ID: 932773476

View in Genome Browser
Species Human (GRCh38)
Location 2:74514273-74514295
Sequence GAGCCAGGCTCAGCGCGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 211}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932773476 Original CRISPR GAGCCAGGCTCAGCGCGGGA GGG (reversed) Intronic
900415900 1:2534544-2534566 GAGCCAGGCTGACCTGGGGAAGG + Intergenic
900484436 1:2914740-2914762 GGGCCAGACTCAGAGCAGGATGG + Intergenic
900503418 1:3017505-3017527 GAGGCTTGCTCAGCGCGGGTGGG + Intergenic
901173323 1:7279967-7279989 CAGCCAGGTCCAGAGCGGGAGGG + Intronic
902090974 1:13902965-13902987 GAGTAAGGCTCAGCCCGTGATGG + Intergenic
902383563 1:16064047-16064069 GATCCAGGCACAGGGCAGGAGGG - Intronic
902722447 1:18313060-18313082 GGGCCAGGATCAGCCCTGGATGG - Intronic
903788233 1:25875365-25875387 GAGCAAGGCTCCGCGGGGCAGGG - Intergenic
905572412 1:39016266-39016288 GAGCCAGGCTTATGGTGGGAGGG - Intergenic
906318131 1:44800951-44800973 GGTCCAGGCTCAGCGGGCGAGGG + Intronic
910260008 1:85285154-85285176 GAGCCAGGCACAGAGCAGCAAGG - Intergenic
913174573 1:116262320-116262342 GAGCCAGGCCCGGGGAGGGAGGG - Intergenic
914838894 1:151231411-151231433 GAGCCAGCCTCAGCTAGGCAAGG - Intronic
915250272 1:154583144-154583166 GAGGCAGGCTCAGCTCCTGAAGG + Exonic
915828666 1:159105096-159105118 GAGCCAGGCACAGAGCAGCAAGG + Intronic
915835616 1:159172810-159172832 TAGCCCGGCCCAGGGCGGGAGGG - Intronic
916876087 1:168971114-168971136 GAGCGAGGCCCAGTGGGGGAAGG + Intergenic
919727662 1:200894619-200894641 GAGCCAGGGTCAGGACAGGAGGG + Intronic
919987954 1:202689005-202689027 GGGCCAGCCTCAGCAAGGGAGGG + Intronic
922800205 1:228361659-228361681 GAGCCAGCCTCGGGGCTGGAGGG - Intronic
923056124 1:230426568-230426590 CCGCCACGCGCAGCGCGGGAGGG + Intergenic
923471578 1:234295497-234295519 GAGCCAGGCTGAGCTTGAGAGGG + Intronic
1063965604 10:11343892-11343914 GTGCCAGGCACGGCGCTGGATGG + Intergenic
1064859785 10:19815602-19815624 GACCCCAGCCCAGCGCGGGAGGG - Intergenic
1065025146 10:21534276-21534298 GGGCCAGGGGCAGCGAGGGAGGG - Intronic
1067220187 10:44338317-44338339 GAGGCTGACTCAGAGCGGGAGGG - Intergenic
1069676313 10:70251239-70251261 GAGCCAAGCCCAGAGCTGGATGG - Exonic
1069910717 10:71757584-71757606 GAGCCAGGCTTATCCTGGGAAGG + Intronic
1069995659 10:72340753-72340775 GCGCCAGGGACAGCGCGGGAAGG - Intronic
1070479701 10:76870235-76870257 GACTCAGGGTCAGCGTGGGAAGG - Intronic
1074813304 10:117126245-117126267 GAGCCGGACTCAGCGTGGGTCGG + Intronic
1075102396 10:119515695-119515717 GAGCAGGGCTCAGGCCGGGAAGG - Intronic
1076060930 10:127413458-127413480 GAGCCAGGCTCCCCGCTGGAGGG - Intronic
1076718913 10:132384116-132384138 GAGCCAGGGGCAGCCCTGGAGGG - Intergenic
1076743504 10:132500109-132500131 GAACCAGGCTCAGCCCATGATGG - Intergenic
1077061952 11:621398-621420 GGTCCAGCCTCAGGGCGGGACGG + Exonic
1077181696 11:1219827-1219849 GAGCCAGGCCCAGCCCTGGGTGG - Intergenic
1077436645 11:2542609-2542631 GAGCCAGGAGCAGCGGAGGAGGG - Intronic
1077888225 11:6401724-6401746 GGACCAGGCTCAGCACTGGATGG - Intronic
1080003987 11:27385314-27385336 GAGCCAGGGTCAGCGCCTGTAGG + Exonic
1080929992 11:36799873-36799895 GAGTAAGGCTCAGGGCGTGATGG - Intergenic
1082819810 11:57537340-57537362 CTGCCAGGCTCAGGGCGGAAGGG + Intergenic
1083634223 11:64111493-64111515 GAGCCTGGCTCAGTGCAGAAGGG + Intronic
1083653754 11:64219399-64219421 GAGCCAGTCCCAGGGCAGGAAGG + Intronic
1084008294 11:66334571-66334593 GGGCCCGGCTCAGCGCCTGACGG + Exonic
1085205838 11:74731390-74731412 GAGGGAGGCTGAGCGCGGGCCGG + Intergenic
1088425472 11:109696901-109696923 CACCCAGTCTCTGCGCGGGAAGG - Intergenic
1088911804 11:114197843-114197865 GTGCCAAGCTCAGGGCAGGAGGG - Intronic
1089133724 11:116232746-116232768 GCTCCAGGCTCAGCGCTGTAGGG - Intergenic
1089588077 11:119522587-119522609 GAGCCTGGCTCGGTGGGGGAAGG - Intergenic
1089910011 11:122088585-122088607 GAGCCAGGATCAGGGCATGAAGG + Intergenic
1090358945 11:126159756-126159778 GGCCCAGGCTCAGCACGGGAAGG - Intergenic
1092942228 12:13420581-13420603 GAGCAAGGCACAGGGCGGGGTGG - Intergenic
1095270674 12:40215074-40215096 GAACAAGGCTCAGTGGGGGAGGG - Intronic
1095443955 12:42266850-42266872 GAGCCAGGCACAGAGTGGGGAGG + Intronic
1096534325 12:52261465-52261487 GAACCAGGCTCAGAGCATGAAGG + Intronic
1097198096 12:57255493-57255515 GAGCCAGCCTCTGAGTGGGAAGG - Intronic
1102500283 12:113347314-113347336 CTTCCAGGCTCAGCGAGGGAAGG + Intronic
1103941569 12:124504048-124504070 AACCCAGACTCAGCGTGGGAGGG + Intronic
1104034878 12:125091327-125091349 GAGCCAAGGTCAGAGTGGGAAGG - Intronic
1105783598 13:23725753-23725775 GAGCCAGGCACAGGGCTGGTGGG - Intergenic
1115478262 14:33836729-33836751 GAGGCAGGCCCAGGGAGGGATGG - Intergenic
1116448395 14:45038396-45038418 GAGCCAGGCACAGAGCGGCGAGG + Intronic
1119474589 14:74919839-74919861 GAGCCAGCCCCAGCGCGGTGAGG - Exonic
1119905448 14:78297967-78297989 CAGCCTGGCCCAGCGCAGGAAGG - Intronic
1121677353 14:95764722-95764744 GAGTAAGCCTCAGCGAGGGAAGG - Intergenic
1122350120 14:101084193-101084215 GAGCCAGGCACAGAGGGGAACGG - Intergenic
1122599632 14:102914876-102914898 GTGCAAGGCCCAGCCCGGGAGGG - Intergenic
1122812384 14:104295477-104295499 GAGCCAGGCTCAGCACAGCAAGG + Intergenic
1123966758 15:25467228-25467250 GATGCAGGCTCAGCTCAGGAAGG + Intergenic
1124478692 15:30059160-30059182 GAGCCCAGCTCAGCCTGGGATGG - Intergenic
1124612822 15:31220235-31220257 GACACAGGCTGAGCGGGGGATGG - Intergenic
1129464584 15:75716716-75716738 CAGCCAGGCTCAGGATGGGAGGG + Intergenic
1129720662 15:77876296-77876318 CAGCCAGGCTCAGGAGGGGAGGG - Intergenic
1129936148 15:79451656-79451678 CAGCCATGCCCAGCGCGGCAGGG - Intronic
1131535748 15:93236317-93236339 GACCCAGGCTCAGTGTGGGCTGG + Intergenic
1132722198 16:1321902-1321924 GAGCCAGGCTGAGCCTGGGGTGG - Intronic
1132741453 16:1415104-1415126 GAGCCAGGCACCGGGCGGAAGGG + Intergenic
1132986266 16:2769208-2769230 GGGCCAGGCTTAGCAGGGGAAGG - Exonic
1133171212 16:3983544-3983566 GGGCCAGGCACAGGGCAGGAAGG + Intronic
1135335813 16:21599943-21599965 TAGCCGGGCCCAGCGCGGGAAGG - Intronic
1135516653 16:23141209-23141231 GAGCCAGGAGGAGAGCGGGATGG - Intronic
1136549961 16:30977742-30977764 GAGCCTGGCTCAGGGCGCCAGGG + Intronic
1136618534 16:31412991-31413013 GAATCAGACACAGCGCGGGAGGG - Intronic
1137396044 16:48116812-48116834 GTGGCAGGCTCAGCCCAGGATGG + Intronic
1137693417 16:50445710-50445732 GTGCCAGGCACAGAGGGGGAAGG + Intergenic
1138363359 16:56451634-56451656 GAGCCCGGCCCAGCCCGGGTGGG + Exonic
1138599727 16:58047296-58047318 GAGCCAGGCACAGAGAGAGATGG + Intergenic
1139448627 16:67013903-67013925 GAGCCAGGCTCAGCCCCAGGTGG - Intergenic
1140189031 16:72798624-72798646 GAGCCTGGGTCAGCAGGGGATGG + Exonic
1140203288 16:72912181-72912203 CTGCCAGGCTCCGCGCGGGGAGG + Intronic
1142115239 16:88352941-88352963 GAGCCAGGCCCAGCCTGGGGTGG + Intergenic
1142280874 16:89146924-89146946 GAGCCAGGCTGAGCTCAGAAAGG + Intronic
1142291069 16:89193784-89193806 GAGGCAGGCTCAGCGCTGTCGGG - Exonic
1143509020 17:7385036-7385058 GAGAAGGGCTCAGCGTGGGAGGG + Intronic
1143527026 17:7479027-7479049 GAGCCAGGCAGAGAGGGGGAGGG - Intronic
1143600128 17:7939722-7939744 GAGCCAGGCTCAGCTGGAAAGGG + Exonic
1144970504 17:19106262-19106284 GACTCAGGCTCAGAGCTGGAAGG + Intergenic
1144990807 17:19232424-19232446 GACTCAGGCTCAGAGCTGGAAGG + Intronic
1145077441 17:19867601-19867623 GAGCCAGGGTCAGCGAGGCCCGG + Exonic
1146063269 17:29617967-29617989 GCGCCAGCCACAGCCCGGGAAGG + Intronic
1147319175 17:39635839-39635861 GTGCCAGGCTCAGAGGGGGAAGG - Exonic
1148687324 17:49508163-49508185 GCGCCAGGCAGAGCGCAGGAAGG + Intronic
1151687998 17:75660910-75660932 GAGCCAGGCCCAGACCAGGAGGG + Intronic
1152350422 17:79781199-79781221 CAGCCAGGCTCTGCGAGGGCTGG + Intronic
1152551144 17:81030955-81030977 GAGCCAGGCTTCCCGCGGCAAGG + Intergenic
1158744753 18:60187393-60187415 GAGCCACCATCAGCCCGGGATGG - Intergenic
1161112216 19:2476820-2476842 GAGACAGGCCCACGGCGGGAGGG - Intronic
1161209212 19:3057510-3057532 GAGGCAGGCTCAGCCCAGCAGGG + Intronic
1161953965 19:7482765-7482787 GCGCCAGGCACAGTGCGGCAAGG + Intronic
1162558417 19:11401962-11401984 GACCCAGGCTCAGCTGGGGTGGG + Intronic
1163378230 19:16947344-16947366 GAGCCATGCTCCCCCCGGGAAGG + Intronic
1163678262 19:18666278-18666300 GAGCCAGGCTCAGGGCTACAGGG - Intronic
1163934043 19:20425129-20425151 GAGCCTGGCTCAGCTCAGGGAGG - Intergenic
1163958024 19:20661772-20661794 GGGCCTGGCTCAGCTCAGGAAGG - Intronic
1163983391 19:20923033-20923055 GAGCCTGGCTCAGCTCAGGAAGG + Intergenic
1164305830 19:24003469-24003491 GAGACAGGCCCAGTGAGGGAGGG + Intergenic
1165058854 19:33195144-33195166 TCTCCAGGCTCAGCGCGGGCGGG - Intronic
1166377345 19:42335044-42335066 AAGCCAGGCTCACAGCGGCATGG - Exonic
1167234006 19:48302937-48302959 GAGGCAGGCTGAGGGAGGGAAGG + Intronic
1167272515 19:48513846-48513868 GAGGCAGGTTCATCGCGGGAGGG + Intergenic
1168404322 19:56102980-56103002 GTGCAAGGCCCAGGGCGGGAGGG + Intronic
925008151 2:461478-461500 GAGCCTGGCTGAGCTCAGGATGG + Intergenic
925610258 2:5696387-5696409 GACCCAGGCTACGAGCGGGAGGG + Exonic
926101437 2:10120731-10120753 GACTCAGGTTTAGCGCGGGAGGG + Intergenic
926292181 2:11539932-11539954 GAGCCAGGCTCTGCACAGCAGGG + Intronic
927513087 2:23656744-23656766 GAGCCAGGATTAGCACGGGGTGG + Intronic
927574459 2:24189895-24189917 GAGCCAGGCTGCTCGGGGGACGG + Intronic
927577135 2:24209157-24209179 AAGACAGGCTCATCGCTGGAAGG + Exonic
927697333 2:25247250-25247272 GAGTCAGTCTCAGCCCTGGAGGG + Intronic
928216664 2:29367159-29367181 GTGCCAGGCTCTGTGCTGGAGGG + Intronic
928216670 2:29367200-29367222 GTGCCAGGCTCTGTGCTGGAGGG + Intronic
928975605 2:37083842-37083864 TGGCCAGGTGCAGCGCGGGAGGG - Intronic
932773476 2:74514273-74514295 GAGCCAGGCTCAGCGCGGGAGGG - Intronic
934562281 2:95319599-95319621 GAGCCAGGCCAAGGGCGGGCAGG - Intronic
935351489 2:102154944-102154966 GAGCCATGCCCAGGGCAGGAGGG - Intronic
936286589 2:111185978-111186000 GAGGCAGGCACAGTGCGGGTGGG + Intergenic
941596171 2:167479950-167479972 GAGGCAGACTCAGCGCATGAGGG - Intergenic
948814207 2:240501703-240501725 GCACCAGGCACAGTGCGGGACGG + Intronic
948866530 2:240777796-240777818 GAGCCAGGCCCAGAGCAGGGAGG - Intronic
949000629 2:241610794-241610816 GAGCCAGGGACAGCGAGAGACGG + Intronic
949050292 2:241894324-241894346 GCCCCAGGCTCCGCGTGGGATGG - Exonic
1168849229 20:965278-965300 TAGCCAGGCTCAGGGAGGGACGG + Intronic
1169340936 20:4795708-4795730 GAGCCAGGGTCAGGGCTGGCTGG + Intronic
1169557629 20:6767720-6767742 GAGCCGGGCGCAGCGCGGCGGGG - Exonic
1172030992 20:31981982-31982004 CAGCCAGGCCCAGCTTGGGAAGG - Intronic
1174085740 20:48006132-48006154 GAGCCAGGCTAAGAGCAGCAGGG - Intergenic
1174119240 20:48249906-48249928 GAGGGAGGCTCAGCTCGGCAGGG + Intergenic
1175220534 20:57414164-57414186 AAGACAGGCTCAGAGCGGGGAGG + Intergenic
1175929120 20:62485285-62485307 GAGGCAGGCGCAGCCTGGGACGG - Intergenic
1175981487 20:62741010-62741032 CGGCCAGGCTCAGCGAGGGGAGG + Intronic
1176973136 21:15289348-15289370 GAGCCAGGCACAGAGCGGTGAGG + Intergenic
1181235886 22:21447415-21447437 GACCCAGGCTCAGCCCCGGAGGG - Exonic
1181329024 22:22074926-22074948 GAGTCAGGCTCAGTGAGGGCAGG - Intergenic
1183211698 22:36455256-36455278 TGGGCAGGCTCGGCGCGGGAGGG + Intergenic
1183546062 22:38455362-38455384 GAGCTGGGCGCAGCGGGGGACGG - Intergenic
1183702356 22:39457616-39457638 GCGCCAAGCGCAGCGCGGGAGGG - Intronic
1184214621 22:43058576-43058598 TAGCCCGGCTCACCCCGGGATGG + Intronic
1184229876 22:43152615-43152637 GAGCCAGCCTCAGCCCAGCAGGG + Intronic
1184973228 22:48042841-48042863 GAACCAGGCTCAGGTCGGGGTGG + Intergenic
950456748 3:13097241-13097263 AAGCAAGGCTCAGAGAGGGAAGG + Intergenic
951039995 3:17979419-17979441 GTGCCAGGCACAGCAAGGGATGG - Intronic
955414574 3:58680333-58680355 GAGCCAGGCTCTGAGTGGGTGGG + Intergenic
959398360 3:105869037-105869059 GACCCAGGCTCGGGGCGGGGCGG + Exonic
961371789 3:126435857-126435879 GAACCAGGCTCAGCCTGGCATGG - Intronic
961535345 3:127567280-127567302 GGGCCAGGCCCTGCACGGGATGG + Intergenic
961975315 3:131018304-131018326 GTGCCAGGCTCAGTGCTGGAGGG - Intronic
962362766 3:134755644-134755666 GAGCCAGGCTGAAAGAGGGATGG - Intronic
966761771 3:183425640-183425662 GTGGCAGGCTCAGGGCAGGAAGG - Intronic
967890205 3:194359426-194359448 GACCCAGGCCCAGAGCGGGCTGG - Exonic
968273925 3:197425444-197425466 GTGCCAGGCACAGTGCTGGAAGG - Intergenic
972571246 4:40312346-40312368 GAGCAAGGCTCAGCTTGGGATGG - Intergenic
973922968 4:55708014-55708036 GAGCCAGGCTCAGTGGGCGTAGG - Intergenic
977257617 4:94758157-94758179 GAGCGAGGGGCGGCGCGGGACGG + Intronic
978944057 4:114472822-114472844 GAGCCAGGCACAGAGCAGGGAGG - Intergenic
988225348 5:28405127-28405149 GAGCCAGGCATAGAGCGGCAAGG - Intergenic
989459696 5:41683366-41683388 AAGCCAGGCACAGCCCGGGTGGG - Intergenic
991086895 5:62655980-62656002 GAGCGAGGCTCTGCGCGTGTAGG - Intergenic
991089289 5:62678570-62678592 GAGCGAGGCTCTGCGCGTGTAGG + Intergenic
996795688 5:127343892-127343914 GAGCCAGGCTCACCTTGTGAAGG + Intronic
997349751 5:133222158-133222180 GAGACAGGCTCTGGGCAGGAGGG + Intronic
1001868704 5:175131277-175131299 GTCCCAGGCTCAGAGAGGGAGGG - Intergenic
1001967428 5:175921126-175921148 GACCCAGGCTCAGGTAGGGAAGG - Intronic
1002789114 6:424806-424828 GCGCCAGGCCCAGCACGGGAAGG - Intergenic
1004074907 6:12336229-12336251 CAGCCAGGCTCTGCCCTGGAGGG - Intergenic
1007581116 6:42960749-42960771 GAGCCAGGCGCGGCGCAGGATGG + Exonic
1012709676 6:102582787-102582809 GAGCCAGGCGCAGTGCAGCAAGG - Intergenic
1014968860 6:127790742-127790764 GAGCCAGGCACAGAGCGGTGAGG + Intronic
1018892286 6:167990599-167990621 GAGCCGGGCGCAGCGGGGCAGGG - Intergenic
1020014720 7:4824295-4824317 GAGCCAGGCTCAAGGCTGGACGG + Intronic
1020105310 7:5420026-5420048 AAGCCAGGGACAGCCCGGGAAGG + Intronic
1020136898 7:5592716-5592738 GCCCCTGGCTCCGCGCGGGAGGG - Intergenic
1020431757 7:8122641-8122663 GAGCCAGGCTAAGCCAGGAATGG + Intronic
1022528311 7:31052312-31052334 AAGCCAGGCTGGGCGCTGGAGGG - Intergenic
1023397226 7:39762537-39762559 GAGCCAGGGTCAGCGTGAGTTGG + Intergenic
1023993807 7:45146482-45146504 GAGCCAGGCTCACCCAGGGCTGG + Intergenic
1024655652 7:51449370-51449392 GCACCAGGCTGAGCCCGGGAAGG - Intergenic
1025135445 7:56407929-56407951 GAGCCAGGGTCAGCGTGAGTTGG - Intergenic
1029147738 7:98458695-98458717 GAGCCAAGCTCAGAGAGGGAAGG - Intergenic
1032862723 7:135895967-135895989 GAGCCAGGCTCAGTGAGGGAAGG + Intergenic
1034256557 7:149727904-149727926 GGCCCAGGCACAGGGCGGGAGGG - Intronic
1035293975 7:157857453-157857475 GTGGCAGGCTCGGCGCGTGATGG + Intronic
1035418252 7:158706957-158706979 GAGCCAGGTGCAGAGCGGCAAGG + Intergenic
1037504476 8:19516608-19516630 GAGCAAGGCTCACACCGGGATGG - Intronic
1037902375 8:22695304-22695326 GAGCCGGGCTAGGTGCGGGAGGG + Intergenic
1041274537 8:56143298-56143320 GAGCCAGGCACAGAGTGGCAAGG - Intergenic
1043798534 8:84578094-84578116 GAGCCAGGCACAGAGTGGCAAGG + Intronic
1044115302 8:88327713-88327735 GAGCCAGGCAGACCCCGGGAAGG - Intronic
1048445995 8:134493743-134493765 GAGCTTGGCTCAGCCGGGGAGGG - Intronic
1048857179 8:138695224-138695246 GTGCCAGGCTCTGAGCTGGAGGG - Intronic
1049749812 8:144277769-144277791 CAGCCAGGCCCAGCGCCCGAAGG + Intronic
1051126533 9:13811603-13811625 GAGTCAGGGTCAGGGTGGGAGGG - Intergenic
1052609732 9:30757924-30757946 GAGCCAGGCTCAGAGCAGTGAGG + Intergenic
1052837798 9:33264656-33264678 GGGCCTGGCTCAGCGCGGGGGGG - Exonic
1053173253 9:35905630-35905652 GAGCCTGACTCAGCCCCGGAGGG + Intergenic
1053877212 9:42557265-42557287 GAGCCAGGCACAGAGCAGCAAGG + Intergenic
1054234482 9:62544457-62544479 GAGCCAGGCACAGAGCAGCAAGG - Intergenic
1055530318 9:77177389-77177411 GAGCCGGGCTCGGCGCGAAAAGG + Intronic
1057665191 9:97039199-97039221 CAGCCAATCGCAGCGCGGGAAGG - Intronic
1057814574 9:98285164-98285186 GAGCCAGGCTGAGGGCCGGAGGG - Intergenic
1060431044 9:123551784-123551806 GTGCCCGGCTCAGGGCGGGGAGG - Intronic
1061241753 9:129378554-129378576 GAGGGGGGCTCAGCGGGGGAAGG + Intergenic
1061368870 9:130186862-130186884 GAGCCAGGCTGAGCACAGCACGG - Intronic
1061909855 9:133716762-133716784 GAGGCCAGCTCAGCGGGGGAAGG - Intronic
1062067582 9:134537093-134537115 GGGCCAGGATCAGCGGGGGCAGG + Intergenic
1062329253 9:136029837-136029859 GAGCCAGGCACAGAGCAGCAAGG - Intronic
1062646331 9:137550501-137550523 GAGCCAGGCCCAGCGCGGCGGGG + Exonic
1186457569 X:9722061-9722083 GAGACAGGGTCAGCGGGGCACGG - Intergenic
1186680006 X:11862667-11862689 GAGCCAAGCTCAGCCAAGGAAGG - Intergenic
1186998526 X:15150077-15150099 GAGCCAGGCTGAGAAGGGGAAGG - Intergenic
1189382722 X:40513258-40513280 GGTCCAAGGTCAGCGCGGGAGGG + Intergenic
1192141620 X:68651483-68651505 GGGCCTGGCTCAGAGAGGGAGGG - Intronic
1195675869 X:107506925-107506947 CAGCCAGGGGCAGCGCGAGAGGG + Intergenic