ID: 932770647

View in Genome Browser
Species Human (GRCh38)
Location 2:74499137-74499159
Sequence CGGAGCCGCCGCGGAACCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 36
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 32}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932770639_932770647 4 Left 932770639 2:74499110-74499132 CCTTTTCCCTTGGCACTGGCGGC 0: 1
1: 1
2: 2
3: 15
4: 139
Right 932770647 2:74499137-74499159 CGGAGCCGCCGCGGAACCTAGGG 0: 1
1: 0
2: 1
3: 2
4: 32
932770637_932770647 5 Left 932770637 2:74499109-74499131 CCCTTTTCCCTTGGCACTGGCGG 0: 1
1: 0
2: 1
3: 17
4: 165
Right 932770647 2:74499137-74499159 CGGAGCCGCCGCGGAACCTAGGG 0: 1
1: 0
2: 1
3: 2
4: 32
932770641_932770647 -3 Left 932770641 2:74499117-74499139 CCTTGGCACTGGCGGCCTTCCGG 0: 1
1: 0
2: 2
3: 11
4: 110
Right 932770647 2:74499137-74499159 CGGAGCCGCCGCGGAACCTAGGG 0: 1
1: 0
2: 1
3: 2
4: 32
932770640_932770647 -2 Left 932770640 2:74499116-74499138 CCCTTGGCACTGGCGGCCTTCCG 0: 1
1: 0
2: 0
3: 2
4: 76
Right 932770647 2:74499137-74499159 CGGAGCCGCCGCGGAACCTAGGG 0: 1
1: 0
2: 1
3: 2
4: 32

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932770647 Original CRISPR CGGAGCCGCCGCGGAACCTA GGG Intronic
900162054 1:1228491-1228513 CGGAGCCGCGGCGGAGCCGGAGG - Exonic
901295070 1:8154892-8154914 CGGCGCCTCCGCGGCAGCTAAGG + Intergenic
903142230 1:21345552-21345574 CGGGGCCGCCGCGGGGCCAATGG + Intergenic
915326912 1:155085472-155085494 CGGCCCCGCCCCGGAGCCTAGGG - Intronic
917797554 1:178542840-178542862 CGGAGCAGGCTCGGAGCCTACGG + Intronic
1096100916 12:48970046-48970068 CGGCGCTGCCGCGGAGGCTAGGG - Intronic
1103954085 12:124567098-124567120 CGGGGGCGCCGGGGAACTTAGGG - Intronic
1105837416 13:24223530-24223552 CGCAGCCTCCGCAGAGCCTACGG + Exonic
1108227461 13:48303954-48303976 CGCTGCCGCCGCGGAACCCCCGG + Exonic
1110630047 13:77697667-77697689 CGGAGCCGCCGCGACGCCCAGGG + Intergenic
1112319724 13:98395385-98395407 CGGAGCCGCCTCGGCGCCCACGG + Exonic
1112580594 13:100674253-100674275 GGGAGCCGCCGCGGAACCCAGGG + Intronic
1116945397 14:50831028-50831050 CGGCGCCGCCGCGGGAACCATGG + Exonic
1125328243 15:38558903-38558925 GGGAGCCTCCTGGGAACCTAAGG - Intronic
1130508694 15:84570617-84570639 AGGAGCCGCCGCGGCAGCTCAGG - Intergenic
1133186895 16:4106394-4106416 CGGTGCTGCCGCGGAACAGAAGG - Intronic
1136410793 16:30075975-30075997 CGGCCCCGCCGCGGAAGCAAAGG - Exonic
1136497197 16:30651627-30651649 CGGAGCCGCCGCGTCTCCCATGG + Exonic
1140025769 16:71289246-71289268 TGGAGGCGCCGCGGACCCAAAGG - Intronic
1152282305 17:79392079-79392101 CGGACCCGCTGCGGGACCTTGGG + Intronic
1157848999 18:51030351-51030373 CTGGGCGGCCGCGGAGCCTAGGG - Exonic
927544455 2:23940508-23940530 CGGCGCGGCCGCGGAACCTGAGG + Exonic
932770647 2:74499137-74499159 CGGAGCCGCCGCGGAACCTAGGG + Intronic
1180868592 22:19133648-19133670 CAGAACCGCAGGGGAACCTAAGG + Exonic
952788070 3:37175959-37175981 CGGAGGCGGCGCGGATCCCACGG + Intronic
966714284 3:183000325-183000347 GGGAGCTGCCGCGGACCCCAGGG + Intergenic
967685306 3:192409987-192410009 CGGAGCCGCCGCCGCCCCTCCGG + Intronic
974953974 4:68616249-68616271 CTGTGCCGCGGCGGAACCTAAGG - Intronic
975633030 4:76421082-76421104 CGCAGCCTCCGCGGGGCCTAGGG - Intronic
979231298 4:118352185-118352207 CGGGGCGGCCGCGGAAACTCCGG - Intronic
1002184260 5:177446959-177446981 CGCAGCCGCCGCGGTACTCACGG - Exonic
1035171854 7:157021534-157021556 CGGGGCCGCCGGGGCACCTGTGG - Intergenic
1043463994 8:80487065-80487087 CGGCGCCGCCGAGGAAGCCAAGG + Exonic
1049237173 8:141518210-141518232 CGGGGGCGCCGCGGGACCTGCGG - Exonic
1057173066 9:92975436-92975458 CGCAGCTGCCGAGGAGCCTAGGG - Intronic
1190317790 X:49162904-49162926 AGGGGACGCCGCGGACCCTAGGG + Exonic