ID: 932772526

View in Genome Browser
Species Human (GRCh38)
Location 2:74508340-74508362
Sequence GAGCAGATGCCGAAGGAGGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 353
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 326}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932772521_932772526 6 Left 932772521 2:74508311-74508333 CCTGCGGAGGCCTGGGACAGACT 0: 1
1: 0
2: 0
3: 16
4: 152
Right 932772526 2:74508340-74508362 GAGCAGATGCCGAAGGAGGAGGG 0: 1
1: 0
2: 0
3: 26
4: 326
932772522_932772526 -4 Left 932772522 2:74508321-74508343 CCTGGGACAGACTAATGCAGAGC 0: 1
1: 0
2: 2
3: 16
4: 161
Right 932772526 2:74508340-74508362 GAGCAGATGCCGAAGGAGGAGGG 0: 1
1: 0
2: 0
3: 26
4: 326

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932772526 Original CRISPR GAGCAGATGCCGAAGGAGGA GGG Exonic
901056798 1:6452082-6452104 GAGCAGAGGCGGAAGGTGGGTGG + Exonic
901185289 1:7368958-7368980 AAACAGAAGCAGAAGGAGGAAGG - Intronic
901573291 1:10179482-10179504 GAGCAGGTGCCGCAGGATGATGG - Exonic
901773416 1:11542917-11542939 GAGAAGAGGCAGGAGGAGGATGG - Intergenic
902100764 1:13986732-13986754 GAGCAGAAGCCAAGGAAGGATGG + Intergenic
902805313 1:18857660-18857682 AAGCAGATCCAGAATGAGGAAGG + Intronic
903320693 1:22541506-22541528 GGGCAGAAGCTGGAGGAGGAGGG - Intergenic
903816187 1:26066177-26066199 GAGCAGATGAAGGAGGGGGAAGG + Intronic
904677764 1:32208812-32208834 GAGCTGTTCCCTAAGGAGGATGG - Intergenic
905445881 1:38028360-38028382 GAGCAGATGAGGAGAGAGGATGG - Intergenic
906189080 1:43884321-43884343 GAGCAGGAGTCGAAGGAGAAAGG - Intronic
908182380 1:61618846-61618868 GAGCAGATGAGGGAGAAGGAAGG + Intergenic
908605123 1:65790448-65790470 GAGCAGAAGCAGAAGGAAGAAGG - Intergenic
909561834 1:77016181-77016203 GAGGAGATACAGGAGGAGGAGGG - Intronic
909561842 1:77016205-77016227 GAGGAGATACAGGAGGAGGAGGG - Intronic
909561850 1:77016229-77016251 GAGGAGATACAGGAGGAGGAGGG - Intronic
909561858 1:77016253-77016275 GAGGAGATACAGGAGGAGGAGGG - Intronic
910152886 1:84174125-84174147 AAGCAGATGCCGAATCAGGGAGG - Intronic
910285184 1:85545775-85545797 GAGGAGATGCAGAGGGAGGAGGG + Intronic
913173900 1:116256664-116256686 GAGCAGATGACAGTGGAGGAAGG - Intergenic
913332159 1:117676704-117676726 AACCAGATGCCGGAGGTGGAAGG + Intergenic
915981679 1:160424308-160424330 GAGGAGCTGGGGAAGGAGGAAGG - Intronic
916261263 1:162844650-162844672 GAGTAGATGCTCCAGGAGGAGGG + Intronic
918114125 1:181482656-181482678 GAGAAGATGCGGAAGGAGAATGG - Intronic
918135566 1:181670917-181670939 GAGCAAGAGCTGAAGGAGGAAGG + Intronic
918912604 1:190592847-190592869 GAGCAGAGGTAGAAGCAGGAGGG - Intergenic
919054000 1:192546127-192546149 GAGCAGATGCAGGCTGAGGAAGG + Intergenic
919851925 1:201678838-201678860 GAGAAAAAGTCGAAGGAGGAAGG + Intronic
920176056 1:204102616-204102638 GAGCAGATGGAGGAGGAAGAGGG + Intronic
921095589 1:211884801-211884823 CAGCTGATGGGGAAGGAGGATGG - Intergenic
922428048 1:225517913-225517935 GAGGAGGTGCTGAAGGAGGCTGG + Intronic
922741646 1:228017375-228017397 GTGGAGAGGCCGCAGGAGGAGGG + Intronic
922994305 1:229943899-229943921 GAGCAGCTGTGGGAGGAGGAGGG + Intergenic
923072368 1:230577640-230577662 GAGGAGAAGAAGAAGGAGGAAGG - Intergenic
1063248496 10:4248769-4248791 GAGCAGAAGCCAACAGAGGACGG - Intergenic
1063603820 10:7506044-7506066 GAACAGATCCTGCAGGAGGAAGG + Intergenic
1064609251 10:17080015-17080037 GAGCAGAAGCTGAGGCAGGAAGG - Intronic
1065323655 10:24531882-24531904 GAGGAGGTGGCGGAGGAGGAGGG - Exonic
1067150792 10:43731666-43731688 AAGCAGAAACAGAAGGAGGAAGG - Intergenic
1068451214 10:57191643-57191665 CAGCAAAAGCCGTAGGAGGAGGG - Intergenic
1071676432 10:87659927-87659949 GAGCAGAGACCGAAGGACGCAGG - Exonic
1071833267 10:89393221-89393243 GACCAGAAGCCTATGGAGGAAGG - Intronic
1072228634 10:93393786-93393808 GATGAGAAGCAGAAGGAGGAAGG - Intronic
1073063424 10:100745324-100745346 GAGCAGCCGGCGAAGGAAGAGGG - Intronic
1074341151 10:112631394-112631416 GAGCAACTGCCTAACGAGGATGG - Intronic
1074532241 10:114305639-114305661 GAGGAGATGCAGATGCAGGAGGG + Intronic
1074532268 10:114305726-114305748 GAGGAGATGCAGATGCAGGAGGG + Intronic
1074532403 10:114306211-114306233 GAGGAGATGCAGATGCAGGAGGG + Intronic
1074987194 10:118668936-118668958 GAGCAGATGAGGAAGAAGGAGGG + Intergenic
1075058934 10:119241150-119241172 AAGCTGAGGCCGGAGGAGGAGGG - Intronic
1075657777 10:124173460-124173482 GGGCAGAGGCTGAAGGAGGAGGG - Intergenic
1076053009 10:127350276-127350298 GAGCAGAGGCTGCAGGAGGCAGG - Intronic
1076482818 10:130796045-130796067 CAGCAGAGGCCGCTGGAGGAGGG + Intergenic
1076717458 10:132373681-132373703 GAGTAGATGCTGAGAGAGGAAGG + Intronic
1077285027 11:1761799-1761821 GCGCAGGTGCAGAGGGAGGACGG - Intronic
1077304857 11:1864448-1864470 GGGCAGAGGCGGAGGGAGGAAGG + Intronic
1077819241 11:5719774-5719796 GGGCATTTGCTGAAGGAGGATGG - Intronic
1077887240 11:6395210-6395232 CAGCAGGGGCAGAAGGAGGAAGG - Exonic
1078135795 11:8650450-8650472 GAGCAGAAGGAAAAGGAGGAAGG + Intronic
1079138945 11:17794965-17794987 CAGCAGATGCAGAAGGGGGCAGG - Intronic
1079392703 11:20036217-20036239 GAGCAGAGGCGGCAGGAGGCTGG - Intronic
1080290616 11:30666976-30666998 GAGCAAATGGGGAAGTAGGAAGG + Intergenic
1081801870 11:45865656-45865678 GAGCAGATGCGTAAAGAAGAGGG + Intronic
1084093760 11:66896572-66896594 GAGCAGAGGGGCAAGGAGGATGG + Intronic
1084183070 11:67456114-67456136 GAGCAGGGGATGAAGGAGGAAGG + Intronic
1090130943 11:124141623-124141645 GCTGAGATGCAGAAGGAGGACGG - Exonic
1090961758 11:131563429-131563451 GAGAAGATGCCCAGGGATGATGG - Intronic
1091287169 11:134413855-134413877 GGGCAGGTGCAGAAGCAGGATGG + Intergenic
1091678339 12:2507924-2507946 GAGCAGAAGCTGCAGTAGGAAGG + Intronic
1092091365 12:5806139-5806161 AAGCAGGTGCCAAAGGAGAAAGG + Intronic
1093232628 12:16566247-16566269 GAGCAGAGAGGGAAGGAGGAAGG + Intronic
1096111323 12:49030933-49030955 AAGAAGCTGCGGAAGGAGGACGG - Exonic
1096489811 12:52007275-52007297 GAGCAGATCCTGAAGGCGGGCGG - Intronic
1096863114 12:54544323-54544345 ATGCAGATGCAGATGGAGGAGGG - Exonic
1098014331 12:66088455-66088477 GGGCAGATCATGAAGGAGGAAGG - Intergenic
1098217502 12:68235858-68235880 GAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1098622072 12:72613758-72613780 GAGAAGGAGCAGAAGGAGGAGGG + Intronic
1101403874 12:104411599-104411621 GAGATGATGCAGGAGGAGGAAGG - Intergenic
1102415387 12:112757965-112757987 GAGCAGCTGCCACAGCAGGATGG - Intronic
1102679817 12:114683870-114683892 GAGCAGAGGAAGGAGGAGGAGGG - Intronic
1103080936 12:118023457-118023479 GAGGAGAAGGCGGAGGAGGAGGG + Intronic
1104277854 12:127346449-127346471 AAACAGATGAAGAAGGAGGAAGG + Intergenic
1108586214 13:51872058-51872080 GAGCAGATGTCCAAGGATCACGG + Intergenic
1111847512 13:93530098-93530120 GAGCAGATGGCTAAGGAATATGG + Intronic
1112323951 13:98431176-98431198 GTGCAGTGGCCGCAGGAGGAAGG - Exonic
1113545114 13:111142763-111142785 GAGGAGATGGTGAAGCAGGAGGG - Intronic
1113803810 13:113101807-113101829 GAGCAGAGGCAGGAGGAGGAGGG + Intergenic
1114633111 14:24172194-24172216 GAGCAGGTCCCGAGGGAGCACGG - Exonic
1114657766 14:24326226-24326248 GAGCAGACCCCCAGGGAGGATGG + Intronic
1116773260 14:49151399-49151421 AAGCAGCTGGAGAAGGAGGAAGG - Intergenic
1119740776 14:77012448-77012470 GTGGTGAAGCCGAAGGAGGAGGG - Intergenic
1121218448 14:92266460-92266482 GAGCGGATGCCTATGGGGGAAGG - Intergenic
1121346638 14:93141018-93141040 GAGCAGAGGCAAATGGAGGAAGG + Intergenic
1121409238 14:93737833-93737855 TAGCTCATGCCGAGGGAGGATGG - Intronic
1122420223 14:101571712-101571734 AAGCAGAGGGGGAAGGAGGAGGG + Intergenic
1122473200 14:101986260-101986282 GGGCAGAAGCTGAAGCAGGATGG + Exonic
1122772482 14:104103571-104103593 GAGCTGGTGCGGAAGGTGGACGG + Exonic
1123682183 15:22770719-22770741 GAGCAGATGCGGGAGCAGGAGGG - Intergenic
1125524857 15:40368390-40368412 GAGCAGCTGCCGCAGGGCGAGGG + Exonic
1126079581 15:44946384-44946406 CAGCAGAAGGCTAAGGAGGAAGG + Intergenic
1126085518 15:45007643-45007665 GAGGAGATTCCCATGGAGGATGG + Intergenic
1126411806 15:48379948-48379970 GATCAGAAGCATAAGGAGGAGGG + Intergenic
1128115514 15:65102479-65102501 CAGGAGAGGCCGGAGGAGGAGGG - Exonic
1128396918 15:67235978-67236000 GAGGAGTTGCCTGAGGAGGATGG - Exonic
1128519174 15:68364428-68364450 GTGCATATCCCGAAGGAGGGAGG - Intronic
1128797760 15:70477834-70477856 GAGGAGATGGAGGAGGAGGAGGG + Intergenic
1129255065 15:74329796-74329818 TAGAAGATGGGGAAGGAGGAGGG + Intronic
1130075455 15:80685349-80685371 CAGCAGAAGCCGAAGAAGTATGG + Intronic
1132500650 16:283275-283297 GAGGAAATCCCCAAGGAGGATGG + Exonic
1132598503 16:763781-763803 GAGCAGAGGAGGAAGGGGGAGGG - Intronic
1133147041 16:3795894-3795916 TAGCTGATGCCCAAGAAGGATGG - Intronic
1133806353 16:9128450-9128472 GAGCTGTTTCCGAAGGAGCATGG - Intergenic
1137392205 16:48091245-48091267 CTGCAGAACCCGAAGGAGGAAGG - Intronic
1137504494 16:49041327-49041349 GAGCAGAAGCCCAGGGAGGAAGG + Intergenic
1138027267 16:53531764-53531786 TGGCAGATGCAGGAGGAGGAAGG - Intergenic
1138412420 16:56850930-56850952 GTGCAGATGGCTAAGGAGGTAGG + Intergenic
1139637732 16:68268363-68268385 GACCAAATGCCGGAGGGGGAGGG - Intronic
1139679452 16:68549753-68549775 GACCAAATGCTGAAGGGGGATGG + Intronic
1142172005 16:88627810-88627832 GAGCAGCTCCCGGGGGAGGAGGG + Intronic
1142200292 16:88757870-88757892 CAGCAGATGCCCCAGGAGGCAGG + Intronic
1142280777 16:89146515-89146537 GTGCAGGTGCCGACGGAGAATGG - Intronic
1142479181 17:207633-207655 GTTCAGATGCAGCAGGAGGACGG + Intergenic
1143336077 17:6172508-6172530 GAGAAGAAGCCGAAGAGGGAGGG - Intergenic
1143411820 17:6713713-6713735 GAGCAGATGCGGACGCGGGAGGG - Intergenic
1143647401 17:8239849-8239871 GAGCAGATGCAGAAGGGGAATGG - Intronic
1143885912 17:10064678-10064700 GAGCCAATGCAGAAGGAAGAGGG + Intronic
1143986923 17:10922761-10922783 GTGCAGATGCCGTAAGTGGATGG - Intergenic
1145935310 17:28711561-28711583 GAGCAGATGCCGCGGTAAGAGGG - Exonic
1147122553 17:38344095-38344117 GAGCAGATGTGGATGGGGGATGG - Intergenic
1147881567 17:43657561-43657583 AAGGAGATGGCAAAGGAGGAAGG + Intronic
1148090899 17:45022019-45022041 GAGCAGCTGCCGCGGGAGCACGG - Intergenic
1148212877 17:45818806-45818828 GATCAGATGCAGCAGGAGGGAGG - Intronic
1148898315 17:50854034-50854056 GAGCATCTGCCAAAGGAGAAGGG - Intergenic
1151235528 17:72717277-72717299 GAGAAGACGCCGATGGAGGTAGG + Intronic
1152201091 17:78946747-78946769 GGGCAGAAGAGGAAGGAGGAAGG - Intergenic
1152435388 17:80273297-80273319 GGGCAGGAGCTGAAGGAGGAAGG + Exonic
1152461234 17:80443597-80443619 GAGCAGAGGCGCAGGGAGGAGGG + Intergenic
1152813013 17:82391096-82391118 GAGGAGGTGCTGAGGGAGGAGGG + Intronic
1154045510 18:10901118-10901140 CAGCAAATGCCGAAGGATGGTGG + Intronic
1156934196 18:42682647-42682669 GAGAAGATGAGGAAGGAGAAAGG + Intergenic
1157449225 18:47772895-47772917 GTGCAGAGGCTGAAGCAGGAAGG + Intergenic
1157799166 18:50604984-50605006 GAGCAGAGGGTGCAGGAGGATGG + Intronic
1158287026 18:55895116-55895138 GAGAAGACTCTGAAGGAGGAAGG + Intergenic
1158417145 18:57258459-57258481 GGCCAGATGCCAGAGGAGGAAGG + Intergenic
1160072872 18:75643583-75643605 GAGCAGAGACTGAAGGAGGAGGG - Intergenic
1160083400 18:75752761-75752783 GAGCAGAGGCTGGAGGAGGAGGG + Intergenic
1160264981 18:77334624-77334646 GAGCAAAGGCCAAAGGAGGATGG - Intergenic
1160757479 19:765194-765216 GAGCAGAGACTGAGGGAGGAGGG + Intergenic
1161082369 19:2317680-2317702 CTGCAGGTTCCGAAGGAGGACGG - Intronic
1161433927 19:4250650-4250672 GAGCAGAGCCCGGAGTAGGAGGG + Intronic
1162029186 19:7910029-7910051 GAGCAGGTGCCGGTGGAGGTGGG - Intronic
1163008776 19:14411998-14412020 GAGCACATCCTGAAGGATGAAGG - Intronic
1163260333 19:16185768-16185790 GAGCAGAAGCAGAAGGCGGCGGG + Intronic
1163704143 19:18802644-18802666 GGGCAGGGGCCAAAGGAGGATGG + Intergenic
1164250274 19:23469629-23469651 GAGGAGATGGAGAAGGAGGGGGG - Intergenic
1164897960 19:31893777-31893799 GAGCAGAAGAGGAAGAAGGAGGG + Intergenic
1165420660 19:35720598-35720620 GAGGAGATGTCGAAGGGGGTGGG - Exonic
1165796585 19:38523475-38523497 GAGAAGATACAGGAGGAGGAAGG - Intronic
1165796601 19:38523551-38523573 GAGAAGATACAGGAGGAGGAAGG - Intronic
1166195949 19:41206087-41206109 CAGCAGATACCTAAGGAGAAGGG - Exonic
1166868032 19:45852917-45852939 GAGCAGAAGCAGAAGGAGAGTGG - Intronic
1167036150 19:46996058-46996080 GTGCATATGCAGAAGGAGGCTGG + Intronic
1167146078 19:47681297-47681319 GAGCAGGTACCGGAGGAGGCGGG + Intronic
1167409487 19:49336663-49336685 GAGGAGGAGCTGAAGGAGGAAGG + Intronic
1167609892 19:50501936-50501958 GAGGAGGTGATGAAGGAGGAGGG - Intergenic
1168464942 19:56594844-56594866 GAAGAGATGGAGAAGGAGGAGGG - Intergenic
1168593928 19:57658971-57658993 GACCAGAAACCAAAGGAGGATGG + Intergenic
925177662 2:1796704-1796726 CAGCAGGAGCAGAAGGAGGATGG - Intronic
925947638 2:8880404-8880426 GAACAGATGCGGGAGGAGGAAGG + Intronic
926231583 2:11008234-11008256 GAGCTGCAGCAGAAGGAGGAAGG - Intergenic
926282962 2:11465595-11465617 GAGCAGATGCTGAAAGCAGAAGG + Intronic
926510407 2:13770042-13770064 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
927702236 2:25275927-25275949 GAGGGGGTGCGGAAGGAGGAGGG + Intronic
927858395 2:26541898-26541920 GAGCAGCTGCCTCAGAAGGAAGG - Intronic
930040070 2:47115349-47115371 GAGCAGATCCAGAAAGAGGAAGG - Intronic
930110631 2:47675800-47675822 GGGCAGATGGGGAAGAAGGAAGG + Intergenic
930349094 2:50226509-50226531 GAGGAGAAGCACAAGGAGGAGGG + Intronic
931799657 2:65746492-65746514 GAGCAGAAGGAGCAGGAGGAAGG + Intergenic
932402223 2:71488958-71488980 GAGGAGCAGCTGAAGGAGGAAGG - Intronic
932569805 2:72932638-72932660 GAACAGATGCTGGAGGAGGAGGG + Intronic
932772526 2:74508340-74508362 GAGCAGATGCCGAAGGAGGAGGG + Exonic
933249598 2:80014256-80014278 GAGCAGAAGCTGCAGGAGGAAGG + Intronic
933275881 2:80283881-80283903 GAGGAGAGGGAGAAGGAGGAGGG + Intronic
933309327 2:80640301-80640323 TAGCAGATTCTGAAGGAGCAAGG + Intronic
935172259 2:100619616-100619638 GAGCAGGTGCCCATGGAGGGTGG + Intergenic
935844714 2:107153345-107153367 CAGCAGATGCGGAAGGGTGAAGG - Intergenic
936346778 2:111681530-111681552 GAGCAGATGGAGAAATAGGAAGG - Intergenic
937490232 2:122359471-122359493 GAGGAGAAGACGGAGGAGGAGGG - Intergenic
943089973 2:183362700-183362722 GAGGAGATGTCCAAGGAGAAGGG + Intergenic
944876593 2:203968789-203968811 GAGCAGAGGCAGAGAGAGGAGGG - Intergenic
945489183 2:210434775-210434797 CATAGGATGCCGAAGGAGGAGGG - Intronic
946394565 2:219436635-219436657 GAGGAGATGCCGATGGAGGGAGG - Intronic
946467246 2:219922821-219922843 GGCCAGATGCCCAAGGAAGAAGG - Intergenic
946907578 2:224431187-224431209 GAGAAAATGCAGAAGAAGGAAGG + Intergenic
947933715 2:233985276-233985298 GAGCAGCTTCCCAAGAAGGAAGG - Intronic
947952733 2:234161942-234161964 GAGCACAGGCTGAGGGAGGAGGG - Intergenic
948023636 2:234758207-234758229 GAGGAGATGGGGAAGAAGGAGGG - Intergenic
948526819 2:238575936-238575958 GCGCAGTGGCTGAAGGAGGAGGG - Intergenic
1169185823 20:3616466-3616488 GAGCTGATTCCTAAGGAGCATGG + Intronic
1169318014 20:4609205-4609227 GAGCAGGGGCAGAAGGAAGAGGG + Intergenic
1170770782 20:19330583-19330605 AAGCAAATGTGGAAGGAGGAGGG + Intronic
1171091615 20:22290729-22290751 GAGCAGATGCTGTGGGAGGCTGG + Intergenic
1172778608 20:37422771-37422793 GGGCAGAGGAGGAAGGAGGAGGG - Intergenic
1173205668 20:40991256-40991278 GGGCAGATGTCTAAGGAGCAGGG + Intergenic
1173616127 20:44403956-44403978 GAGGAGAGGCCGAGGGAGAAAGG + Intronic
1175127160 20:56760910-56760932 CATCAGCTGCCGAAGGAGGAAGG - Intergenic
1177156610 21:17507227-17507249 GAACACATGCCGAAGGTGGGCGG - Intergenic
1178416662 21:32410742-32410764 GAGCTGAGCCCGAGGGAGGAAGG - Intergenic
1178745265 21:35243448-35243470 GAGGAGATGGAGAAGGAAGAGGG - Intronic
1178973154 21:37199081-37199103 GGGCAGATGCTGCAGAAGGAGGG - Intronic
1178977741 21:37234045-37234067 GAGCAGGTGCCCAGCGAGGAAGG - Intronic
1179025064 21:37673184-37673206 GAGCAGAGGCTGGAGGAAGAGGG + Intronic
1179540349 21:42079585-42079607 GGGCAGATCTAGAAGGAGGAAGG + Intronic
1179571098 21:42279362-42279384 GAGCAGACGCAGGAGGCGGAGGG + Intronic
1183248212 22:36710122-36710144 GATCTGATGCCAAAGGAGGCTGG + Intergenic
1183481165 22:38066333-38066355 GAGGAGATGCGGAGGGGGGAAGG - Intronic
1183777036 22:39972961-39972983 GGGCAGATGGTGCAGGAGGAGGG + Exonic
1184067239 22:42127799-42127821 GTGCAGGGGCCGAGGGAGGAAGG - Intronic
949143490 3:664957-664979 GTGCAGATGCCCTATGAGGATGG - Intergenic
949242711 3:1890933-1890955 AAGAAGATGGAGAAGGAGGAGGG - Intergenic
949349483 3:3110998-3111020 GAGCAGATGCAGAAAGATGGTGG + Intronic
950187986 3:10957235-10957257 CAGCAGATGCAGAAGCAGGAGGG + Intergenic
953253382 3:41266152-41266174 GAGCAGAGGCCTGAGGAGGTTGG - Intronic
953707749 3:45244032-45244054 GAGGAGATGCTGGATGAGGAGGG - Intergenic
954718539 3:52539580-52539602 GAGCAGGTGCCAAAGAAAGATGG + Intronic
955819557 3:62881715-62881737 CAGCAGAGGCAGAAGCAGGAAGG - Intergenic
956659695 3:71584620-71584642 GAGGAGAGACCGAGGGAGGACGG - Intergenic
958576243 3:95952497-95952519 GAGCAGATGCTGCAACAGGAGGG + Intergenic
959539903 3:107525327-107525349 GAGGAGAGGGAGAAGGAGGAGGG + Intronic
960998200 3:123353134-123353156 GACCAGAAGCCTAGGGAGGAAGG - Intronic
961608278 3:128114668-128114690 GTGCAGATGCCTAATGAGGCAGG - Intronic
961917018 3:130386906-130386928 GAGCAGATGCAGATGGAGTGAGG + Intronic
962353459 3:134673375-134673397 GAGCTGATGGCCAGGGAGGAGGG - Intronic
963058036 3:141203396-141203418 GAACATATGCCCAAGGTGGATGG + Intergenic
963066996 3:141271903-141271925 GAGCTGCTCCCAAAGGAGGATGG + Intronic
965764014 3:172110700-172110722 TAGCAAGTGCCCAAGGAGGAGGG + Intronic
966257165 3:177930221-177930243 CAGCAGAAGCCCAAGGTGGAAGG + Intergenic
966344517 3:178963790-178963812 GATCAGAGGCCTAAGGAGGCAGG - Intergenic
966431411 3:179834556-179834578 GAGCAGAGGGGGAAGGAGTAGGG + Intronic
966502550 3:180659474-180659496 GAACAGATGCAGAAGAGGGATGG - Exonic
967148990 3:186630987-186631009 GAGCAGATTTGGAAGGGGGAGGG - Intergenic
969261259 4:6035626-6035648 GTGCAGATGCTGGAGAAGGAGGG + Intronic
969598344 4:8161453-8161475 GAGCTGAGGCTGGAGGAGGAGGG - Intergenic
975160944 4:71122744-71122766 AAGGAGATGCCGAGGGGGGATGG - Intergenic
977685839 4:99846893-99846915 GAGCAGGTGGCAAAGAAGGAAGG + Intronic
980175055 4:129334462-129334484 AAGCAGAGGCCAAAAGAGGATGG + Intergenic
982873877 4:160620001-160620023 GTGCAGATGCAGAAAGAGGGTGG - Intergenic
983945991 4:173585958-173585980 GAGAAGATGCCGAGGGAAGGCGG - Intergenic
984213560 4:176880171-176880193 GAGCAGCTGCTGAGGTAGGAAGG + Intergenic
985129701 4:186726907-186726929 GAGACGCAGCCGAAGGAGGAGGG - Intergenic
985345049 4:188995512-188995534 GAGCAGAAGCAGAAGGACAAAGG + Intergenic
985721689 5:1492924-1492946 GAGCAGATGACGAACGACCATGG + Intronic
985907522 5:2852601-2852623 GAGCAGAGGCAGAAAGAGCAAGG - Intergenic
986482652 5:8204350-8204372 TAGCAGAAGGTGAAGGAGGAAGG - Intergenic
987097201 5:14560581-14560603 GAGCAGATTGTGAATGAGGAGGG - Intergenic
987287813 5:16476334-16476356 GAGCAGATTATAAAGGAGGAGGG - Intronic
988841355 5:35086948-35086970 GAGAAGATGGGGAAAGAGGAAGG - Intronic
989425579 5:41291699-41291721 GAGCAGTTGCAGAAAGAGGGTGG + Intergenic
990607595 5:57426191-57426213 TAGCAGATGCTGATGGAGGGAGG + Intergenic
992769718 5:80035560-80035582 GACCAGGTGCAGCAGGAGGACGG - Exonic
993550549 5:89268378-89268400 GAGCAGATGACCTAGGGGGAAGG - Intergenic
994816270 5:104591779-104591801 TAGCAGGTGGAGAAGGAGGAGGG - Intergenic
995323598 5:110865581-110865603 GCACAGATGCCTTAGGAGGATGG + Intergenic
997349160 5:133217850-133217872 GATCAGCCGCCGAGGGAGGATGG - Intronic
998406844 5:141878815-141878837 GAGCAGGTGCCCAGGGAAGAAGG - Intronic
999051138 5:148524921-148524943 GAGCAGGTGCCTCAGGAGCAGGG + Intronic
1000010112 5:157223132-157223154 GAGCAGAGGCAGAAGGAAGAGGG + Intronic
1001543710 5:172557110-172557132 GAGCAGAAGCAGGAGGAGGGAGG - Intergenic
1002352440 5:178592412-178592434 GAGCAGAGGCAGAAGGAAGAAGG + Intergenic
1003064186 6:2889297-2889319 GACCAGGTGTCAAAGGAGGATGG + Exonic
1007367714 6:41406635-41406657 AAGCAGAAGCAGAAGGAGGTTGG + Intergenic
1007790496 6:44305705-44305727 GAGCTGATGCTGGAGGAGAAAGG - Exonic
1010287389 6:74094889-74094911 GACCAGAAGCCAAAGGATGAGGG + Intergenic
1011253021 6:85392984-85393006 GAGAAGTTGCTGAAGGAGAAGGG + Intergenic
1011332831 6:86228660-86228682 GAGCACATGCCAAAGCAGGGTGG - Intergenic
1011618777 6:89222541-89222563 GAGCAGATGCAGAACGGGGGTGG - Intronic
1013071097 6:106729996-106730018 GAGCAGGTGGAGAAGGAGGGAGG + Intergenic
1015254649 6:131164400-131164422 GAGCAGGTGCTGAGAGAGGAAGG + Intronic
1015452642 6:133388929-133388951 GAGCAGAAGCAGAAGGACGTGGG - Intronic
1017132219 6:151117457-151117479 GAGCAGATTCAGAAGGAGTGAGG + Intergenic
1017743521 6:157427172-157427194 GAGCACAGGAGGAAGGAGGAAGG + Intronic
1017995971 6:159531960-159531982 GAGCAGCAGCAGAAGGAGAAGGG - Intergenic
1018449192 6:163890891-163890913 GAGGAGTTGAAGAAGGAGGAGGG - Intergenic
1018478716 6:164168823-164168845 GAGCAGATGCCCAGGAATGAAGG + Intergenic
1018676467 6:166226494-166226516 GAGCACATGCCGAAACAGTAAGG + Intergenic
1019943980 7:4312209-4312231 GAGCAGAAGCAGAGGGAGGGAGG - Intergenic
1021616151 7:22505100-22505122 GAGAAGAGGAAGAAGGAGGAAGG + Intronic
1022349251 7:29551555-29551577 GAGAAGAGGATGAAGGAGGAGGG + Intergenic
1022925942 7:35056316-35056338 GAGAAGAGGAAGAAGGAGGAAGG + Intergenic
1023160154 7:37289052-37289074 GAACAGATGCCCAAGAAGAATGG + Intronic
1024295993 7:47842748-47842770 GAGCAGCTGCAGAAGGTGAAGGG + Intronic
1027051677 7:75025026-75025048 GGGCAGATGCCGAGGGAAGCCGG + Intergenic
1028376320 7:90149235-90149257 GAGAAGAGGAAGAAGGAGGAAGG - Intergenic
1029823948 7:103171006-103171028 GAGAAGAGGAAGAAGGAGGAAGG + Intergenic
1030113242 7:106044031-106044053 CAGCAGATGCCACAGGAGGAAGG + Intergenic
1030318504 7:108140702-108140724 GAGCAGAGTGGGAAGGAGGAAGG + Intergenic
1030775616 7:113530643-113530665 GATCAGATGCAGCAGGAGCAAGG - Intergenic
1031196424 7:118620260-118620282 GAGGAGATGCTGGAGGAGGCTGG - Intergenic
1031197102 7:118628933-118628955 GAGGAGATGCTGGAGGAGGCTGG + Intergenic
1031688948 7:124765162-124765184 CACAAGATGCCAAAGGAGGAAGG - Exonic
1032427590 7:131833946-131833968 GAGCAGAAGCCGACTGTGGAAGG + Intergenic
1032669396 7:134069408-134069430 GAGAAGAGGAGGAAGGAGGAAGG - Intergenic
1033275323 7:139967315-139967337 GAGCAGATGGCCAAGGAGAATGG + Intronic
1035023876 7:155814389-155814411 GAGGAGATGCCAAGGGTGGAAGG - Intergenic
1035579211 8:729386-729408 GGGAAGGTGCCGCAGGAGGAGGG - Intronic
1035670633 8:1414506-1414528 GAGCAGAAGCGGAAGGTGGCGGG + Intergenic
1036156937 8:6350875-6350897 AAGCAGAGGCCGGAGGAGGTGGG + Intergenic
1037589798 8:20303335-20303357 GAGCAGGGGCCGCAGGAAGAGGG - Intronic
1038780057 8:30562431-30562453 GAGCAGGTGAGGAAGGAGTATGG + Intronic
1039986530 8:42452453-42452475 GAAGAGATGGAGAAGGAGGAAGG + Intronic
1041081806 8:54221601-54221623 GACCAGATGCTGCAGGCGGATGG - Intergenic
1041347883 8:56920442-56920464 GAGAAGACGGAGAAGGAGGAAGG + Intergenic
1043765328 8:84123708-84123730 GAACATATGCCCAAGGTGGATGG - Intergenic
1044320071 8:90791689-90791711 GCGCAGAGGCCGGAGGAGGGAGG + Exonic
1045747485 8:105440678-105440700 GAGAAGATGCAGGAGCAGGAGGG + Intronic
1046963741 8:120139577-120139599 GAGCAGATGCTAAAAAAGGAAGG - Intronic
1047128593 8:121991344-121991366 GAGCAGTTGTCCAAGGGGGAAGG + Intergenic
1047433613 8:124815757-124815779 GAACAGATGCAAAAGGAAGAAGG + Intergenic
1047618438 8:126582187-126582209 GAGCTGATAGAGAAGGAGGAAGG - Intergenic
1047710765 8:127550142-127550164 GGGCAGATAGCCAAGGAGGAAGG + Intergenic
1047756611 8:127923747-127923769 GGGCACATGGAGAAGGAGGAAGG + Intergenic
1048019264 8:130523364-130523386 GAGGAGATGCTCAAGAAGGAAGG - Intergenic
1048333929 8:133489466-133489488 GAGCAGCTACCCAAGGTGGAGGG - Intronic
1049277170 8:141725710-141725732 GAGCAGCTGCAGAGGGAGGGAGG - Intergenic
1049351653 8:142167847-142167869 GGGCAGGTGCAGAGGGAGGAAGG - Intergenic
1049510942 8:143026370-143026392 GAACAGATCCGGAGGGAGGAGGG + Intergenic
1050833782 9:10050147-10050169 GAGCAGATCCCCAAGAATGAGGG + Intronic
1051804147 9:20972900-20972922 CAGCAGATGCTGAAAGAAGAGGG - Intronic
1051804156 9:20973002-20973024 CAGCAGATGCTGAAAGAAGAGGG - Intronic
1051804174 9:20973211-20973233 CAGCAGATGCTGAAAGAAGAGGG - Intronic
1051804182 9:20973316-20973338 CAGCAGATGCTGAAAGAAGACGG - Intronic
1051804217 9:20973707-20973729 GAACAGATGCTGAAAGAAGAGGG - Intronic
1052618114 9:30869253-30869275 GAGCAGCTGTCTTAGGAGGATGG - Intergenic
1053073821 9:35116226-35116248 GAGAAGGGGCGGAAGGAGGAGGG - Intronic
1053184959 9:36008230-36008252 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1053306531 9:36988019-36988041 GAGAAGATGAAGAAGGAGGGAGG + Intronic
1054883470 9:70170555-70170577 GAGCAGCTGGCACAGGAGGAGGG + Exonic
1055053379 9:72001290-72001312 AAGGGGATGCAGAAGGAGGATGG + Intergenic
1056795270 9:89654887-89654909 GAGCAGTTGCAGCAGAAGGATGG - Intergenic
1057739767 9:97701172-97701194 GAGCCGAAGGAGAAGGAGGAGGG - Intergenic
1057925017 9:99138670-99138692 GGTCAGATGCTGAAGAAGGAAGG + Intronic
1059319119 9:113454051-113454073 GAGCAGCTGAGGCAGGAGGATGG - Intronic
1059340415 9:113594702-113594724 GAGCAGCTGCCCTAGGGGGAAGG + Intronic
1061144829 9:128791512-128791534 GAGCAGCAGCCGCAGGAGGCAGG - Intronic
1062166326 9:135109443-135109465 GAGAAGAAGCCGCAGGAGAAGGG + Intronic
1062362203 9:136193408-136193430 GAGCAGGAGCCGGAGGAGGTCGG + Intergenic
1186452478 X:9685041-9685063 GAGCAGATGGGGTAGGAGGATGG + Intronic
1186878487 X:13840566-13840588 GAGCAGTTGCCCAAGTAAGAAGG + Intronic
1188287650 X:28347719-28347741 CACCAGATGCGGAAGGAGGGAGG - Intergenic
1188323440 X:28769767-28769789 GAGCAGATGCAGCAGCAGTAGGG - Intronic
1196975357 X:121152833-121152855 GAGTAGATGGGTAAGGAGGAGGG - Intergenic
1200492877 Y:3850111-3850133 GATAAGATGCCCATGGAGGATGG + Intergenic
1202088496 Y:21163704-21163726 GAGCAGGTGCAGATGGAGGAAGG + Intergenic