ID: 932766320

View in Genome Browser
Species Human (GRCh38)
Location 2:74472749-74472771
Sequence CCTGCTAAGCAGCCGGCGGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 124}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932766320_932766325 -2 Left 932766320 2:74472749-74472771 CCGGCCGCCGGCTGCTTAGCAGG 0: 1
1: 0
2: 1
3: 9
4: 124
Right 932766325 2:74472770-74472792 GGCCTGCGAACCGCAGCTCTGGG 0: 1
1: 0
2: 0
3: 8
4: 157
932766320_932766331 22 Left 932766320 2:74472749-74472771 CCGGCCGCCGGCTGCTTAGCAGG 0: 1
1: 0
2: 1
3: 9
4: 124
Right 932766331 2:74472794-74472816 TTCCTAGCCCAGGCGGAGGAAGG 0: 1
1: 0
2: 1
3: 12
4: 141
932766320_932766330 18 Left 932766320 2:74472749-74472771 CCGGCCGCCGGCTGCTTAGCAGG 0: 1
1: 0
2: 1
3: 9
4: 124
Right 932766330 2:74472790-74472812 GGGCTTCCTAGCCCAGGCGGAGG 0: 1
1: 0
2: 1
3: 13
4: 161
932766320_932766329 15 Left 932766320 2:74472749-74472771 CCGGCCGCCGGCTGCTTAGCAGG 0: 1
1: 0
2: 1
3: 9
4: 124
Right 932766329 2:74472787-74472809 TCTGGGCTTCCTAGCCCAGGCGG 0: 1
1: 0
2: 2
3: 15
4: 192
932766320_932766333 26 Left 932766320 2:74472749-74472771 CCGGCCGCCGGCTGCTTAGCAGG 0: 1
1: 0
2: 1
3: 9
4: 124
Right 932766333 2:74472798-74472820 TAGCCCAGGCGGAGGAAGGCAGG 0: 1
1: 0
2: 0
3: 21
4: 245
932766320_932766324 -3 Left 932766320 2:74472749-74472771 CCGGCCGCCGGCTGCTTAGCAGG 0: 1
1: 0
2: 1
3: 9
4: 124
Right 932766324 2:74472769-74472791 AGGCCTGCGAACCGCAGCTCTGG 0: 1
1: 0
2: 1
3: 7
4: 115
932766320_932766328 12 Left 932766320 2:74472749-74472771 CCGGCCGCCGGCTGCTTAGCAGG 0: 1
1: 0
2: 1
3: 9
4: 124
Right 932766328 2:74472784-74472806 AGCTCTGGGCTTCCTAGCCCAGG 0: 1
1: 0
2: 0
3: 24
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932766320 Original CRISPR CCTGCTAAGCAGCCGGCGGC CGG (reversed) Exonic
900894741 1:5475214-5475236 ACTGCCAAGCAGCCGGCCACTGG - Intergenic
900924115 1:5692347-5692369 TCTGCTATGCTGCCGGCTGCTGG - Intergenic
901242595 1:7704136-7704158 TCTGCAATGCAGCCGGCGGGAGG - Intronic
902478632 1:16700562-16700584 CCTGCTGTGCACCTGGCGGCGGG + Intergenic
905861346 1:41354039-41354061 ACTGCAAAGCAGCCTGGGGCCGG + Intergenic
907853440 1:58278707-58278729 CCTGATCAGCAGCAGGCGGGGGG + Intronic
912533012 1:110339875-110339897 CCTCCTCAGCTCCCGGCGGCGGG + Exonic
912549053 1:110472753-110472775 CCTCCTGGGCAGCCGCCGGCGGG - Intergenic
916012011 1:160714675-160714697 CCTGCTGAGCTGCAGGTGGCAGG - Intergenic
918093865 1:181318596-181318618 CCTGCTGAGCCGCCCGCGCCCGG - Intergenic
920632845 1:207669475-207669497 CCTGTTGGGCAGCCGGCGCCCGG + Intronic
1065081742 10:22136223-22136245 CCTCCTAAGCAGCTGGGGGAAGG + Intergenic
1066195400 10:33094377-33094399 CATGCTAAGCAGGCCGCAGCTGG + Intergenic
1066422509 10:35275873-35275895 CCTGCTAAACCGGCGGTGGCTGG - Intronic
1067812589 10:49441615-49441637 CCTGCGGAGACGCCGGCGGCTGG - Intergenic
1076773062 10:132677591-132677613 CCTGTAAAACAGCCTGCGGCAGG - Intronic
1077216347 11:1396731-1396753 CCTGCTGGGCAGCCGGCACCAGG + Intronic
1077579381 11:3407163-3407185 CCTGCTCAGGAGCCGGCTCCTGG + Intergenic
1084236414 11:67790706-67790728 CCTGCTCAGGAGCCGGCTCCTGG + Intergenic
1084557593 11:69884068-69884090 CTTGCTAAGTGGCCGGAGGCCGG + Intergenic
1084836001 11:71802287-71802309 CCTGCTCAGGAGCCGGCTCCTGG - Intergenic
1086438921 11:86808445-86808467 CCTGCTAAGCAGCTGCCAGGGGG + Exonic
1088495797 11:110430228-110430250 CCTGCTGAGGAACCGGGGGCCGG + Exonic
1091240012 11:134046071-134046093 CCTGCTCAGGAGCCTGGGGCAGG - Intergenic
1091240024 11:134046116-134046138 CCTGCTCAGGAGCCTGGGGCAGG - Intergenic
1091240036 11:134046161-134046183 CCTGCTCAGGAGCCTGGGGCAGG - Intergenic
1095465523 12:42484142-42484164 CCTGGAAAGCGGGCGGCGGCGGG - Intronic
1096245640 12:49984019-49984041 TCTGCTAAGCTGCCGACTGCAGG + Intronic
1102101190 12:110280645-110280667 CGTGCGAAGGAGCTGGCGGCAGG + Intergenic
1104365248 12:128170824-128170846 CCTGCACAGCAGCCTGCTGCAGG + Intergenic
1105804628 13:23945967-23945989 CCTGCTCAGGAGCCGGTGGTTGG - Intergenic
1105947193 13:25200351-25200373 CCTGCTCAGGAGCCTGAGGCAGG - Intergenic
1106579424 13:31004856-31004878 CCTGCTCAGGAGGCGGAGGCAGG - Intergenic
1108685425 13:52815333-52815355 GCTGCCCAGGAGCCGGCGGCGGG + Intergenic
1114063650 14:19041235-19041257 CCTGCCATGCAGCCAGAGGCTGG + Intergenic
1114098607 14:19358761-19358783 CCTGCCATGCAGCCAGAGGCTGG - Intergenic
1121251229 14:92500787-92500809 CCTGCCCAGCAGCCGCCAGCAGG + Exonic
1122506320 14:102234085-102234107 ACTGTTAAGCGGCCGGTGGCAGG + Intronic
1123492894 15:20796949-20796971 CCTGCCATGCAGCCTGAGGCTGG - Intergenic
1123549395 15:21366047-21366069 CCTGCCATGCAGCCTGAGGCTGG - Intergenic
1124407610 15:29405665-29405687 CCTGCTGAGCAGCCAAAGGCAGG - Intronic
1124631011 15:31337170-31337192 CATGCTAAGTGGCCTGCGGCAGG + Intronic
1124839654 15:33229768-33229790 CCTGCTAAGGAGGCTGAGGCAGG + Intergenic
1126009562 15:44289296-44289318 CCGCCTCAGCAGCCGGCTGCAGG + Exonic
1127287717 15:57545607-57545629 TCAGCTCAGCAACCGGCGGCTGG + Exonic
1127352922 15:58170776-58170798 CCTCCTAAGCATCCTGAGGCTGG - Intronic
1128220979 15:65968401-65968423 CCTGCTAAGCAGGAGGGAGCAGG - Intronic
1130153595 15:81331182-81331204 CCTTTTAAGCAGTCGGTGGCCGG + Intergenic
1131534290 15:93221690-93221712 CCTTTTAAGCAGTCGGTGGCTGG + Intergenic
1131540891 15:93274379-93274401 CCTGCTAACCAGCTGGGGGAGGG + Intergenic
1202957726 15_KI270727v1_random:93265-93287 CCTGCCATGCAGCCTGAGGCTGG - Intergenic
1133347994 16:5083223-5083245 CCTGCTCAGGAGCCGGCCCCTGG + Intronic
1141608706 16:85169660-85169682 CAGGTGAAGCAGCCGGCGGCGGG + Intergenic
1142125154 16:88406488-88406510 TCTGCTGAGCTGCAGGCGGCAGG - Intergenic
1142367647 16:89658396-89658418 CCAGCGAAGCTGCCGGCGGCGGG - Exonic
1149849255 17:60025790-60025812 CCTGCTGAGCCGCCCCCGGCGGG + Intergenic
1149860913 17:60120734-60120756 CCTGCTGAGCCGCCCCCGGCGGG - Intergenic
1150292600 17:63990405-63990427 CCAGCTAAACAGCTGGGGGCGGG - Intergenic
1151559575 17:74863070-74863092 CCTGCTCAGCAGCCGAGGTCTGG - Exonic
1152342776 17:79734338-79734360 CCTGCTCACCAGCCGGTGGAAGG - Intronic
1152356814 17:79811528-79811550 CCTGCTGGGCAGCCTGCGCCTGG + Intergenic
1152697260 17:81803582-81803604 CCTGCAGAGCAGACGGGGGCTGG - Intergenic
1153821934 18:8839463-8839485 CCTGCCAAGCAGCATGCGGCTGG - Intergenic
1154450435 18:14471482-14471504 CCTGCCATGCAGCCTGAGGCTGG - Intergenic
1159370820 18:67525586-67525608 CCTGCTTTGCAGCCAGCTGCAGG - Intergenic
1160507400 18:79434783-79434805 CCAACGCAGCAGCCGGCGGCAGG + Intronic
1160904845 19:1447174-1447196 CCGGCCACCCAGCCGGCGGCGGG + Intronic
1162750195 19:12824947-12824969 CCTGCTCAGCAGGCTGAGGCAGG - Intronic
1162788642 19:13051821-13051843 CCTGCTAAGGCGGCAGCGGCGGG - Intronic
1163834594 19:19565417-19565439 GCTGCCATGCAGCAGGCGGCAGG + Intronic
1168636811 19:58002956-58002978 CCTGCGTCGAAGCCGGCGGCAGG + Exonic
1202712651 1_KI270714v1_random:26393-26415 CCTGCTGTGCACCTGGCGGCGGG + Intergenic
929787174 2:45001331-45001353 CCTGCTCACCAGCCGGCCGCCGG + Intergenic
932766320 2:74472749-74472771 CCTGCTAAGCAGCCGGCGGCCGG - Exonic
933947613 2:87300204-87300226 CCTGACAAGCAGCTGGCTGCAGG + Intergenic
936332583 2:111561373-111561395 CCTGACAAGCAGCTGGCTGCAGG - Intergenic
938480978 2:131661258-131661280 CCTGCCATGCAGCCCGAGGCTGG + Intergenic
948046946 2:234952167-234952189 CCAGGTAGGCAGGCGGCGGCGGG + Intronic
1169379827 20:5096703-5096725 CCTGCTAGGCAGCTGGTGGAAGG + Intronic
1172379493 20:34476345-34476367 CCTGCTGAGGAGCCGGGGACCGG - Intronic
1175324233 20:58111365-58111387 CCTGCTTTGAAGCCGGGGGCTGG - Intergenic
1176454474 21:6897350-6897372 GCTGCTCAGCAGCCGGAGCCGGG + Intergenic
1176832647 21:13762398-13762420 GCTGCTCAGCAGCCGGAGCCGGG + Intergenic
1180482145 22:15763869-15763891 CCTGCCATGCAGCCAGAGGCTGG + Intergenic
1183103383 22:35597888-35597910 CCTGCTAAGCACCTGCAGGCTGG - Intergenic
1183578607 22:38708570-38708592 CCTGTTAAGCAGCAGGAGGCAGG + Intronic
1183858376 22:40652043-40652065 CCTGCCAAGCAGCCAGCGGCCGG - Intergenic
1184066403 22:42124167-42124189 CCTGCTGAGCAGGAGGTGGCAGG + Intergenic
1184068871 22:42136319-42136341 CCTGCTGAGCAGGAGGTGGCAGG + Intergenic
1184276607 22:43412337-43412359 CCTGCCTAGCGGGCGGCGGCGGG + Intronic
1184678525 22:46056325-46056347 CCAGGTAGGCAGCAGGCGGCAGG - Intronic
1184892984 22:47390741-47390763 CCTGCTGAGCAGCAGGTGGAGGG - Intergenic
1185279754 22:49964983-49965005 CCTGATAAACAGCCCGGGGCAGG + Intergenic
949961598 3:9316841-9316863 CCTGCTAAGCATCTGAAGGCGGG + Intronic
950493381 3:13319520-13319542 TCTGCTCAGCAGCCTGCGCCAGG - Intronic
951640411 3:24829518-24829540 CCTGCTAGGCAGCCGGTCCCTGG - Intergenic
955239150 3:57164700-57164722 CCTGCTAAGGCCCGGGCGGCCGG - Intronic
961214888 3:125151599-125151621 TCTGCTAAGCAGCCGGAAGCAGG - Intronic
961792192 3:129384254-129384276 CCTGCAAGGCAGCCAGAGGCTGG + Intergenic
961885983 3:130096717-130096739 CCTGCTCAGGAGCCGGCCCCTGG + Intronic
968995168 4:3940861-3940883 CCTGCTCAGGAGCCGGCTCCTGG + Intergenic
969758819 4:9167931-9167953 CCTGCTCAGGAGCCGGCTCCTGG - Intergenic
969818796 4:9705401-9705423 CCTGCTCAGGAGCCGGCCCCTGG - Intergenic
971512767 4:27447550-27447572 GCTGCTAAGCAGGCTGAGGCAGG + Intergenic
994255377 5:97587249-97587271 CCTGCTAAGAAGGAGGCGGAAGG + Intergenic
998143394 5:139712106-139712128 CCTGCCAAGCTGCCTGCCGCAGG + Intergenic
999166254 5:149551629-149551651 CCTGCTGAGCCGCCGCCGACCGG - Intergenic
1001948244 5:175797546-175797568 CCTGCACAGAAGCCCGCGGCTGG + Intronic
1002045136 5:176537229-176537251 TCTGCGCGGCAGCCGGCGGCTGG + Exonic
1004154809 6:13158169-13158191 TCTGCTAAGCAGCCGGGCGCGGG - Intronic
1005912781 6:30326008-30326030 CCTGCTAAGCTTCCAGCAGCAGG + Intergenic
1008370241 6:50723289-50723311 CCTGCCAAGCAGCCTGCTGCCGG - Intronic
1011636156 6:89375673-89375695 CCTGTTAACCAGCAGGAGGCAGG - Intronic
1018856475 6:167678775-167678797 CCTGGAAAGCGGCCGGGGGCGGG - Intergenic
1019365067 7:628921-628943 CCTGCTCTGCAGCCCACGGCGGG + Intronic
1019670612 7:2276172-2276194 CCTGCCAGGGAGCCAGCGGCTGG - Intronic
1020746884 7:12090355-12090377 CCTGCTATGCAGCTGCCGGAAGG + Intergenic
1022156017 7:27662700-27662722 GCTGCAAAGCTGCCGGCTGCCGG + Exonic
1024580074 7:50793702-50793724 CCCGCTCAGCAGCCCGGGGCAGG - Intergenic
1025090561 7:56059798-56059820 CCTGCTCAGAAGCCTGAGGCGGG - Intronic
1025993526 7:66513486-66513508 CCTGCTCAGCACCCAGGGGCAGG + Intergenic
1035268845 7:157708068-157708090 CTTGCAGAGCAGCCAGCGGCTGG - Intronic
1036847689 8:12181033-12181055 CCTGCTCAGCAGCCGGCTCCTGG + Intergenic
1036869057 8:12423348-12423370 CCTGCTCAGCAGCCGGCTCCTGG + Intergenic
1037502187 8:19496913-19496935 CATGCTGTGCAGCCGGCGGGAGG + Intronic
1037502768 8:19501136-19501158 CCTGCTAAGGAGGCTGAGGCAGG + Intronic
1041511601 8:58659672-58659694 CCTCCTCGGCAGGCGGCGGCGGG - Intronic
1047484840 8:125320062-125320084 CCTGCTCAGGAGGCTGCGGCAGG + Intronic
1049443407 8:142619326-142619348 CCCGCTCAGCAGCCTGGGGCAGG - Intergenic
1061949119 9:133926373-133926395 CCTGCTGGGCTGCCGGGGGCTGG - Intronic
1062629599 9:137457945-137457967 CCTGCTATGAAACCGGCAGCGGG - Intronic
1203442510 Un_GL000219v1:22588-22610 ACTGCGGAGCTGCCGGCGGCAGG + Intergenic
1203513318 Un_KI270741v1:141497-141519 ACTGCGGAGCTGCCGGCGGCAGG + Intergenic
1192118608 X:68433989-68434011 CCTGCGCAGGAGCCTGCGGCAGG - Intergenic
1195275394 X:103276124-103276146 CCTGCAAGGCAGCGGGAGGCGGG - Intronic