ID: 932772331

View in Genome Browser
Species Human (GRCh38)
Location 2:74507521-74507543
Sequence GCCAGCGGTGCGAATTGGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 58}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932772331_932772344 25 Left 932772331 2:74507521-74507543 CCGCCCCAATTCGCACCGCTGGC 0: 1
1: 0
2: 0
3: 4
4: 58
Right 932772344 2:74507569-74507591 CTTGCACCTCGTTCCGTAGCGGG 0: 1
1: 0
2: 0
3: 3
4: 23
932772331_932772343 24 Left 932772331 2:74507521-74507543 CCGCCCCAATTCGCACCGCTGGC 0: 1
1: 0
2: 0
3: 4
4: 58
Right 932772343 2:74507568-74507590 CCTTGCACCTCGTTCCGTAGCGG 0: 1
1: 0
2: 0
3: 2
4: 19

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932772331 Original CRISPR GCCAGCGGTGCGAATTGGGG CGG (reversed) Intronic
900476519 1:2878810-2878832 GCCAGAGGTGGGAAGTGAGGCGG - Intergenic
906766106 1:48435812-48435834 GCCAGCGGTGCGGACAGGGGCGG - Intronic
913172549 1:116245784-116245806 TCCAGTGGTCCGAAATGGGGAGG + Intergenic
920925866 1:210340919-210340941 ACCAGCTGTGTGATTTGGGGCGG + Intronic
1072726393 10:97816661-97816683 GCCAGCTGTGAGAAATGGGATGG + Intergenic
1077444593 11:2585071-2585093 GCCCGAGGTGGGACTTGGGGGGG + Intronic
1084121298 11:67070572-67070594 GCCCGAGGTGGGAGTTGGGGAGG + Intronic
1091074766 11:132605084-132605106 GCCAGCTGTGTGACTTGGTGAGG + Intronic
1094728492 12:33147484-33147506 GGCAGCAGTGAGGATTGGGGAGG - Intergenic
1100306981 12:93359619-93359641 ACCAACATTGCGAATTGGGGTGG - Intergenic
1103727834 12:123007549-123007571 GCCAGGGGTGGGAAGTGAGGAGG - Intronic
1117156820 14:52950635-52950657 GCCGGCGCTGCGAATTCGGTGGG - Intronic
1129709067 15:77811073-77811095 GACAGCTGTGGGAATTGGGGTGG - Intronic
1130329392 15:82909436-82909458 GACAGCGGTACAAATTGGAGTGG + Intronic
1131467487 15:92667477-92667499 GCCAGCTGTGGGAATTGCAGTGG - Intronic
1131641490 15:94298724-94298746 GCCAGAGGTGAGAATAGGGCTGG + Exonic
1141799853 16:86299450-86299472 GTCAGCTGTGTGACTTGGGGTGG + Intergenic
1146502031 17:33372686-33372708 GCCAGCGGTTCCAATGGGGTGGG - Intronic
1153207941 18:2723589-2723611 GGCTGGGGTGGGAATTGGGGAGG + Intronic
1155235657 18:23816481-23816503 GCCAGCGGTGAGTCTTCGGGAGG + Exonic
1160833650 19:1114507-1114529 GCCAGTGGTCCGAGCTGGGGAGG + Intronic
1165939468 19:39407935-39407957 GCCAGCGGTGCGAAGCCAGGGGG - Exonic
1168232905 19:55044737-55044759 GCCAGCGGTGCCTGTCGGGGAGG - Exonic
928118227 2:28563391-28563413 ACCAGCTGTGTGACTTGGGGTGG - Intronic
929562279 2:42963385-42963407 TCCAGAGGTGAGGATTGGGGAGG + Intergenic
931748053 2:65307951-65307973 GCCATCTGTGTGAATGGGGGGGG - Intergenic
932772331 2:74507521-74507543 GCCAGCGGTGCGAATTGGGGCGG - Intronic
933555548 2:83826241-83826263 GCTAGGGGTGGGGATTGGGGAGG - Intergenic
939680400 2:145124035-145124057 GCCTGGGGTGGGAATTGGGTGGG + Intergenic
940980321 2:159994324-159994346 GGCAGGGGTGGAAATTGGGGAGG + Intronic
943363095 2:186944789-186944811 GCCAGCAGTGGGAAGTGAGGAGG + Intergenic
944615135 2:201451879-201451901 GCCAGCGGTGCGGACAGGGGCGG - Exonic
946220434 2:218221255-218221277 GCAAGCAGTGCCAGTTGGGGTGG + Intronic
1169208310 20:3752226-3752248 GCCTGCGGAGCGGGTTGGGGCGG + Exonic
1171249326 20:23636547-23636569 CCCAGGGGTGTGACTTGGGGAGG + Intronic
1173227423 20:41170040-41170062 GCCTGCGGTGTGGAGTGGGGTGG + Intronic
1178810761 21:35878997-35879019 GCCAGTGGTGAGAGCTGGGGAGG - Intronic
1182297093 22:29315999-29316021 GCCCGGGGTCCGAATTGGGGGGG + Intronic
1183529289 22:38344159-38344181 GCCTGGGGTGCGATTTGGGCCGG + Intronic
1184944203 22:47790030-47790052 GGCAGTGGTGAGAATTGGGCAGG + Intergenic
954708951 3:52495539-52495561 GCCAGCGGTGGGAACAGGGAGGG + Intronic
961870158 3:129981628-129981650 GAGAGCAGTGCGGATTGGGGTGG + Intergenic
969349833 4:6591979-6592001 GCCAGCTGTGGGACCTGGGGCGG - Intronic
969436254 4:7191362-7191384 CCCAGCGCTGGGACTTGGGGAGG - Intergenic
969755063 4:9143870-9143892 GGCGGCGGTGCTCATTGGGGAGG - Intergenic
987707387 5:21473632-21473654 GCCAGCGCTGCGCCCTGGGGAGG - Intergenic
991028868 5:62061618-62061640 GTCAGAGGTACAAATTGGGGAGG - Intergenic
1002325857 5:178405096-178405118 GCCTGTGGTGCGAATGCGGGAGG - Intronic
1003846558 6:10180272-10180294 GCCAGCGCTCCGAAGTGGTGAGG - Intronic
1005778117 6:29160024-29160046 GCCTCCGCTGCGAGTTGGGGCGG - Intergenic
1005778744 6:29165855-29165877 GCCTCCGCTGCGAGTTGGGGCGG + Intergenic
1009020839 6:57946880-57946902 GCCAGCGCTGCGCCCTGGGGAGG + Intergenic
1019163190 6:170082470-170082492 GCCACTGGTGAGAAGTGGGGAGG + Intergenic
1023779383 7:43641983-43642005 GGCAGGGGAGGGAATTGGGGCGG + Intronic
1029135544 7:98368055-98368077 GCCAGAGGTGAGGATTGGTGAGG - Intronic
1038366468 8:26940648-26940670 GGCAGCAGTGAGAATGGGGGAGG - Intergenic
1038378132 8:27063554-27063576 GGCAGCAGTGAGAATGGGGGAGG - Intergenic
1048857004 8:138694411-138694433 GCCAGGGGAGAGAACTGGGGAGG + Intronic
1049427493 8:142543933-142543955 GCCAGGGGTCTGGATTGGGGTGG + Intronic
1049580792 8:143409623-143409645 GCCAGAGGTGTGGAGTGGGGAGG - Intergenic
1060446501 9:123693462-123693484 GCCAGGGCTGAGATTTGGGGAGG - Intronic
1189001305 X:36950021-36950043 GCCAGGGGTTGGGATTGGGGAGG - Intergenic
1198807288 X:140504699-140504721 GCCGGCGGCGCGAACTCGGGCGG - Exonic