGCTCCAGCAGGAGGAGCTGG - Intronic
1169589470 20:7124230-7124252 GCTGCTTATGAGAGAGGAGCTGG + Intergenic
1170817376 20:19725501-19725523 GATGCTGAAAAGTGAGGAGCTGG + Intergenic
1171227393 20:23452939-23452961 GCTGATGAAGGGGGAGGAGGAGG - Intergenic
1171235507 20:23521087-23521109 GGTTCTGAAGAGCCAGGAGCAGG + Intergenic
1172775202 20:37403172-37403194 GATGGTGAACCGCGAGGTGCTGG + Exonic
1172871402 20:38137705-38137727 GCTGCTGAGGCATGAGGGGCTGG + Intronic
1172896343 20:38302930-38302952 GCTGCTGCAGAGGGAGGGGCAGG + Intronic
1173519998 20:43692262-43692284 GCTGCTGGAGCTCGAGGACAAGG + Exonic
1173848138 20:46200937-46200959 GCTGCGCAGGCGGGAGGAGCCGG - Intronic
1175429175 20:58890534-58890556 GCTGCAGAAGCGCACGGAGCAGG + Intronic
1175913197 20:62414261-62414283 GCTGCTGCTGGGCCAGGAGCAGG + Exonic
1177011047 21:15730333-15730355 CCGGCGGAGGCGCGAGGAGCCGG + Exonic
1179219135 21:39390709-39390731 GCTGCAGAAGGACGCGGAGCAGG + Exonic
1180096390 21:45557189-45557211 GCTGCTGAAGCCCTGGCAGCAGG + Intergenic
1180222749 21:46369851-46369873 GGTGCTGATGCTCCAGGAGCAGG - Intronic
1180837233 22:18936014-18936036 GCTGCTGGCGCGCCACGAGCAGG - Exonic
1181064729 22:20300011-20300033 GCTGCTGGCGCGCCACGAGCAGG + Intergenic
1181572114 22:23773241-23773263 GCGGCTGGAGCGCGAGAGGCAGG - Intronic
1181813688 22:25421086-25421108 GCTGCTGGGGCGCGCAGAGCGGG + Intergenic
1182548310 22:31088033-31088055 GGAGCTGGAGCGCGAGGAGGAGG + Exonic
1183784534 22:40021808-40021830 GCTGCTGAAGCGCCTGGCGGGGG - Exonic
1184669534 22:46005533-46005555 GCAGGTGAAGCCCGAGGAGGTGG + Intergenic
1184729405 22:46364599-46364621 GGAGCTGCACCGCGAGGAGCAGG - Exonic
1203287326 22_KI270734v1_random:161313-161335 GCTGCTGGCGCGCCACGAGCAGG - Intergenic
949895485 3:8764994-8765016 CCTGCTGAAGCCCAAGGGGCAGG - Intronic
951576338 3:24118134-24118156 GCAGCTGAAGTGAGAAGAGCAGG + Exonic
952312497 3:32202780-32202802 GCTGCTGGAGGGAGAGCAGCTGG - Intergenic
954034356 3:47842944-47842966 GCTGCTGCATAGCCAGGAGCAGG - Intronic
954151713 3:48661187-48661209 GCAGCTGCAGCGCGCGCAGCTGG + Exonic
955927649 3:64023474-64023496 GCAGCGGAAGCGGGAGGAGTCGG + Intronic
956179163 3:66501240-66501262 GCCGGTGAAGCGGGAGGGGCGGG - Intronic
957350747 3:79019393-79019415 GCCGCTGATCCGGGAGGAGCTGG - Intronic
961539737 3:127591207-127591229 GCGGCTGGAGCGCGTGGCGCCGG - Intronic
962456849 3:135572778-135572800 GCTGCTGGAGAGCGAGGACAGGG - Intergenic
963406357 3:144868539-144868561 GGTGCTGAAGCACTAGGAACAGG + Intergenic
968666063 4:1822990-1823012 GCTGCAGAAGCGCTCGGAGGTGG - Exonic
968764098 4:2459135-2459157 GCTGCTGCAGCGCAGGGCGCAGG + Exonic
970332803 4:15002925-15002947 TCTGCTGATGCGCCAGGAACGGG - Exonic
977795348 4:101158237-101158259 GCTGGTGATGCACCAGGAGCAGG - Intronic
978112214 4:104976935-104976957 GCTGCAGAAGCTCGAGGAGTGGG - Intergenic
981751871 4:148100096-148100118 AATGATGAAGCACGAGGAGCTGG + Intronic
985566343 5:620236-620258 GCTGCTGGAGCTTGGGGAGCAGG - Exonic
985688590 5:1294857-1294879 GCTGGTGCAGCGCGGGGACCCGG - Exonic
986392605 5:7300217-7300239 GGTGCGGAAGCGGGAGGAGCAGG - Intergenic
986392610 5:7300238-7300260 GATGCGGAAGCGGGAGGAGCAGG - Intergenic
986392638 5:7300427-7300449 GATGCAGAAGCAGGAGGAGCAGG - Intergenic
986392679 5:7300679-7300701 GGTGCGGAAGCAGGAGGAGCAGG - Intergenic
986392683 5:7300700-7300722 GGTGCGGAAGCAGGAGGAGCAGG - Intergenic
986392687 5:7300721-7300743 GGTGCGGAAGCAGGAGGAGCAGG - Intergenic
986392691 5:7300742-7300764 GGTGCGGAAGCAGGAGGAGCAGG - Intergenic
986392695 5:7300763-7300785 GGTGCGGAAGCAGGAGGAGCAGG - Intergenic
986392699 5:7300784-7300806 GGTGCGGAAGCAGGAGGAGCAGG - Intergenic
986392703 5:7300805-7300827 GGTGCGGAAGCAGGAGGAGCAGG - Intergenic
986392707 5:7300826-7300848 GGTGCGGAAGCAGGAGGAGCAGG - Intergenic
986392711 5:7300847-7300869 GGTGCGGAAGCAGGAGGAGCAGG - Intergenic
986392715 5:7300868-7300890 GGTGCGGAAGCAGGAGGAGCAGG - Intergenic
986392719 5:7300889-7300911 GGTGCGGAAGCAGGAGGAGCAGG - Intergenic
986392723 5:7300910-7300932 GGTGCGGAAGCAGGAGGAGCAGG - Intergenic
986392727 5:7300931-7300953 GGTGCGGAAGCAGGAGGAGCAGG - Intergenic
986392731 5:7300952-7300974 GGTGCGGAAGCAGGAGGAGCAGG - Intergenic
986392735 5:7300973-7300995 GGTGCGGAAGCAGGAGGAGCAGG - Intergenic
986684339 5:10262680-10262702 GCTGCGGAACAGCGAGGTGCTGG + Intronic
988065590 5:26226536-26226558 GCTGTAGAACCGAGAGGAGCTGG - Intergenic
992892494 5:81216746-81216768 GCTTTTGATGCGGGAGGAGCTGG - Intronic
995650388 5:114362289-114362311 GCTGCTGGTGCGCGAGGTGCGGG - Exonic
997583993 5:135034118-135034140 GCTGCTGAGGCCCGAGCGGCAGG - Exonic
997882730 5:137604777-137604799 GCTGCTGGAGAGTGCGGAGCTGG - Intergenic
998137328 5:139681033-139681055 GATGCTGAAGCGCGTGGTGCAGG + Exonic
998285608 5:140857608-140857630 GCCGCTGGACCACGAGGAGCTGG + Exonic
1002123358 5:177022810-177022832 GTTGCTGGAGGGCCAGGAGCCGG + Exonic
1002338246 5:178495187-178495209 GCTGCTGATGGGCGGGGTGCAGG - Intronic
1003243881 6:4368094-4368116 GCTGCTGAAGTGAGAGGGGTGGG + Intergenic
1004911100 6:20285040-20285062 ACTGCAGGAGCGGGAGGAGCAGG + Intergenic
1006277104 6:33013819-33013841 CCTGCTGGAGTGGGAGGAGCTGG - Intergenic
1006749319 6:36366689-36366711 GCCGCTGGAGAGCCAGGAGCAGG - Exonic
1006848270 6:37078260-37078282 GCTGCTGCACCTAGAGGAGCTGG - Intergenic
1007553185 6:42745833-42745855 GCTTCTGGAGCGCGCGGAGTCGG - Exonic
1011099711 6:83708438-83708460 GCTGCAGCAGCGCGAGGAGGAGG - Intronic
1011603512 6:89081102-89081124 GCTGCTGGAGCGCGAGGCTGGGG - Exonic
1015544937 6:134352161-134352183 GCAGCTGGAGGGCTAGGAGCTGG - Intergenic
1018029337 6:159829893-159829915 GCTGCTGAAGATGGAGGAACAGG - Intergenic
1020105902 7:5422234-5422256 GCTCCTGCAGCCCGAGGACCTGG + Intronic
1022094551 7:27130562-27130584 GCTGCTGCAGCGGCAGGTGCTGG + Exonic
1022100145 7:27164640-27164662 GCTGCTGCAGCGAGAGGGGGCGG - Intronic
1022113739 7:27246085-27246107 GCCGCTGAAGGGCGAGGCGGCGG - Exonic
1022482483 7:30753007-30753029 GCTGCTGAGCCTGGAGGAGCAGG + Intronic
1022923197 7:35036990-35037012 GCGGCGGAAGCGGGAGGAGAGGG + Intronic
1023520468 7:41045674-41045696 GCTTCTGAGGCTGGAGGAGCAGG - Intergenic
1027232990 7:76282764-76282786 GCGGCTGGAGCTCCAGGAGCGGG - Exonic
1028567094 7:92245808-92245830 GGTGCTGAGGTGCGAGGAGAGGG - Intronic
1029372495 7:100158433-100158455 GCTGCCGCCGCGCGCGGAGCTGG - Exonic
1029406083 7:100374675-100374697 GCTGCTGAGGCCTGAGGAGTGGG - Intronic
1029537012 7:101163034-101163056 GCTGCAGGAGCAGGAGGAGCTGG - Exonic
1030216015 7:107044652-107044674 GCGGCTGGAGCGGGAGGAGCAGG + Exonic
1032442144 7:131950099-131950121 GCGGCTGAAGCGGGAGGCTCAGG - Intergenic
1033050687 7:138001678-138001700 GGTGCTGGAGAGCGGGGAGCAGG - Exonic
1034437745 7:151071221-151071243 GCTCAAGAAGCGAGAGGAGCAGG + Exonic
1035406884 7:158604461-158604483 CCTGCTGAAGGACGAGGGGCCGG - Intergenic
1035455021 7:159002573-159002595 GCCGGAGAAGCGCGTGGAGCAGG + Intergenic
1037486982 8:19356959-19356981 GTTGCCCAAGAGCGAGGAGCTGG - Intronic
1040740697 8:50571156-50571178 GCTGCTGAAACGCTAATAGCTGG - Intronic
1042489114 8:69379007-69379029 GGAGCAGAAGCGGGAGGAGCAGG - Intergenic
1045173651 8:99697274-99697296 GCTGCAGAAGCGCTCGGAGTTGG + Intronic
1046103899 8:109644674-109644696 GCAGCGGCGGCGCGAGGAGCCGG - Exonic
1049651557 8:143772060-143772082 GCTGCTGACGCGCGAGGGCGTGG + Intergenic
1050151327 9:2621957-2621979 GCTGCTGCAGCCCGGGGAGGTGG + Exonic
1056475386 9:86947181-86947203 GCGGCCGCAGCGCGAGCAGCCGG - Exonic
1057605945 9:96497609-96497631 GCTGCTAACGGGAGAGGAGCGGG + Intronic
1057869401 9:98707470-98707492 GGGGCTGGAGCGCGCGGAGCGGG - Intronic
1058356907 9:104094038-104094060 GCTGGCGAAGCGCGAGGACCCGG + Intergenic
1058536293 9:105963734-105963756 TCTGCTGAAGCGGGATGAACAGG - Intergenic
1059071926 9:111146971-111146993 GCTGCTGTACCGGGAGGACCAGG + Intergenic
1059480789 9:114587868-114587890 GCTGCTGCAGGCCGAGAAGCGGG + Exonic
1060267587 9:122121388-122121410 GCTGCTGGAGCCCAAGGGGCTGG - Intergenic
1060566687 9:124599046-124599068 GCTCCTGAAGCACAAGGAGAAGG - Intronic
1061062455 9:128257498-128257520 GCTGCTGGAGCTGCAGGAGCTGG - Exonic
1062192045 9:135253129-135253151 GCTCCTGGAGCTGGAGGAGCAGG + Intergenic
1062415188 9:136445395-136445417 GCTGTTGAAGGGAGAGGACCGGG + Intronic
1062499409 9:136845827-136845849 CCTGCTGGGGCGCGAGGTGCGGG + Exonic
1185621313 X:1452789-1452811 GCTGCACAAGCGCGTGGTGCTGG - Exonic
1188411446 X:29876921-29876943 GCATCTGAGGCGCGTGGAGCAGG - Intronic
1199612652 X:149631431-149631453 GATGCTGCAGCCCGAGGACCCGG - Intronic
1199978312 X:152907174-152907196 GGTGCTGGAGCGTGAGGAGATGG - Intergenic
1200115563 X:153768329-153768351 TCTGCTGAAGCTCGGGCAGCCGG + Exonic
1201867877 Y:18673788-18673810 GCTGCTGGAGGGCGAGGACGCGG - Intergenic