ID: 932772121

View in Genome Browser
Species Human (GRCh38)
Location 2:74506289-74506311
Sequence GCCACCGCGCCCGGCCCCGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4122
Summary {0: 1, 1: 30, 2: 285, 3: 1106, 4: 2700}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932772121_932772130 16 Left 932772121 2:74506289-74506311 CCTTCGGGGCCGGGCGCGGTGGC 0: 1
1: 30
2: 285
3: 1106
4: 2700
Right 932772130 2:74506328-74506350 AGCACTTTGGGAGGCAGAGGTGG 0: 3907
1: 153669
2: 176449
3: 114127
4: 72832
932772121_932772124 4 Left 932772121 2:74506289-74506311 CCTTCGGGGCCGGGCGCGGTGGC 0: 1
1: 30
2: 285
3: 1106
4: 2700
Right 932772124 2:74506316-74506338 GCCTGTAATCCCAGCACTTTGGG 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611
932772121_932772131 17 Left 932772121 2:74506289-74506311 CCTTCGGGGCCGGGCGCGGTGGC 0: 1
1: 30
2: 285
3: 1106
4: 2700
Right 932772131 2:74506329-74506351 GCACTTTGGGAGGCAGAGGTGGG 0: 1895
1: 74127
2: 250064
3: 245043
4: 167671
932772121_932772128 13 Left 932772121 2:74506289-74506311 CCTTCGGGGCCGGGCGCGGTGGC 0: 1
1: 30
2: 285
3: 1106
4: 2700
Right 932772128 2:74506325-74506347 CCCAGCACTTTGGGAGGCAGAGG 0: 5413
1: 206587
2: 259227
3: 184125
4: 204894
932772121_932772126 7 Left 932772121 2:74506289-74506311 CCTTCGGGGCCGGGCGCGGTGGC 0: 1
1: 30
2: 285
3: 1106
4: 2700
Right 932772126 2:74506319-74506341 TGTAATCCCAGCACTTTGGGAGG 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789
932772121_932772123 3 Left 932772121 2:74506289-74506311 CCTTCGGGGCCGGGCGCGGTGGC 0: 1
1: 30
2: 285
3: 1106
4: 2700
Right 932772123 2:74506315-74506337 CGCCTGTAATCCCAGCACTTTGG 0: 121435
1: 268139
2: 223994
3: 153979
4: 220861

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932772121 Original CRISPR GCCACCGCGCCCGGCCCCGA AGG (reversed) Intronic