ID: 932770730

View in Genome Browser
Species Human (GRCh38)
Location 2:74499532-74499554
Sequence GTTCATGGTCGGCCGGGCTG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 118}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932770721_932770730 4 Left 932770721 2:74499505-74499527 CCGGGGTGTTCGGGGCTCGCGTC 0: 1
1: 0
2: 0
3: 3
4: 36
Right 932770730 2:74499532-74499554 GTTCATGGTCGGCCGGGCTGGGG 0: 1
1: 0
2: 0
3: 4
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932770730 Original CRISPR GTTCATGGTCGGCCGGGCTG GGG Exonic
906356053 1:45106518-45106540 GATGATGGGCGGCCGGGCAGAGG - Intronic
914451735 1:147798645-147798667 GTTAATGGTGGGCTTGGCTGGGG - Intergenic
917135044 1:171781495-171781517 GTGAATGGTCGGCCGGCCTCAGG + Intergenic
918701750 1:187616232-187616254 GATGATGGGCGGCCGGGCAGAGG - Intergenic
921145750 1:212354343-212354365 TTGCATTGTCGGCCAGGCTGGGG - Intronic
1063464900 10:6236781-6236803 GTCCTGGGCCGGCCGGGCTGTGG + Intergenic
1063999723 10:11653598-11653620 GTTCAAGGGCGGGAGGGCTGGGG - Intergenic
1065342541 10:24721797-24721819 GTTCCTGGCCGGCAGGGCGGTGG - Intronic
1066402530 10:35090098-35090120 GTTAATGGGTGGCGGGGCTGGGG - Intronic
1069674772 10:70239363-70239385 GATGATGGGCGGCCGGGCAGAGG + Intergenic
1074761426 10:116669962-116669984 GATCCTGGGCGGCCGGGCAGAGG - Exonic
1077191195 11:1256527-1256549 GCTCAGGGTGGGCGGGGCTGGGG - Intronic
1077317901 11:1927436-1927458 GTTCATGGGCCGTGGGGCTGAGG + Intronic
1078131867 11:8620064-8620086 GTTCATGGAAGGGCAGGCTGAGG + Exonic
1081811134 11:45914655-45914677 GCTCATGGTTGCCAGGGCTGTGG + Exonic
1084037833 11:66523752-66523774 GTTCATGGTCAGGATGGCTGCGG - Exonic
1084046054 11:66568318-66568340 GTTCAACCGCGGCCGGGCTGCGG - Exonic
1085022398 11:73217925-73217947 CTTCCTGGCCAGCCGGGCTGGGG + Intergenic
1092336838 12:7640848-7640870 GTTCATGGTCTGGCGGGCTCAGG - Intergenic
1096194356 12:49640126-49640148 CATCATGGTCTGCCTGGCTGTGG - Exonic
1099227998 12:79992670-79992692 GTTCATGGTCTCCCTGGCTCAGG + Intergenic
1101081596 12:101191994-101192016 CTTCCTGGTAGGCCAGGCTGAGG - Intronic
1103932589 12:124458430-124458452 GCTCTTGGTGGGCCGGGCTCTGG - Intronic
1105267591 13:18836452-18836474 GATGATGGGCGGCCGGGCAGAGG + Intergenic
1120209693 14:81622805-81622827 GTTCATGGTCTGGCTGGCTCAGG + Intergenic
1121338288 14:93090287-93090309 GTGCATGGTAGGCAGGGATGGGG - Intronic
1122290819 14:100679571-100679593 GTTCATGGATGGCAGGGCTCAGG + Intergenic
1122974265 14:105164621-105164643 GCTCAAGGTGGGCCAGGCTGAGG - Intronic
1124641104 15:31397213-31397235 GTTCAGGGTGGGGCGGGGTGGGG + Intronic
1127088592 15:55446376-55446398 GATGATGGGCGGCCGGGCAGAGG + Intronic
1127088749 15:55446947-55446969 GATGATGGGCGGCCGGGCAGAGG + Intronic
1127088807 15:55447174-55447196 GATGATGGGCGGCCGGGCAGAGG + Intronic
1129162402 15:73753746-73753768 GCTCTGGGTCGGCAGGGCTGGGG + Intergenic
1131516437 15:93080661-93080683 GTTCAGGCTGGGCTGGGCTGGGG + Intronic
1132703310 16:1231062-1231084 GTCCATGGGCAGCTGGGCTGGGG - Intergenic
1132708091 16:1255037-1255059 GTTCATGGGGAGCTGGGCTGGGG + Intergenic
1133117615 16:3587000-3587022 GTTCTTGGTTGCCAGGGCTGGGG + Intronic
1133631993 16:7630394-7630416 GTGCTTGGTGGGCCGGGTTGTGG + Intronic
1135587764 16:23683922-23683944 GTTAATGGTTGGGCGGGCAGTGG - Exonic
1150381563 17:64724388-64724410 GCTCGTGGTCAGCCTGGCTGGGG - Intergenic
1150774771 17:68070850-68070872 GCTCGTGGTCAGCCTGGCTGGGG + Intergenic
1152391488 17:80006405-80006427 TCTCATGGGCAGCCGGGCTGGGG + Intronic
1154120308 18:11647392-11647414 GATGATGGGCGGCCGGGCAGAGG - Intergenic
1154120366 18:11647588-11647610 GATGATGGGCGGCCGGGCAGAGG - Intergenic
1154391815 18:13943530-13943552 GTTCGTGGTTGCCAGGGCTGGGG + Intergenic
1157547596 18:48557364-48557386 GTTCCTGGTTGGCCTGGCTCTGG - Intronic
1161605427 19:5212272-5212294 GTTCAGGGGCTGCTGGGCTGCGG + Intronic
1161845026 19:6707394-6707416 GCTCCTGCACGGCCGGGCTGGGG + Intronic
1165295497 19:34922524-34922546 GATGATGGGCGGCCGGGCAGAGG + Intergenic
1165758431 19:38307412-38307434 GTTCATGGTGAGCTGGGCTCGGG - Exonic
925076237 2:1018532-1018554 GTGCATGGTGGGCAGGGTTGGGG + Intronic
932770730 2:74499532-74499554 GTTCATGGTCGGCCGGGCTGGGG + Exonic
933709591 2:85315625-85315647 GATCATGGTGGACCGGCCTGGGG - Intergenic
933713475 2:85344149-85344171 GATCATGGTGGACCGGCCTGGGG + Exonic
935469982 2:103447314-103447336 GTTCAAGGTCGACTGGGCTTTGG + Intergenic
944785615 2:203066851-203066873 GATGATGGGCGGCCGGGCAGAGG + Intronic
945616013 2:212068057-212068079 GTTCATGGGGAGCCTGGCTGAGG + Intronic
947026807 2:225745205-225745227 GTTCATGGTCTCCCCGGCTCAGG - Intergenic
1169125705 20:3125401-3125423 GATGATGGGCGGCCGGGCAGAGG - Intronic
1169125724 20:3125477-3125499 GATGATGGGCGGCCGGGCAGAGG - Intronic
1169475571 20:5928338-5928360 GTGTATGGTCTGCCGGCCTGTGG - Intergenic
1172502585 20:35437613-35437635 GTTCAGGGCCGCCCGGTCTGGGG + Exonic
1173279808 20:41618181-41618203 GTCCAGGCCCGGCCGGGCTGGGG - Intronic
1173511261 20:43630667-43630689 GTTCATGGTCTGATGGGCTGGGG + Intronic
1175516230 20:59571961-59571983 GTCCAAGGTCCCCCGGGCTGTGG - Intergenic
1175550249 20:59812925-59812947 GTTCATGAATGGCCAGGCTGTGG + Intronic
1176194762 20:63831836-63831858 GTTGATGCCCGGCCGGGCTGGGG - Intergenic
1180077239 21:45468982-45469004 GTTCTTGGCCGGCCTGGCTGGGG + Intronic
1181236203 22:21448962-21448984 GTGCATGGCCTCCCGGGCTGTGG + Exonic
1182255314 22:29033554-29033576 GTGCAAGGTGGGCTGGGCTGAGG + Intronic
1183697507 22:39431485-39431507 GTCCCTGGTGGGCCGGTCTGGGG - Exonic
951844771 3:27073485-27073507 TTTCCTGGTCTGCTGGGCTGTGG - Intergenic
964485086 3:157178664-157178686 GATGATGGGCGGCCGGGCAGAGG + Intergenic
964485247 3:157179304-157179326 GATGATGGGCGGCCGGGCAGAGG + Intergenic
964485334 3:157179637-157179659 GATGATGGGCGGCCGGGCAGAGG + Intergenic
968651851 4:1763314-1763336 GTGGACGGGCGGCCGGGCTGGGG + Intergenic
969405282 4:6987343-6987365 GTTCATGGTGAGTCGGGGTGCGG + Intronic
973039792 4:45456358-45456380 GTTCATGGTCTCCCTGGCTCAGG + Intergenic
974804539 4:66861141-66861163 GTTCATGGTCTGGCTGGCTCAGG - Intergenic
975298963 4:72766881-72766903 GTTCGTGGTCTGGCTGGCTGAGG - Intergenic
982969520 4:161965734-161965756 GTTCATGCTGTGCTGGGCTGAGG + Intronic
989409423 5:41101253-41101275 GTTCATGGTCCAGGGGGCTGGGG - Intergenic
989991695 5:50774555-50774577 GATGATGGGCGGCCGGGCAGAGG + Intronic
991935287 5:71794317-71794339 GATGATGGGCGGCCGGGCAGAGG + Intergenic
999986954 5:157014103-157014125 GATGATGGGCGGCCGGGCAGAGG - Intergenic
1000979237 5:167798953-167798975 GTTCATGGACGGCAGTGCAGAGG - Intronic
1002222691 5:177695870-177695892 GATGATGGGCGGCCGGGCAGAGG + Intergenic
1002222749 5:177696063-177696085 GATGATGGGCGGCCGGGCAGAGG + Intergenic
1003006831 6:2390337-2390359 GTTCATGGACGGACTGGATGTGG + Intergenic
1008571967 6:52825278-52825300 GATGATGGGCGGCCGGGCAGAGG - Intergenic
1009392931 6:63164582-63164604 GATGATGGGCGGCCGGGCAGAGG - Intergenic
1016482139 6:144494274-144494296 GTTCATGGTCTTCCTGGCTCAGG + Intronic
1019128335 6:169856628-169856650 GATGATGGGCGGCCGGGCAGAGG + Intergenic
1021558539 7:21945862-21945884 GTTCTTGGTGCGCCGGGCCGTGG - Exonic
1021988166 7:26117330-26117352 GTTCCTGGGAGGCTGGGCTGGGG - Intergenic
1022965261 7:35466266-35466288 GTTCATGGCGGGCCTGGCCGGGG - Intergenic
1023082239 7:36536502-36536524 GTTCATGCTGGGCCGGCCTCAGG - Intronic
1026069437 7:67104973-67104995 GTTGATGATGGGCTGGGCTGGGG + Intronic
1026707468 7:72707340-72707362 GTTGATGATGGGCTGGGCTGGGG - Intronic
1027048463 7:75006850-75006872 GTTGGTGGTTGGCGGGGCTGGGG - Intronic
1028535786 7:91888164-91888186 GATGATGGGCGGCCGGGCAGAGG - Intergenic
1028535949 7:91888772-91888794 GATGATGGGCGGCCGGGCAGAGG - Intergenic
1032129462 7:129216407-129216429 GATGATGGGCGGCCGGGCAGAGG - Intergenic
1035702146 8:1644260-1644282 GCTCTTGGTCGGGCGGGCTTAGG - Intronic
1037470290 8:19201955-19201977 GTTGATGTTAGGCAGGGCTGGGG - Intergenic
1037493699 8:19419340-19419362 GTTAATGTTTGGCGGGGCTGGGG - Intronic
1040791208 8:51231925-51231947 GTTCATGGTCTGGCTGGCTCAGG - Intergenic
1040952526 8:52951861-52951883 GTTCATGGTCTCCCTGGCTCAGG + Intergenic
1042876611 8:73446259-73446281 ATTCATGGTTGCCAGGGCTGGGG + Intronic
1045137325 8:99234526-99234548 GTTCAGGGGCCGCAGGGCTGGGG + Intronic
1049083619 8:140461002-140461024 GATCATTGTGGGCTGGGCTGTGG - Intergenic
1049802969 8:144526800-144526822 GTTGATTTTCGGCCGGGCTCAGG + Exonic
1052771398 9:32694125-32694147 GATGATGGGCGGCCGGGCAGAGG - Intergenic
1055133987 9:72806659-72806681 GATGATGGGCGGCCGGGCAGAGG + Intronic
1058368160 9:104234811-104234833 GATGATGGGCGGCCGGGCAGAGG + Intergenic
1062091584 9:134681226-134681248 GTTCTTGAAGGGCCGGGCTGAGG - Intronic
1185452608 X:290833-290855 GTGCAGGTGCGGCCGGGCTGAGG + Intronic
1185452628 X:290895-290917 GTGCAGGTGCGGCCGGGCTGAGG + Intronic
1185452648 X:290957-290979 GTGCAGGTGCGGCCGGGCTGAGG + Intronic
1186283220 X:8016925-8016947 GTCCAAGGTTGGCCTGGCTGGGG - Intergenic
1189421776 X:40862879-40862901 GATGATGGGCGGCCGGGCAGAGG - Intergenic
1191611221 X:63115369-63115391 GCTCATGGTGGGATGGGCTGTGG - Intergenic
1192003618 X:67185329-67185351 GTTCATGGTTGGCTTGGTTGGGG - Intergenic