ID: 932763876

View in Genome Browser
Species Human (GRCh38)
Location 2:74458104-74458126
Sequence CAGGTAATCCCGGCTGGAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 86}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932763876_932763881 -5 Left 932763876 2:74458104-74458126 CCTCTTCCAGCCGGGATTACCTG 0: 1
1: 0
2: 0
3: 11
4: 86
Right 932763881 2:74458122-74458144 ACCTGGCGTGCTTCGGCCTTTGG 0: 1
1: 1
2: 1
3: 8
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932763876 Original CRISPR CAGGTAATCCCGGCTGGAAG AGG (reversed) Intronic
902245260 1:15116640-15116662 CAGGTCATCCAGGCTGGATGTGG - Exonic
902602848 1:17551802-17551824 CAGGTCATCCAGGCTGGGACTGG + Intronic
903547603 1:24136470-24136492 CAGGTCATCAGGGCTGGAGGTGG + Intronic
904457064 1:30654131-30654153 CAGGTAAGCGCAGCTGGAAGTGG - Intergenic
905599474 1:39236943-39236965 AAGGAAATCACGGCTGGACGCGG - Intronic
908691632 1:66786490-66786512 GAGGTAATAGAGGCTGGAAGAGG + Intergenic
914834957 1:151199079-151199101 CAGGTAAGCCCGGCAGGGCGTGG + Exonic
919638276 1:200025122-200025144 CTGGTAATCCTGGCTGTCAGCGG - Intergenic
924813728 1:247425036-247425058 CATGTACTACCTGCTGGAAGAGG + Exonic
1062840699 10:669028-669050 CATGTAACCGCGGCTGGAACGGG + Intronic
1069296059 10:66845838-66845860 AAGGAAATCCTGGCTGTAAGCGG + Intronic
1069584529 10:69589270-69589292 CAGGCAATCCCCTCTGGCAGAGG - Intergenic
1069999836 10:72368073-72368095 GAGGTCATCCCGGGAGGAAGGGG + Exonic
1074497989 10:113996699-113996721 CAGGAAATCCAGGTAGGAAGTGG - Intergenic
1075715379 10:124552299-124552321 AAGGTCATCCCAGCTGTAAGTGG + Intronic
1076386616 10:130061856-130061878 CAGGTAATCCCAGCAGGAGGCGG + Intergenic
1076660990 10:132056052-132056074 CAGGCAATGCTGGCTGGAAATGG - Intergenic
1088561895 11:111123614-111123636 CAGGTAATCCAGGTAGGAAGTGG - Intergenic
1096231245 12:49898014-49898036 CTGGTCATCCCAGCTGAAAGTGG + Exonic
1097187075 12:57201770-57201792 CAGGTCATCTGGGCTGCAAGCGG - Exonic
1100227386 12:92573038-92573060 CAGGAAATCAGGCCTGGAAGAGG + Intergenic
1102759777 12:115375223-115375245 CAGGGAATCCCAGCTGCACGTGG + Intergenic
1103174927 12:118854737-118854759 CAGAGAATCCAGGCTGGATGTGG + Intergenic
1104879549 12:132061022-132061044 AAGGTGTTCCCAGCTGGAAGTGG + Intronic
1105395785 13:20032897-20032919 CATGTAATCCAGGCTGGGTGCGG - Intronic
1105597624 13:21854195-21854217 CAGAAGATCCAGGCTGGAAGAGG - Intergenic
1105826389 13:24127121-24127143 CAGTCAATCCTGGCAGGAAGGGG + Intronic
1105917288 13:24928269-24928291 CAGGTGATCCGGGCTAGAAAGGG + Intergenic
1113751088 13:112776885-112776907 CAGGTCATCTCGGCTGGTCGCGG - Intronic
1114715105 14:24816541-24816563 CAGGTCATCTCGGGGGGAAGAGG - Intronic
1117197380 14:53354013-53354035 AAGGTAGTTCCGGCTGGTAGTGG + Intergenic
1121279785 14:92690184-92690206 CAGGTAATGGCAGCTGGAATGGG + Intergenic
1121426050 14:93852905-93852927 CAGGAAAACCAGGCTGAAAGAGG + Intergenic
1122141618 14:99666420-99666442 CAGCAGATCACGGCTGGAAGGGG + Intronic
1128542634 15:68546464-68546486 CAGGTAGTCTGGGCTGGAGGTGG - Intergenic
1130578636 15:85115651-85115673 CAGTTAATCCTGGCCGGGAGCGG + Intronic
1133647112 16:7774878-7774900 CAGGAATTCCAGGATGGAAGTGG - Intergenic
1136030595 16:27499937-27499959 CTGGTTTTTCCGGCTGGAAGGGG - Intronic
1136285591 16:29238693-29238715 CAGGTATTCCAGGTTGGAACTGG - Intergenic
1139500279 16:67357827-67357849 CCAGTAATCCCAGCTGGATGAGG - Intronic
1140378536 16:74465210-74465232 CAGGGAATACCTGCTGGAGGAGG + Intronic
1142090924 16:88208869-88208891 CAGGTATTCCAGGTTGGAACTGG - Intergenic
1148440742 17:47710539-47710561 CAGGGAAACCCAGCTGGCAGAGG - Exonic
1152648790 17:81482451-81482473 CAGGTAATCAGTGCTGGGAGGGG - Intergenic
1155207741 18:23575794-23575816 AAAGTCATCCTGGCTGGAAGTGG + Intronic
1157466845 18:47954654-47954676 CTGGTAATCCCGGGAGGCAGAGG - Intergenic
1157818989 18:50751710-50751732 CACGTGGTCCAGGCTGGAAGGGG + Intergenic
1160027775 18:75232648-75232670 CAGGTAAACCCTGAAGGAAGTGG + Intronic
1161350215 19:3786948-3786970 GAGGAAATCCCGGCTGGAAAAGG - Intronic
1161352791 19:3803305-3803327 CAGATAATCCCTGCTAGAAGGGG + Intergenic
1161367512 19:3888977-3888999 CAGAGAATCACGGCTGGGAGCGG + Intronic
1161715826 19:5875752-5875774 CAGGTCATCCCTTCTGGAAATGG - Intronic
1162063456 19:8110818-8110840 GAGGTCATCTGGGCTGGAAGGGG - Intronic
1164029659 19:21391472-21391494 TAAGTAAACCCGGCTGGGAGCGG - Intergenic
1165993088 19:39826979-39827001 CTGGTAATCCTGGCAGGGAGGGG + Exonic
1166059847 19:40319504-40319526 CTGGTAATACCAGCTGGAAAGGG - Intergenic
929046767 2:37798166-37798188 CAGATAATGCCGACTTGAAGAGG + Intergenic
929771647 2:44897397-44897419 CAGGTAATCCTGGGTGAAAAGGG + Intergenic
932763876 2:74458104-74458126 CAGGTAATCCCGGCTGGAAGAGG - Intronic
934123784 2:88866483-88866505 CTGATAATCCTGGCTCGAAGGGG + Intergenic
937337886 2:121072883-121072905 CAGGAACTCCAGGCTGGCAGGGG - Intergenic
940982117 2:160015462-160015484 CTGGTAATGCTGGCTGGAAAAGG + Intronic
942739961 2:179165094-179165116 CAGGCAAACCCGGCTTTAAGGGG - Intronic
945040907 2:205743266-205743288 GAGGTATTCCTGGGTGGAAGAGG - Exonic
948868211 2:240785838-240785860 CAGGAAGTCCCGGGTGGCAGAGG + Intronic
1170622343 20:18006539-18006561 CCTGTAATCCCGGCTGGTTGGGG - Intronic
1172121483 20:32601539-32601561 CAGGTACTTCCGGCTGGAAAAGG - Exonic
1174495391 20:50937967-50937989 AAGGTAATGCTGGCTGGATGTGG - Intronic
1175366989 20:58462327-58462349 CAGGTTGTCCAGCCTGGAAGTGG + Intronic
1177016012 21:15788181-15788203 CAGGTATTACCAGCTGGTAGAGG - Intronic
1179906037 21:44423862-44423884 CAGCCATTCCCAGCTGGAAGAGG + Intronic
1180867440 22:19127474-19127496 CAGGTAAGCCCGGGTGGGAGGGG + Intergenic
1181790391 22:25261042-25261064 CAAGTAATCCGGGCGGGGAGGGG - Intergenic
1183046789 22:35226857-35226879 CAGCTAGTCCCAGCTGGATGGGG + Intergenic
962712537 3:138100081-138100103 CAGGTAATCCCCCCAGGATGGGG + Intronic
963660762 3:148126050-148126072 CCGGTAATCCCAGCTGGCTGAGG - Intergenic
966730964 3:183151208-183151230 CAGCTAATCCCAGCTGCAAGGGG + Intronic
972786124 4:42328174-42328196 CAGGTAACGCAGCCTGGAAGAGG + Intergenic
973918203 4:55657739-55657761 CAGGTACCCGCAGCTGGAAGTGG + Intergenic
982712175 4:158768862-158768884 CACGTAACCCCGGCGGGAGGCGG - Intergenic
992181334 5:74201077-74201099 CAGGTAATCCCTGATGGAAAGGG - Intergenic
992864081 5:80940326-80940348 CAGGTAATTCCAGCTGCAAGGGG - Intergenic
995445559 5:112239037-112239059 CAGGTAATCCAGCTAGGAAGCGG - Intronic
995542196 5:113196318-113196340 CAGGTGAGCCCTGATGGAAGTGG + Intronic
996270604 5:121600047-121600069 TAGGTAATAGAGGCTGGAAGTGG - Intergenic
1002323296 5:178388513-178388535 CAGGGGATCCCAGCTGGGAGAGG + Intronic
1006516506 6:34548519-34548541 CAGATAATCAGAGCTGGAAGGGG + Intronic
1026892481 7:73990390-73990412 CAGGTTATTCTGGCTGGAGGGGG - Intergenic
1039555801 8:38474037-38474059 CAGAGAATCCAGGGTGGAAGTGG - Intergenic
1043669584 8:82865362-82865384 CCTGTAAACCCAGCTGGAAGTGG + Intergenic
1052789243 9:32859105-32859127 TAGGTAATCCTGGCTGGGTGTGG - Intergenic
1055607338 9:77984448-77984470 CAGGTACTTCAGGCTGGATGTGG - Intronic
1059374121 9:113869043-113869065 CAGGAAAACACGGCTGGAAAGGG + Intergenic
1060971071 9:127738479-127738501 CAGGGAACCCCAGCAGGAAGGGG + Exonic
1188240583 X:27784076-27784098 CAGGTAATTCCAGAAGGAAGAGG - Intergenic
1195367053 X:104136537-104136559 CATGGACTCCTGGCTGGAAGAGG + Intronic
1197414996 X:126164743-126164765 CATGGAGTCCAGGCTGGAAGAGG + Exonic
1197770105 X:130084256-130084278 GAGCTAATGCTGGCTGGAAGTGG + Intronic