ID: 932766650

View in Genome Browser
Species Human (GRCh38)
Location 2:74474789-74474811
Sequence CTCCTGACAAGCACCTGGTA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 146}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932766643_932766650 20 Left 932766643 2:74474746-74474768 CCAGGCTATTGAGGCAGCTGCTG 0: 1
1: 0
2: 3
3: 23
4: 244
Right 932766650 2:74474789-74474811 CTCCTGACAAGCACCTGGTAAGG 0: 1
1: 0
2: 1
3: 19
4: 146
932766641_932766650 29 Left 932766641 2:74474737-74474759 CCAAGCTCTCCAGGCTATTGAGG 0: 1
1: 0
2: 0
3: 11
4: 237
Right 932766650 2:74474789-74474811 CTCCTGACAAGCACCTGGTAAGG 0: 1
1: 0
2: 1
3: 19
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932766650 Original CRISPR CTCCTGACAAGCACCTGGTA AGG Exonic
901865687 1:12105271-12105293 CTCCAGAGAAGGACCTGGTTGGG - Intronic
902984887 1:20149258-20149280 CTCCTGGCCTGCACCTGGAATGG + Exonic
904155598 1:28480371-28480393 CTCTTGACTAGCTCCAGGTAAGG + Intronic
907809874 1:57858592-57858614 CCCCTAACAAGCACCTGGCCTGG - Intronic
909434803 1:75628781-75628803 CTCCAAACAAGCACTTTGTAGGG + Intergenic
914875315 1:151509308-151509330 CTCCTTACAAACACTTGGTGGGG + Intergenic
919786724 1:201262659-201262681 CTCCTGCTAAGGGCCTGGTAGGG + Intergenic
920497147 1:206463236-206463258 CTCCTGCCTAGCACTTGGAAAGG - Exonic
920765622 1:208830824-208830846 CTTAGGACAAGCAGCTGGTATGG - Intergenic
921539317 1:216394171-216394193 ATCCTGGCCAGCACTTGGTATGG - Intronic
921971834 1:221158090-221158112 CTGCTGAAAAGCACCAGGCATGG + Intergenic
922929865 1:229380821-229380843 CTCCTGCCTAGCCCCTGGTAGGG - Intergenic
924883875 1:248190880-248190902 TTCCAGACAAGCAACTGTTAAGG + Intergenic
1066752520 10:38672981-38673003 CTGCTGACAAGCACCTACTTGGG + Intergenic
1067203011 10:44190715-44190737 ATCCTCACCAGCACTTGGTATGG - Intergenic
1067689939 10:48495340-48495362 GTCCTCACAACCACCTGATATGG + Intronic
1068272636 10:54748680-54748702 ATCCTAACCAGGACCTGGTAAGG + Intronic
1069770281 10:70894085-70894107 CTCCTCATCAGCACATGGTAGGG - Intergenic
1070716771 10:78728191-78728213 CTCCTCACAAGCACTTTGCAAGG - Intergenic
1076862225 10:133143460-133143482 CTCCTGACAAACAGCTGGTGTGG + Intergenic
1077437435 11:2549648-2549670 CTCCTCCCAAGCACCTGGGGTGG + Intronic
1078273875 11:9823959-9823981 ATAATGACAAGCACCTGGTTAGG + Intronic
1080454044 11:32402318-32402340 CTCCTGACAAACACATTCTAAGG - Intronic
1080667509 11:34348747-34348769 CTCCTGAAAAGCACCCGCAATGG + Intronic
1082189159 11:49221472-49221494 TTCCTGACAAGAATCAGGTAAGG + Intergenic
1083662642 11:64258953-64258975 CTCTGGACAAGTACCCGGTACGG + Exonic
1084179010 11:67437391-67437413 CTCCTGACAGGGGCCTGGTCCGG + Intronic
1085909077 11:80799731-80799753 CTCCAGACAAGCAAATGCTAAGG + Intergenic
1089167563 11:116488820-116488842 CTCCTGACAATTTCCTGGTTCGG - Intergenic
1091172835 11:133533399-133533421 CTGCTTACAAGCACGTGTTAGGG - Intergenic
1098371550 12:69765851-69765873 TTCCAGACAAGCAACTGCTAAGG - Intronic
1101819588 12:108173525-108173547 CTCCTGAGAAGCACCTGGTCAGG - Intronic
1103098060 12:118147847-118147869 CTCCTAACAAACACCTGCTATGG - Intergenic
1103985654 12:124765733-124765755 CTCCAGAAAAGCCCCTGGCAGGG - Intergenic
1104715724 12:131014979-131015001 CTCCTGACATGAACCTGGCGTGG - Intronic
1106218225 13:27721936-27721958 CTCCTGAAGAGCTCCTGGAATGG - Intergenic
1107635565 13:42388925-42388947 CTCCTTACAAGCTTGTGGTAAGG - Intergenic
1114591052 14:23865094-23865116 CTCCTGAGAATCACCTGCTTTGG + Intergenic
1114660556 14:24340870-24340892 TTCCTGACAAGCACATGCTCTGG + Intergenic
1118239789 14:64045062-64045084 GTCCTGATAAGCTCCTGGAATGG - Intronic
1120824816 14:88945544-88945566 CTCCTGCCAAGCACATCATAAGG - Intergenic
1122172577 14:99889224-99889246 CTGCTGCCAAGAACCTGGTGTGG - Intronic
1122768969 14:104088810-104088832 CCCCTGCCAAACACCTGGAAAGG - Intronic
1125070866 15:35551140-35551162 CTCCTCAAAAGCACCTGCTGTGG - Intergenic
1126140075 15:45430334-45430356 CTCCTCACAAGCACCTAGGGGGG + Intergenic
1127374805 15:58374614-58374636 ATCCTTACAAGGTCCTGGTAGGG - Intronic
1127830187 15:62743648-62743670 CACCTGACCAGCCCCTGGTTGGG - Intronic
1128247026 15:66140083-66140105 CTCCTGAAAAGCAGCTTTTAGGG + Intronic
1130002683 15:80060319-80060341 CTCCTGACTGGCACCGGGAAGGG + Intronic
1131094246 15:89645849-89645871 CACCTGACAAGGACCTGCTCAGG - Intronic
1132854121 16:2037218-2037240 CTCCTGGGCACCACCTGGTAAGG + Intronic
1136222457 16:28836902-28836924 TTCCTGCCAAGCACCTTGAATGG + Exonic
1137817416 16:51411726-51411748 TACCTGAAAAGCACCTGGTATGG - Intergenic
1140433381 16:74923939-74923961 TTCCAGACAGGCACCTGGCAAGG + Exonic
1141638120 16:85326191-85326213 CTCATCACAACCACCTGGGAGGG + Intergenic
1141744874 16:85919046-85919068 CTCCCGACAATCACCTGATGAGG - Intronic
1141880565 16:86856231-86856253 CTCCTGCAAAGCAACTGGCAGGG + Intergenic
1142608547 17:1095682-1095704 TTCCTGAGAAGCAGCTGGTATGG - Intronic
1142902313 17:3019781-3019803 CTCCTGCCATGCACATGTTATGG - Intronic
1144756951 17:17685649-17685671 CTGCTGGCCAGCACCTGGGAGGG - Intronic
1145913038 17:28553466-28553488 CTCCTCACAACCATCTTGTAAGG + Exonic
1149531455 17:57398700-57398722 CTCCTGATAGGAACCTTGTATGG + Intronic
1150614827 17:66762366-66762388 CACCTGACAAGCAGGTGGTGGGG - Intronic
1151209538 17:72534027-72534049 CTCCTGACAAGCACCACACAGGG + Intergenic
1151851664 17:76694213-76694235 CTCAGGACAAGCACATGGTAGGG - Intronic
1152558556 17:81066721-81066743 CTCATGTCACTCACCTGGTAGGG + Intronic
1153671737 18:7418563-7418585 CTGCTGAAAAGAACCTGGGAAGG - Intergenic
1155039224 18:22051091-22051113 TGCCTGACAAGCAGCTGGTAAGG + Intergenic
1157487584 18:48099629-48099651 CTCCTGACAATGAACTGGCAGGG + Intronic
1157491992 18:48129943-48129965 CTCCTGACTCCCACCTGCTAGGG - Intronic
1158134972 18:54198136-54198158 CTGATGACCAGCTCCTGGTAGGG - Intronic
1159889216 18:73938829-73938851 CTCCTGCCAGACACCTGGAAGGG - Intergenic
1161560993 19:4972341-4972363 ATCCTCACAACCACCTGGGAGGG - Intronic
1163673165 19:18640936-18640958 ATCCTCACTAACACCTGGTATGG + Intronic
1168412282 19:56147389-56147411 CTCCTGACTTGCAGCTGGTGTGG - Intronic
925363914 2:3298145-3298167 CTGCTAACAAGCATCTGTTAAGG - Intronic
927099323 2:19775779-19775801 CCCATCACAAGCACCTGGGATGG + Intergenic
928457050 2:31431763-31431785 CTTCTTACAACCACCAGGTAAGG - Intergenic
928470425 2:31569393-31569415 ATCCTCACAAACACTTGGTATGG + Intronic
930546006 2:52767711-52767733 TTCCTGACAAGCAAATGTTAAGG + Intergenic
932347393 2:71004611-71004633 CTCCTCACAAGCATCAGCTAGGG - Intergenic
932766650 2:74474789-74474811 CTCCTGACAAGCACCTGGTAAGG + Exonic
935332508 2:101987476-101987498 CTTCTGGCTAGCACCTGGCAGGG - Intergenic
935537938 2:104316331-104316353 CTGCTGGGATGCACCTGGTATGG - Intergenic
937207801 2:120247777-120247799 CTCATGCAAAGCACCAGGTAAGG - Intronic
937243288 2:120476257-120476279 CTCCTGCCACCCACCTGGTATGG + Intergenic
939026177 2:137016116-137016138 ATCCTCACAAGAACCTTGTAAGG + Intronic
939179951 2:138793083-138793105 TTTCAGACAAGCACATGGTAAGG - Intergenic
941961675 2:171260092-171260114 CTCCTCACCAACACCTGGTATGG - Intergenic
944890676 2:204114391-204114413 CTCCTGACAGGCAGCAGGAAGGG - Intergenic
948374219 2:237510671-237510693 CTATTCACAAGCAGCTGGTAGGG - Exonic
1169571481 20:6911392-6911414 CTCCTGGGAAGCACCTGAGAGGG - Intergenic
1171250264 20:23640927-23640949 CTGCTCACAAGCACCTGGCCAGG - Intergenic
1171256365 20:23691546-23691568 CTGCTCACAAACACCTGGTAAGG - Intergenic
1171263719 20:23753456-23753478 CTGCTCCCAAACACCTGGTAAGG - Intergenic
1171272758 20:23829139-23829161 CTGCTCACAAACACCTGGTAAGG - Intergenic
1171991407 20:31699380-31699402 CTCCTGACCAGCAGCTGAGATGG + Intronic
1173148906 20:40549299-40549321 CTCCTGTCCAGCTCCTGGTGTGG - Intergenic
1173428972 20:42968671-42968693 CTCCTCACAATGACCTGGTGAGG + Intronic
1175628052 20:60505633-60505655 CCCCTGACAAGCACTTGGAAGGG + Intergenic
1176728810 21:10468965-10468987 CTCATGAGAATCACCTGGTCAGG + Intergenic
1179913545 21:44462416-44462438 CTCCTGACAGCCAACTGTTAAGG + Intergenic
1182900252 22:33892328-33892350 CTTCTGACCAGCAGCTGGCAGGG + Intronic
1183671821 22:39277699-39277721 CTCCTCACAACCACCCTGTAAGG + Intergenic
1184347383 22:43922142-43922164 CACCTGAGAAGCACCTGGATTGG - Intergenic
1184496016 22:44841948-44841970 CTCCTGATCAGCACCAGGTGCGG + Intronic
949167130 3:956313-956335 CTACTGACAACAGCCTGGTAGGG + Intergenic
949269729 3:2200612-2200634 GTCCTCACAACCACCTTGTAAGG - Intronic
950465440 3:13150673-13150695 CTCCTCACAAGCACCTGGAGAGG + Intergenic
951455528 3:22888177-22888199 CTATTGGCAAGCACATGGTATGG + Intergenic
951869782 3:27348634-27348656 CTCCTGACAAGCACTTGCCCAGG + Intronic
953063151 3:39444445-39444467 CTCCTGACAACCCCATGATATGG - Intergenic
954552881 3:51496881-51496903 ATCCTAACAAGCATCTGCTAGGG + Intronic
956409965 3:68969005-68969027 CTCCTCACAACCACCTGATGAGG + Intergenic
957663769 3:83196080-83196102 CTCCTGACTAGTACGTTGTAAGG - Intergenic
958501741 3:94919368-94919390 CTTCTTACAAGAACCTGGTAAGG - Intergenic
961041145 3:123679365-123679387 CTCCTGAGAAGCTCCTGAGAAGG - Intronic
968509762 4:990413-990435 CCCCTCACCAGCACCTGGCATGG + Intronic
978374849 4:108064278-108064300 CTTCTGACAAACACCTTTTAAGG - Intronic
986696772 5:10364183-10364205 CTCCTTACAAACACTTGGTACGG - Intronic
991106500 5:62849906-62849928 CTCCAGACAAGCAAATGCTAAGG - Intergenic
992262165 5:74982254-74982276 CTCCTTGCCAGCACTTGGTATGG - Intergenic
992957894 5:81929255-81929277 CTCCTGACAATCATTTGGTCAGG + Intergenic
994641372 5:102413755-102413777 CTCCTCACCAACACTTGGTATGG + Intronic
996018115 5:118563575-118563597 CTCCTGCCAAAAACCTGGCACGG - Intergenic
997465130 5:134082696-134082718 CTCCTTGCCAACACCTGGTATGG + Intergenic
997593554 5:135091250-135091272 CTCCTGAGAACCACCTGGGGTGG - Intronic
997852320 5:137343893-137343915 CTCCTGTATGGCACCTGGTATGG - Intronic
998647261 5:144076157-144076179 CTGCTGGCAAGCACCTTGGATGG - Intergenic
1000124021 5:158226072-158226094 GTGGTGACAAGCACCAGGTAGGG + Intergenic
1002055024 5:176593865-176593887 CTCCGGACAGGCCCCAGGTATGG + Intronic
1003397019 6:5762476-5762498 CTCCTGCCAAGCACCTCCTGCGG - Intronic
1010768513 6:79802955-79802977 CTGCTGAGAAGCACCTGCTATGG + Intergenic
1012618803 6:101313481-101313503 CTCCTGTCTGCCACCTGGTATGG + Intergenic
1015849854 6:137560462-137560484 CTCCTGGCCAGAACCTGGTGGGG - Intergenic
1019415550 7:925125-925147 CGCCTGCCAAGCACCTGGACGGG + Intronic
1019757818 7:2786629-2786651 ATCCTCTCATGCACCTGGTAGGG + Intronic
1020428119 7:8092643-8092665 TTCCAGACAAACACCTGGTGTGG + Intronic
1021052460 7:16005046-16005068 CTCCAAACAAGGACCTGTTATGG + Intergenic
1022384507 7:29888904-29888926 CACCTGAGAAGCTCCTGGGAGGG - Intronic
1023115839 7:36861653-36861675 CTCCTGACAAGCATGAGGTAAGG - Exonic
1023187259 7:37545210-37545232 ATACTGCCAAGCACCTAGTATGG - Intergenic
1029189460 7:98761451-98761473 CTCCTGACACCCACTTGGCAAGG - Intergenic
1031756422 7:125649077-125649099 CTCCTGAGAAATACCTGTTAAGG - Intergenic
1035265480 7:157688602-157688624 GTCCCGAGAAGCACCTGGTGTGG - Intronic
1038193146 8:25342430-25342452 TTCCTGACAACCAGCTGGTTCGG + Exonic
1045528135 8:102959066-102959088 CTCATGAGAATCACCTGGGAAGG + Intronic
1049511100 8:143026990-143027012 CTTCTGCCCAGCACCTGGTTGGG - Intergenic
1051672157 9:19521760-19521782 GTCCTCACAAGTACCTGGTAAGG - Intronic
1053221975 9:36319863-36319885 CTCCTTTCAACCTCCTGGTATGG + Intergenic
1055755463 9:79553306-79553328 CTCCTGAGAAGGACCTTGTATGG + Intergenic
1056976114 9:91256422-91256444 CTCATGAAGAGCACCTGGCATGG + Intronic
1057189019 9:93075909-93075931 CTCCTCACCTGCACCTGGAAGGG + Exonic
1057199003 9:93130502-93130524 CTCCTCACAGGCCCCTGGAAAGG - Intronic
1057571885 9:96210808-96210830 CTCCTGACACTGACCTGTTAGGG - Intergenic
1057708575 9:97416513-97416535 ATCCTGACAAGCAGCAGGCACGG - Intronic
1059335120 9:113564303-113564325 CTCCTCACAAGCTGCTGGTGAGG + Intronic
1059426125 9:114222130-114222152 CTCCACACAGGCACCTGGTGGGG - Intronic
1060520618 9:124292054-124292076 CTCCTGAGAAGCTCCAGGGAAGG - Intronic
1203585438 Un_KI270746v1:65099-65121 CTCATGAGAATCACCTGGTCAGG - Intergenic
1186697710 X:12054746-12054768 CTCCTGAAAAGCAAATGGAAAGG + Intergenic
1187049285 X:15679952-15679974 CTCCTGAAATGCACATAGTATGG - Intergenic
1187563628 X:20426641-20426663 ATCCTCACAACAACCTGGTATGG + Intergenic
1191182489 X:57578229-57578251 ATCCTGACAAGGATCTGGCATGG - Intergenic
1191215099 X:57925442-57925464 ATCCTGACAAGGATCTGGCATGG + Intergenic
1192553751 X:72073771-72073793 ATGCTGAGAAGCACATGGTATGG - Intergenic
1195569023 X:106378722-106378744 ATCCTGACAAGGACCTGATGTGG - Intergenic