ID: 932769787

View in Genome Browser
Species Human (GRCh38)
Location 2:74494181-74494203
Sequence TTCCTCTGTGAAAGGTAAGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 251}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932769787_932769794 14 Left 932769787 2:74494181-74494203 CCCCCTTACCTTTCACAGAGGAA 0: 1
1: 0
2: 2
3: 25
4: 251
Right 932769794 2:74494218-74494240 AAATGATTATTGCTGCCCTGTGG 0: 1
1: 0
2: 1
3: 9
4: 175
932769787_932769795 15 Left 932769787 2:74494181-74494203 CCCCCTTACCTTTCACAGAGGAA 0: 1
1: 0
2: 2
3: 25
4: 251
Right 932769795 2:74494219-74494241 AATGATTATTGCTGCCCTGTGGG 0: 1
1: 0
2: 0
3: 4
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932769787 Original CRISPR TTCCTCTGTGAAAGGTAAGG GGG (reversed) Exonic