ID: 932773582

View in Genome Browser
Species Human (GRCh38)
Location 2:74514607-74514629
Sequence CGCCCGTGCCAGCCGCTGCC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 201}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932773582_932773591 15 Left 932773582 2:74514607-74514629 CCCGGCAGCGGCTGGCACGGGCG 0: 1
1: 0
2: 0
3: 19
4: 201
Right 932773591 2:74514645-74514667 CACAGGGATGCTGCTGTTTCGGG 0: 1
1: 0
2: 1
3: 25
4: 238
932773582_932773592 16 Left 932773582 2:74514607-74514629 CCCGGCAGCGGCTGGCACGGGCG 0: 1
1: 0
2: 0
3: 19
4: 201
Right 932773592 2:74514646-74514668 ACAGGGATGCTGCTGTTTCGGGG 0: 1
1: 0
2: 0
3: 23
4: 174
932773582_932773593 23 Left 932773582 2:74514607-74514629 CCCGGCAGCGGCTGGCACGGGCG 0: 1
1: 0
2: 0
3: 19
4: 201
Right 932773593 2:74514653-74514675 TGCTGCTGTTTCGGGGACCCCGG 0: 1
1: 0
2: 1
3: 8
4: 164
932773582_932773588 -1 Left 932773582 2:74514607-74514629 CCCGGCAGCGGCTGGCACGGGCG 0: 1
1: 0
2: 0
3: 19
4: 201
Right 932773588 2:74514629-74514651 GCGGCTGCTCCGGGTGCACAGGG 0: 1
1: 0
2: 2
3: 12
4: 141
932773582_932773587 -2 Left 932773582 2:74514607-74514629 CCCGGCAGCGGCTGGCACGGGCG 0: 1
1: 0
2: 0
3: 19
4: 201
Right 932773587 2:74514628-74514650 CGCGGCTGCTCCGGGTGCACAGG 0: 1
1: 0
2: 0
3: 16
4: 133
932773582_932773590 14 Left 932773582 2:74514607-74514629 CCCGGCAGCGGCTGGCACGGGCG 0: 1
1: 0
2: 0
3: 19
4: 201
Right 932773590 2:74514644-74514666 GCACAGGGATGCTGCTGTTTCGG 0: 1
1: 0
2: 1
3: 11
4: 176
932773582_932773586 -10 Left 932773582 2:74514607-74514629 CCCGGCAGCGGCTGGCACGGGCG 0: 1
1: 0
2: 0
3: 19
4: 201
Right 932773586 2:74514620-74514642 GGCACGGGCGCGGCTGCTCCGGG 0: 1
1: 0
2: 0
3: 25
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932773582 Original CRISPR CGCCCGTGCCAGCCGCTGCC GGG (reversed) Exonic
900206164 1:1432772-1432794 CCCCCGTGCCAGCAGCAGCTGGG - Intergenic
903281753 1:22254138-22254160 TGCCCATGCCAGCCTCTCCCCGG - Intergenic
903652368 1:24929916-24929938 CGCCCGCGCCGGCCGCCCCCGGG - Intronic
905457342 1:38097317-38097339 GGCCCGTGCCACCCCTTGCCTGG + Intergenic
907810762 1:57867386-57867408 CTCACTTGCCAGCCTCTGCCTGG + Intronic
907850397 1:58249977-58249999 CCGCCGCGGCAGCCGCTGCCTGG + Intronic
908165992 1:61459533-61459555 GGCCCGTCCCTGCCGCCGCCAGG + Intronic
909354784 1:74696132-74696154 CACCCGTGTCAGCCTCTGACTGG + Intergenic
910138397 1:83999078-83999100 CGCCCGTGGCAGCCACGGCTCGG + Exonic
914672529 1:149882384-149882406 TGCCCATGCCATCCACTGCCTGG + Intronic
915559184 1:156676623-156676645 CGCCCGGCCCAGCCGCTCGCGGG + Exonic
918243749 1:182641693-182641715 GCCCTGTGCCAGCCACTGCCAGG + Intergenic
920066536 1:203273489-203273511 CGCCTCTGCCGGCCGCTGCCGGG - Intronic
920173257 1:204084492-204084514 AGCCCCTGCCAGCACCTGCCTGG - Intronic
920310821 1:205047282-205047304 CACCCCTGCCAGCTGCAGCCTGG + Intronic
921903835 1:220475893-220475915 CACCCGGGCCAGCGGCTGCGGGG - Intergenic
923497602 1:234538871-234538893 CGCCCGGGACTGCCGCAGCCTGG - Intergenic
1065522284 10:26584539-26584561 CGCCAGTGCCAGCCGCAAGCGGG + Intergenic
1065726076 10:28668880-28668902 CGCCCGAGCCCGCCCCTCCCCGG - Intergenic
1067030524 10:42876572-42876594 CCACCGTGCCAGGCGCTGCATGG - Intergenic
1067103682 10:43351063-43351085 CGCGCGTGCCAGTCAGTGCCTGG + Intergenic
1067298449 10:44989455-44989477 TGCCCGTGGCAGAAGCTGCCTGG + Intronic
1068591756 10:58860147-58860169 GCCCCATGCCAGCCGCTGCATGG + Intergenic
1069808093 10:71138416-71138438 CCCCAGTGTCAGCGGCTGCCGGG - Intergenic
1069858178 10:71453236-71453258 CAGCAGTGCCAGGCGCTGCCTGG - Intronic
1070427488 10:76303842-76303864 CGAGCGTGTTAGCCGCTGCCTGG - Intronic
1070814515 10:79314303-79314325 CGCCCTTCCCGGCTGCTGCCTGG + Exonic
1073060551 10:100731039-100731061 AGCCAGTGCCCGCCGGTGCCCGG + Intergenic
1073440304 10:103548758-103548780 CACCTGTGACGGCCGCTGCCTGG - Intronic
1075680020 10:124325100-124325122 CGCACCTGCCAGCAGCTGCGGGG - Intergenic
1076869744 10:133187482-133187504 TCCCCGGGCCAGGCGCTGCCTGG - Intronic
1076898734 10:133326799-133326821 CACCCCTGCCACCCCCTGCCTGG + Intronic
1077273811 11:1694043-1694065 CCTCCGTGCCAGCCTGTGCCGGG + Intergenic
1084517101 11:69642994-69643016 GGCCCGTGACCGCCGCCGCCAGG - Intronic
1084576610 11:69992755-69992777 TCCCCGTGCCTGCCTCTGCCTGG + Intergenic
1084636834 11:70398552-70398574 CCGCCGCGCCAGCCGCTCCCAGG - Exonic
1085329451 11:75635837-75635859 CGCCCGTGTAAGGAGCTGCCAGG + Intronic
1089555984 11:119316237-119316259 CCGCCGTCCCAGCCGCTGTCCGG - Intronic
1089730551 11:120516292-120516314 CACCCCTGCCAGCTCCTGCCAGG - Intronic
1093970216 12:25369503-25369525 CACCCGGGCCAGCGGCTGCGGGG + Intergenic
1094199153 12:27779906-27779928 CGCCCGGGCCCGCAGCTTCCCGG + Intergenic
1096109081 12:49018633-49018655 CACCAGCGCCAGCCCCTGCCCGG + Intronic
1096647757 12:53047675-53047697 CGCCGCTGCCAGCTGCTGCCGGG - Intronic
1096677226 12:53232303-53232325 CTCCCCTGCCTGCCCCTGCCCGG + Intronic
1097164861 12:57078589-57078611 CCCCCTTGGCAGCTGCTGCCCGG + Intronic
1097281301 12:57846626-57846648 CACCCGGGGGAGCCGCTGCCCGG - Exonic
1097687551 12:62704901-62704923 CGCCTGAGCCAGACCCTGCCTGG + Intronic
1099439764 12:82686564-82686586 CAGCCGTGCCAGGCGCTGCCAGG + Intergenic
1099478671 12:83140256-83140278 CACCCGGGCCAGCAGCTGCGGGG + Intergenic
1101409506 12:104457110-104457132 CGCCGGCGGCCGCCGCTGCCTGG - Exonic
1101716618 12:107318380-107318402 CGCCCGTCCCACTGGCTGCCCGG + Intergenic
1102485501 12:113252636-113252658 TGCCGGTGCCAGCCCCTGCTGGG + Intronic
1102544683 12:113645978-113646000 AGCCCCTGTCAGCCTCTGCCAGG - Intergenic
1103786517 12:123436782-123436804 CGCCCCTGGCGACCGCTGCCAGG + Intergenic
1104843553 12:131835651-131835673 CACCCAGGCCAGCTGCTGCCTGG - Intronic
1104944750 12:132410577-132410599 GGCCCGTGTCTGCCGCTCCCAGG + Intergenic
1111085733 13:83373360-83373382 GGCCCATGCCAACCACTGCCTGG + Intergenic
1112326145 13:98443902-98443924 CCCCCGTGCCCGCCACTCCCTGG - Intronic
1113465216 13:110507865-110507887 CGCACCTGCCAGCCCCAGCCAGG - Intronic
1113657000 13:112073327-112073349 CGCCGGTGTCAGCCGCCGGCGGG + Intergenic
1113694363 13:112333307-112333329 TGCCCCTCCCAGCCCCTGCCTGG + Intergenic
1113831289 13:113297516-113297538 CGCCCGGTCCCGCCGCTCCCAGG - Intronic
1117547998 14:56808959-56808981 CGCCCGCGCCCGGCGCTGGCAGG + Intronic
1117963948 14:61188453-61188475 CGCCTGCCCGAGCCGCTGCCTGG - Intronic
1122275231 14:100587492-100587514 CGCCCCGGCCGGGCGCTGCCGGG - Intergenic
1122757962 14:103997567-103997589 CGCCCCCGCCAGCTGCTCCCTGG - Intronic
1122836063 14:104431702-104431724 GCCCCGTGCCAGCTTCTGCCTGG + Intergenic
1122905467 14:104799786-104799808 CTCCCATGCCAGCCCCTGTCCGG + Intergenic
1123023322 14:105412174-105412196 CCCCAGTGGCAGGCGCTGCCTGG + Exonic
1123680254 15:22757881-22757903 CGCCTGAGCCAGCGGCTGCTAGG + Intergenic
1124129294 15:26970860-26970882 CTCCCGTGCCCGCCGTCGCCCGG - Intergenic
1124332467 15:28832347-28832369 CGCCTGAGCCAGCGGCTGCTAGG + Intergenic
1126849920 15:52790525-52790547 CGCACGTGCCCGCAGCTCCCTGG - Intronic
1130108872 15:80949010-80949032 AGCCCCTGCCAGCAGCTGCCTGG + Exonic
1131272660 15:90956683-90956705 CCCCCGGGCCCGCCGCAGCCAGG + Exonic
1132886511 16:2184666-2184688 CCCCCGACCCCGCCGCTGCCAGG + Intronic
1132886665 16:2185225-2185247 GGCCAGTGCCGGCCCCTGCCTGG + Intronic
1133136772 16:3717637-3717659 CGCCCGAGCAGGCAGCTGCCCGG - Intergenic
1133734921 16:8607671-8607693 CACCATGGCCAGCCGCTGCCTGG + Intergenic
1139383574 16:66549796-66549818 CCCCCGTCCCAGCCGCAGCCGGG + Intronic
1141661754 16:85445223-85445245 CGCACGTGGCAGCTGCTCCCGGG - Intergenic
1142122003 16:88391107-88391129 CCACTGTGCCAGCTGCTGCCCGG + Intergenic
1142595159 17:1026363-1026385 CGCCCTTCCCATCCGATGCCTGG - Intronic
1148157992 17:45434224-45434246 CACCACTGCCAGCCACTGCCTGG - Intronic
1150389593 17:64782493-64782515 CACCACTGCCAGCCGCTGCCTGG - Intergenic
1150789855 17:68195411-68195433 CACTACTGCCAGCCGCTGCCTGG + Intergenic
1151802168 17:76384949-76384971 CGCTCGTGGGAGCCGCTCCCGGG - Exonic
1152135724 17:78502062-78502084 CGTCCATGCTAGCCACTGCCAGG - Intronic
1152404795 17:80091040-80091062 CGACTGTGTCAGCCGCTGCAGGG + Intronic
1152597784 17:81246321-81246343 TGCCCGTGCCAGACCCCGCCAGG - Exonic
1152744220 17:82031730-82031752 CGGCCGCGCCCGCCGCCGCCCGG + Exonic
1156391631 18:36656036-36656058 TGCCTGTGTCAGCAGCTGCCTGG - Intronic
1159040696 18:63320425-63320447 CGCCCGCGCCACCCACTGGCCGG - Intergenic
1159880620 18:73855322-73855344 CGCCCCAGCCAGCCTCTGGCAGG + Intergenic
1160592123 18:79950938-79950960 AGCCCGTGACAGCCTCGGCCAGG - Exonic
1160727494 19:623827-623849 CGCCCCTGCCACCCCCTGCACGG - Intronic
1160730556 19:639954-639976 CGCCCGCGCCAGCAGCAGCCAGG - Exonic
1160745376 19:708930-708952 CCCCCGCGCCCGCCGCCGCCCGG + Intergenic
1160826270 19:1081982-1082004 CGCCCCTTCCAGGCTCTGCCTGG - Intronic
1160909554 19:1468404-1468426 CCCGCGTGGCAGCTGCTGCCTGG - Exonic
1160996688 19:1885322-1885344 CGCCCGCCCCCGCCCCTGCCCGG + Intronic
1161162482 19:2768915-2768937 CGACTGTGCTGGCCGCTGCCCGG + Intronic
1161219779 19:3113229-3113251 CGCCCGGGCCAGCCGAGGCCTGG + Intronic
1162412993 19:10517611-10517633 CGCCTGTGCCAGTCGCCGCCGGG - Intronic
1162481499 19:10929336-10929358 CGCCCAGGCCAGCCTCTACCAGG + Exonic
1163113793 19:15177684-15177706 CCGCCGTCCCAGCCGCAGCCTGG + Exonic
1163218846 19:15899820-15899842 CACCCGGGCCAGCGGCTGCTCGG + Intergenic
1163423315 19:17227039-17227061 CCTCCGTGCCAGCCCCAGCCGGG + Exonic
1163506039 19:17706861-17706883 CCCCTGTGACTGCCGCTGCCTGG + Intergenic
1163631815 19:18421410-18421432 CTCCAGAGCCAGCAGCTGCCTGG - Intronic
1164575516 19:29403312-29403334 CACCTGTGCCTGCCACTGCCTGG - Intergenic
1165091411 19:33390011-33390033 CGCCCATGCTCGCCTCTGCCTGG + Intronic
1165487579 19:36104793-36104815 AGTCCGTGCCTGCTGCTGCCCGG - Exonic
1165793742 19:38506998-38507020 CGCCCCTTCCAGCCTTTGCCGGG - Intronic
1165924861 19:39320750-39320772 CGCCCCCGCCCGCCGCTCCCGGG + Intergenic
1166283495 19:41810076-41810098 CGCTCCTGCCAGTCACTGCCAGG + Intronic
1166888252 19:45973943-45973965 CGCCCGCGCCCGCCGCCCCCCGG - Intergenic
1167604940 19:50476616-50476638 AGCCCGGGGCAGCGGCTGCCGGG + Exonic
925048837 2:795690-795712 CGCCCGTGCCAGCTCCCCCCAGG - Intergenic
926126958 2:10277827-10277849 CGCCCGATGCTGCCGCTGCCCGG - Intergenic
927461795 2:23305693-23305715 TGCCTGTGCCAGCAGCTCCCGGG + Intergenic
932773582 2:74514607-74514629 CGCCCGTGCCAGCCGCTGCCGGG - Exonic
935971593 2:108534662-108534684 CGCCCGCGCCAGGCCCGGCCCGG - Intronic
936059180 2:109283344-109283366 CCCCATTGCCAGCCTCTGCCAGG + Intronic
936513175 2:113164791-113164813 TGCCCGTGCCTGCCCCTCCCAGG - Intronic
937905367 2:127050352-127050374 CGGCGGTGCCAGCCGCAGCCAGG + Intronic
940340095 2:152571109-152571131 TGCCCCTGCCAGAGGCTGCCAGG - Intronic
940751255 2:157628953-157628975 CGCCCGGGCCTGCTGCTGCAGGG + Exonic
941111766 2:161424240-161424262 CGCCCGGCCCCGCCGCGGCCCGG + Exonic
941904992 2:170711973-170711995 CCGCTGTGCCAGCCGCCGCCAGG + Intergenic
944728599 2:202497047-202497069 CACCCGGGCCAGCGGCTGCGGGG + Intronic
948115739 2:235493745-235493767 CGCGCCTGCCAGCTCCTGCCCGG - Intergenic
948603346 2:239119878-239119900 CCTCTGTGCCAGCCTCTGCCCGG - Intronic
948897837 2:240935422-240935444 CGCCTGTGCCAGCTGCTCCCCGG - Intronic
949032824 2:241805044-241805066 CGCCGGGACCAGCCGATGCCTGG + Intergenic
1172015605 20:31870729-31870751 CGCCCGCGCCTGCCGGTGCCAGG - Exonic
1175515807 20:59569014-59569036 TGCCTGTGCCACCCCCTGCCTGG - Intergenic
1176030111 20:63007630-63007652 CTTCCCTGCCAGCCGCTTCCTGG + Intergenic
1179925740 21:44533313-44533335 CGTCCGCGCCAGCCTCTGCAGGG - Intronic
1179989503 21:44939918-44939940 CGCCCGCCCGAGCCGCTTCCGGG + Intergenic
1180064235 21:45404917-45404939 CGCCCGTCCCCGCCGCCCCCGGG + Intergenic
1180879899 22:19196221-19196243 GGCTCCTGCCAGCCTCTGCCAGG - Intronic
1180921137 22:19522280-19522302 CACCTGTGCCAGCCCCTGCTGGG - Intergenic
1181288857 22:21775234-21775256 CGCACCTGCCAGCTGCTTCCCGG - Intronic
1181514035 22:23401543-23401565 GTCCCGTGCCAGCCCCTTCCAGG + Intergenic
1182355373 22:29720335-29720357 CGCCCGCTCCAGCCGCCCCCGGG + Exonic
1183733017 22:39628867-39628889 GACGCGTGCCAGCCTCTGCCAGG - Intronic
1183989200 22:41586828-41586850 CCACCGTGCCAGCCCATGCCTGG - Intronic
1184147888 22:42622282-42622304 CCTCCGCTCCAGCCGCTGCCTGG + Intronic
1184278744 22:43425555-43425577 GGCCCCCGCCAGACGCTGCCAGG - Intronic
950556430 3:13698866-13698888 ACCCCATGCCAGCCGCTGCCTGG + Intergenic
954277915 3:49554543-49554565 CGCCCGGGCCGGCGGCTCCCGGG - Exonic
956080185 3:65549231-65549253 AGCGCGTTCCAGCCGCTCCCCGG + Intronic
962653196 3:137516839-137516861 TGCCCCTTCCAGCCCCTGCCTGG - Intergenic
963163668 3:142178881-142178903 CTCTCGTGCCTGCCGCTGGCAGG - Intronic
968067188 3:195765150-195765172 CGCCCCTGGCAGCCCCAGCCTGG - Intronic
968081480 3:195849538-195849560 TGCCGCAGCCAGCCGCTGCCTGG - Intergenic
968515673 4:1014722-1014744 CACACGGGCCAGCCACTGCCCGG - Intronic
968547755 4:1207323-1207345 CGCCGGGGCCAGCCGGGGCCAGG - Intronic
968701320 4:2059454-2059476 CGGCCGTGCCCGCCGCCGCCCGG + Intergenic
969289439 4:6229316-6229338 TGCCCCTGCCATCCGCTGGCAGG - Intergenic
979674571 4:123397881-123397903 CGGCCGCGGCAGCCTCTGCCTGG + Intronic
985006011 4:185535666-185535688 CCCCCGCGCCCGCCGCGGCCCGG - Intergenic
985537388 5:472898-472920 CGCCCTTTCCCACCGCTGCCGGG - Exonic
985980174 5:3456337-3456359 GGCCCCTGCCAGCCCCTGGCAGG + Intergenic
986391249 5:7289861-7289883 CGCCTGAGCCAGCGGCTGCTAGG + Intergenic
989591954 5:43120894-43120916 CGCCCGTAGCTGCCGCTGCCGGG + Intronic
992487590 5:77210877-77210899 CGCCCGCGCCCGCGGCCGCCGGG - Exonic
997361715 5:133299459-133299481 CCCACCTGCCAGCCGCCGCCTGG - Intronic
997470842 5:134115852-134115874 CTTCAGTCCCAGCCGCTGCCAGG + Intronic
997533237 5:134595670-134595692 TGCCCTTGCCATCTGCTGCCAGG + Intergenic
1002342749 5:178527509-178527531 CACCCGGGCCAGCCGCTTCCTGG - Intronic
1002350180 5:178577604-178577626 CGCGCCTGCCCCCCGCTGCCTGG + Intronic
1002704214 5:181149200-181149222 CACCCCTGCCAGCCCCCGCCTGG - Intergenic
1003190779 6:3872467-3872489 GGCGGGTGCCAGCCGCTGTCTGG - Intergenic
1006620653 6:35361647-35361669 TGCTCCTGCCAGCCCCTGCCTGG + Intronic
1008030437 6:46688278-46688300 CGCGCGTGGCCGCCGCTTCCTGG - Exonic
1016010740 6:139135483-139135505 CCGCCGCGCCCGCCGCTGCCAGG - Exonic
1016541475 6:145170598-145170620 TGCCCGTGGCAACTGCTGCCTGG - Intergenic
1016934747 6:149441292-149441314 CTGCCCTGCCACCCGCTGCCTGG - Intergenic
1017497688 6:154995708-154995730 CCCCCGTGCCAGGCTGTGCCCGG - Intronic
1018768949 6:166955973-166955995 CGCCCTCCCCAGTCGCTGCCCGG + Intronic
1019644523 7:2121851-2121873 CTGCTGTGCCAGCCCCTGCCCGG - Intronic
1019729747 7:2623349-2623371 CCCCCCTGCCAGCCCCTCCCTGG - Intergenic
1019743773 7:2688418-2688440 CGCCCGTAGCCGCCGCCGCCCGG - Intronic
1020274343 7:6615619-6615641 CGTCCGTGCGGGCCGCTGGCCGG - Exonic
1021452776 7:20798056-20798078 CGCCCGCGGCCGCCGCAGCCCGG - Intergenic
1022559744 7:31336241-31336263 CACCCGCGCCAGCAGCTGCTCGG + Intergenic
1023862899 7:44226476-44226498 TGGCCGTGGCAGCGGCTGCCCGG - Intronic
1029530361 7:101121465-101121487 CTCCCCTGCCAGCCCCTGGCCGG - Intergenic
1031746652 7:125506524-125506546 CGCCCCTGGCAGCAGCTGCCTGG - Intergenic
1032344358 7:131105944-131105966 CGCGCGCGCCCGCCGCCGCCCGG - Intergenic
1032525624 7:132576877-132576899 CGCCCGGTCGGGCCGCTGCCCGG + Exonic
1036185882 8:6622060-6622082 CCCCAGTGCCGGGCGCTGCCAGG - Intronic
1036743973 8:11391005-11391027 CGCCAGAGCCAGCCGCAGCCTGG - Intronic
1037581804 8:20249803-20249825 CCCACGTGCCAGCTGCTGCAGGG + Exonic
1041378410 8:57225351-57225373 AGCCAGTGCCAGCTGGTGCCAGG - Intergenic
1042223323 8:66494566-66494588 CCCCTGTGTCAGCCGCTGACAGG + Intronic
1048497841 8:134949807-134949829 CCTCCGTGCCAGCTGCTGACAGG + Intergenic
1048953797 8:139517481-139517503 CTCCCTTTCCAGCCTCTGCCTGG + Intergenic
1049437176 8:142592126-142592148 CGCCCGAGTCAGCAACTGCCAGG + Intergenic
1049798280 8:144506314-144506336 CGGCTGTGCCCGCCGGTGCCAGG + Exonic
1051439857 9:17072742-17072764 CACCCGGGCCAGCGGCTGCGGGG + Intergenic
1053381236 9:37651005-37651027 CGACCGTGCCCGCCGCTGGGCGG + Intronic
1056699712 9:88892142-88892164 CCTCGGTACCAGCCGCTGCCAGG + Intergenic
1058982651 9:110184456-110184478 GGCTCTTGCCAGCTGCTGCCTGG + Intergenic
1061193262 9:129094370-129094392 CCCCAGGCCCAGCCGCTGCCAGG - Intergenic
1061212698 9:129202992-129203014 CGTCCGCGCCAGCGGCTGCCCGG - Intergenic
1061328127 9:129876265-129876287 CGGCTCTGCCAGCCTCTGCCTGG + Intronic
1061559727 9:131394468-131394490 CGCCCGGGCCCGCCGCCCCCAGG - Intronic
1062385784 9:136310994-136311016 ATCCCATGCCGGCCGCTGCCGGG - Intergenic
1062396214 9:136353884-136353906 CCCCAGTGCCACCCTCTGCCTGG + Intronic
1185747486 X:2584274-2584296 TGCCCGGGACAGACGCTGCCTGG + Intergenic
1189385249 X:40531680-40531702 TGCCCTCGCCAGCCTCTGCCAGG + Intergenic
1192340334 X:70258721-70258743 GGCCAGTGCCAACAGCTGCCTGG - Exonic
1195060747 X:101191624-101191646 CGCCCGGGGAGGCCGCTGCCCGG + Intergenic
1199699295 X:150364220-150364242 CGCCCGCGCTAGCCGGCGCCGGG - Intronic
1200000807 X:153058895-153058917 TGCCCCTGCCAGCAGGTGCCAGG + Intronic
1200209703 X:154341768-154341790 GGCACCTGCCCGCCGCTGCCGGG - Intergenic
1200216875 X:154371851-154371873 GGCCCCTTCCCGCCGCTGCCGGG - Intronic
1200221149 X:154390324-154390346 GGCACCTGCCCGCCGCTGCCGGG + Intronic